Hacker News Personal Blogs 2013 | All Blog Posts

"We Need to Talk About TED"

Zac Szewczyk — Tue, 31 Dec 2013 21:30:11 GMT

For everyone waiting on TEDx to release Ben Bratton’s “We need to talk about TED” video, here you go. Since reading his transcript I have kept the page open in anticipation of TEDx releasing this, and I still managed to miss it by a day. If you enjoyed the transcript, you’ll love the talk.

Permalink.

The case for 3x

Zac Szewczyk — Tue, 31 Dec 2013 19:58:31 GMT

The only thing I love more than listening to podcasts is writing about them. During the last curfuffle I wrote Podcasting State of the Union where I did my best to provide counterpoints for the flaws Harry Marks pointed out in the podcasting industry. To my delight, many agreed with me. After a few days the heat died down though, and I did not expect to have another opportunity to discuss this topic for a while. Then Ben Brooks decided to stir the pot once more with Why Tech Podcasts Bother Me, and many responded with wildly different opinions. Perhaps most notably, Andrew Clark and Zac Cichy of The Menu Bar surprised me in episode thirty-four by agreeing with the majority of Ben’s points.

Permalink.

Nerd, Decentralize Thyself

Zac Szewczyk — Tue, 31 Dec 2013 12:13:05 GMT

Back in April I linked to Rich Stevens’ announcement of a new newsletter he planned to begin publishing once or twice a week focusing on “A little business, a little gadgetry, a little art and writing, and a few dick jokes.” Since then I have enjoyed his seventeen posts immensely, and the latest was no exception: in Nerd, Decentralize Thyself¹ Rich Stevens spoke to the recent trend towards relying on platforms such as Tumblr and Twitter, and how despite liking both he would never forfeit ownership of his website. He went on to call for more people devoted to pointing out great work in order to solve the discoverability problem those aforementioned services aim to obviate as a way of decreasing our reliance on third parties to do great work and, hopefully, make building a website back into something cool again. If you find this description at all interesting, subscribe to the newsletter; you will not be disappointed.

Permalink.

We Need Coding in Schools, but Where are the Teachers?

Nicola Iarocci — Tue, 31 Dec 2013 02:00:00 GMT

Maybe instead of Coder Dojos for kids, we should run them for their teachers.

We must build a team of dedicated teachers to support school coding programs. We do not rely on our students to absorb math from textbooks, online videos or math clubs; similarly, we cannot depend on every student to learn to code on their own, by using online tutorials and afterschool clubs. If coding becomes as fundamental as reading and writing, we need to create a system where everyone has an opportunity to learn, not just the few who probably would have learned it on their own anyway.

Principles of good RESTful API Design

Thomas Hunter II — Tue, 31 Dec 2013 02:00:00 GMT

Responsive Design vs. Mobile-First

Dan Stroot — Tue, 31 Dec 2013 02:00:00 GMT

I have heard some people speak of "mobile-first" and "responsive design" interchangeably making them sound as if they were one and the same. However I think there are some subtle differences. I believe responsive design is the broadest possible definition. It says to me that we are going to target all platforms, screen sizes, pixel densities, etc. It means that the user experience will be custom tailored to the exact device you just happen to be viewing it with. This should be our ultimate goal, right?

This post Responsive Design vs. Mobile-First first appeared on Dan Stroot's Blog

Testing the Apple Tax

Zac Szewczyk — Tue, 31 Dec 2013 00:08:32 GMT

Prompted by an article Zach Epstein posted to BGR last Thursday titled Testing the ‘Apple tax’: What would it cost to build a Windows version of the new Mac Pro? I planned to link his piece as a smug counterpoint to all the people I know who like saying that they can build a more powerful machine for “1/3 the cost”¹ of my overpriced Apple computer. As I thought more about the notion of an Apple tax though, I realized I had more to say on this topic than a juvenile “ha ha”.

Permalink.

Paranoia

🦉 olshansky 🦁 — Mon, 30 Dec 2013 16:02:32 GMT

Olshansky's review of Paranoia

How to use Gmail more efficiently

Blog posts of Andreas Klinger — Mon, 30 Dec 2013 02:00:00 GMT

I usually I blog about Angellist but I have shown this “lifehack” to so many people that I thought it’s worth it’s own blogpost...

Alex Gaynor — About Python 3

Nicola Iarocci — Mon, 30 Dec 2013 02:00:00 GMT

A very interesting read if you’re into Python. Eve has been Python 3 compatible for a while and honestl, I would be surprised to find that somebody is running it in production under Python 3.

Why aren’t people using Python 3?

First, I think it’s because of a lack of urgency. Many years ago, before I knew how to program, the decision to have Python 3 releases live in parallel to Python 2 releases was made. In retrospect this was a mistake, it resulted in a complete lack of urgency for the community to move, and the lack of urgency has given way to lethargy.

Microsoft’s New Systems Language

Nicola Iarocci — Mon, 30 Dec 2013 02:00:00 GMT

Number #3 on Praeclarum’s list hits home for me, but all his points are both valid and strong.

As a programming language nerd I had mixed feelings when Jon Galloway tweeted about Microsoft’s new programming language.

“Why are your feelings mixed?” I kept asking myself. I love new programming languages. I took an internship at Microsoft just so I could be closer to the people who made C#. I read language specs for fun. I write compilers for fun. I sell a programming language, interpreter, and IDE.

What Happens When One of Your Coworkers Dies

Nicola Iarocci — Mon, 30 Dec 2013 02:00:00 GMT

I barely knew Colin. He sat two offices down from me, but we never worked on anything together, never laid eyes on each other after 5 p.m. Our relationship consisted, in its entirety, of work-related small talk in the break room, his lunch rotating behind us in the microwave. Ding, stir, have a good rest of your day.

via What Happens When One of Your Coworkers Dies | The Billfold.

How To Be Successful with a Standing Desk

Justin Garrison's Homepage — Mon, 30 Dec 2013 02:00:00 GMT

In January 2014 I will have been using a standing desk as my main desk for three years. Here are three tips

Preventing Wine from registering mimetypes

Carey Metcalfe — Sun, 29 Dec 2013 21:37:00 GMT

When installing Wine for Linux, the install script insists on associating all text files with its built-in notepad.exe

As someone who uses Vim almost exculsively, this is definitely not the desired behaviour.

To stop this from happening, run the following command before installing Wine.

export WINEDLLOVERRIDES='winemenubuilder.exe=a'

This sets the path of the winemenubuilder library (the library that creates mimetype associations) to something invalid, preventing the associations from being made when Wine installs.

Once Wine is installed, it won't try to associate notepad.exe again. However, if needed, the library can be properly disabled via the libraries tab of wineconf.

Introducing Instapaper Daily

Zac Szewczyk — Sun, 29 Dec 2013 17:06:02 GMT

From almost a week ago, midway through my Christmas vacation, Betaworks announced the latest in a slew of great improvements to the Instapaper platform: Instapaper Daily. Although I cannot say it will replace Tweetbot or Reeder as one of my primary sources for news and articles to read, I really like this as a service and as an indicator of the direction Betaworks plans on taking Instapaper.

In the past I have criticized Betaworks for both insufficient design sense in their web ventures and a lack of direction driving their product decisions. With the release of Instapaper Daily they have assuaged these misgivings, at least a little, by continuing to improve upon Instapaper’s core value proposition — improving one’s reading experience — and doing so beautifully: whereas Instapaper’s website remains an eyesore at best, Instapaper Daily presents its information in a clear, concise, and visually attractive manner.

Good for them.

Permalink.

Writer Pro

Zac Szewczyk — Sun, 29 Dec 2013 16:30:27 GMT

As soon as Information Architects released Writer Pro shortly before Christmas, I began collecting “first look” pieces after their phenomenal introductory video nearly caused me to shell out a hefty $40 to have the app on both my Mac and iOS devices sight on seen. Much more cautions after my poor experience with Coin though, I exercised a bit of restraint in choosing to wait until after Christmas to make my final decision. Nine days and one debacle later, I am very thankful I did.

Permalink.

Why 'greener' computing is coming soon to Europe

Welcome to Marco Fioretti's website! on Stop at Zona-M — Sun, 29 Dec 2013 11:15:26 GMT

(historical note: this is an article I wrote for IT Manager’s Journal, which published it at the URL http://management.itmanagersjournal.com/management/04/12/07/2312226.shtml?tid=84 on December 14, 2004. When I rediscovered the original text on my hard drive, on December 29, 2013, I put it back here with the original date as reference, since that whole website was closed years ago) The Member States of the European Union are getting ready to follow two directives that will have a deep impact on all the electronic industry.

A basic guide to when and how to deploy HTTPS

Nicola Iarocci — Sun, 29 Dec 2013 02:00:00 GMT

Many web developers know about SSL, but it is very common to see it only partially deployed, or not deployed where it should be. This basic guide on when and how to deploy SSL will help you avoid the most common mistakes.

via A basic guide to when and how to deploy HTTPS — Erik Romijn.

WarGames Magazine Identified

Nicola Iarocci — Sun, 29 Dec 2013 02:00:00 GMT

On seeing WarGames for the first time in the 1980s, I wondered which magazine it was. Later, after seeing it on TV and on VHS/DVD, the same question kept nagging at me. I believed that I would one day get to the bottom of this matter. I correctly assumed that the magazine was a real world magazine with a fake advertisement added to it. Through some effort and persistence I finally achieved my goal on 2013-02-24 at 5:30pm.

Why Good Programming Projects Go Bad

Nicola Iarocci — Sun, 29 Dec 2013 02:00:00 GMT

Fred Brooks wrote the software development classic The Mythical Man-Month almost 40 years ago. In this interview, Brooks explains why managers still make the same mistakes.

via Why Good Programming Projects Go Bad.

You Should Change Your Python Shell

Nicola Iarocci — Sun, 29 Dec 2013 02:00:00 GMT

If you write Python code, switching to IPython is the number one thing you can do to immediately improve your productivity. Bold words, I know. Let’s look at how IPython can make you a more productive programmer.

via You Should Change Your Python Shell | GrokCode.

Book Review: Debian 7: System Administration Best Practices

Thomas Hunter II — Sun, 29 Dec 2013 02:00:00 GMT

2013 Year in Review

Ben Overmyer's Site — Sun, 29 Dec 2013 02:00:00 GMT

A great deal happened in 2013 for me and my family. Sadly, though, I missed the mark on all six of my goals for the year. Despite that, I think 2013 can be counted a success in general.

My Goals for 2013

My first goal for 2013 was to release a computer game. For a variety of reasons, this never came close to completion. I overestimated my free time and, to be honest, my motivation. I ended up spending far more time developing tabletop games. I'll get into that in a second. My second goal was to join a local developer group. Technically, I succeeded at this, since I started going to MNPHP meetups for awhile. However, because I didn't sustain my attendance, I'm counting this one failed. There is promise here, though. My third goal was ambitious - take a vacation to Hawaii. Saving up the money to do so, especially amidst changing jobs, proved too difficult for me. My fourth goal, lead a yoga class, failed for more than just inability to do so. Most yoga schools these days seem to focus solely on the physical side of yoga, with no thought for the spiritual side. I had a moment of clarity when I realized that I couldn't get to the level of proficiency in just a year to be qualified to teach both the physical and spiritual sides. I may revisit this goal some year in the future, but not in the near tense. My fifth goal was well on its way to success when I sabotaged it by re-incorporating Dicejockey into my main site. Though I wanted to reach 1,000 visitors per month for at least one month in 2013, my desire to pull in everything to one destination representing me was greater than my desire to continue a blog dedicated solely to MMORPGs and tabletop RPGs. My sixth and final goal for 2013, to collaborate on a project with my sister Tasha, went fairly well for the first half of the year. Unfortunately, I think I was too ambitious in the project we chose to work on, because my contribution would have been a large number of artworks that my skill level and free time did not allow for. Still, this goal was inspiring, and I'll do something along these lines in 2014.

Major Happenings of 2013

I changed jobs twice this past year. The first time, I left Group 3 Marketing because I felt I was stagnating as a developer. I joined a startup called Sportsdigita and worked heavily on Symfony2 projects. While I certainly grew as a developer at Sportsdigita, the culture was damaging everything else about my life. In August, then, I left that company to work for the Minneapolis Star Tribune, the largest newspaper in Minnesota (and, possibly, the Midwest). The Star Tribune has proved to be a wonderful balance between interesting projects and good culture, and it doesn't hurt that it pays well, too. My contributions to Silver Gryphon Games grew this year. My efforts on the web side increased, and my interest in this side of the business is definitely heating up. I released the first web tool for Ingenium, and it's proved very useful - internally, anyway. I did more writing this year in previous years, releasing no less than three adventures for Ingenium. Two of those I did all the writing for, and the third I contributed a third of the final word count to. This also marked the first year where I managed a convention on my own, using the newly-minted “Booth 2.” All in all, 2013 was a successful year for me. I got back into tabletop gaming in a big way this year. I started what has become my longest-running D&D campaign ever. I started playing Warhammer 40k and Warmachine on a weekly basis with some good friends. I did a lot of miniature painting, and produced some works that I'm actually proud of, which hasn't happened before. I also began writing the rules for my own war game, and that could bode well for Silver Gryphon Games, based on early playtest feedback. I met several new friends and strengthened relationships with others. I've been more social-minded this year than the past couple years. I've definitely gone to more conventions this year than in past years, also.

Closing Thoughts

Many positive things happened this year, but I'm disappointed that I wasn't able to follow through with a single one of my goals. I grew as a developer, a gamer, and a person in general in 2013. Overall, despite the lack of goal completion, I think 2013 was a win for me. Here's to an even better 2014!

Bromptoning it up

Liza Shulyayeva — Sat, 28 Dec 2013 18:14:38 GMT

If you follow me on Twitter you likely would’ve seen my photos of a silly looking contraption with tiny wheels. Meet Deider, the Brompton folding bike:

Move to S3 and Octopress. Oh and #1GAM

Liza Shulyayeva — Sat, 28 Dec 2013 16:28:18 GMT

Octopress and S3

I’ve finally moved this site over to Octopress and S3. There is a lot of work to be done, the most pressing of which is fixing leftover broken images, implementing code highlighting, and fixing some theme stuff (like the navigation links), but other than that it’s going ok. The move overall was pretty hassle-free with no real problems. I ended up with the following setup:

How has your experience been relating to the use of a bluetooth keyboard with the iPad; specifically with the way iOS requires the activation of Voiceover to increase remote keyboard functionality. Personally I find the accessibility features in iOS second to non both keyboard and voice but wanted to pole for your experience and findings as I and I’m sure others may be interested to learn such things. Frustratingly how to copy and paste code outside of anything but screen or TMUX. Thanks (:

Yield Thought — Fri, 27 Dec 2013 21:27:08 GMT

Hi Edg3e,

I hadn't looked into using Voiceover to activate app switching and so on - that's... interesting. It takes away one of the few things I preferred about the Surface, whilst adding some of its own new annoyances. Progress, I guess?

I sympathize with the copy and paste - often I wanted to take some text from the console and put it into a bug ticket; I ended up writing a small script that uses our bug tracker's API to add a comment containing text from the command-line, and then extending it to automatically include the last stack dump and log file output. Surprisingly, this made me more productive than I had been with manually copying and pasting things all the time. That's something I found a lot while working with the iPad/Linode combination - things that were too uncomfortable to do the 'normal' way ended up being shoehorned into a 'console' way which often resulted in quite a bit of time-saving - and, crucially, attention-saving.

Typing a short command at the console gives me fewer temptations to check my email or notice a support ticket has been updated than switching to the browser does.

Mark

On What To Call SharePoint Developer-y Type People

Text(Greg); — Fri, 27 Dec 2013 16:56:49 GMT

A little more than a year ago, I was, as someone looking for .Net developers that knew the SharePoint API, frustrated by the confusion in the SharePoint space between the different kinds of developers that exist in the ecosystem. This confusion persists to this day, much to the detriment of

The Family

🦉 olshansky 🦁 — Fri, 27 Dec 2013 13:07:59 GMT

Olshansky's review of The Family

Samuel Hulick: User Onboarding Champion

Sam Solomon — Fri, 27 Dec 2013 02:00:00 GMT

Samuel Hulick is a user experience designer and runs useronboard.com. He is currently writing a book called User Onboarding.

2013-12-27

ho.dges.online — Fri, 27 Dec 2013 02:00:00 GMT

The organ hall at Kelvingrove Art Galleries & Museum in Glasgow.

Using Beyond Compare 4 Mac Beta with Git

Donat Studios — Fri, 27 Dec 2013 01:29:40 GMT

A little over a year ago I wrote a post about using Beyond Compare on Mac via Wine. A native version is now in beta and open to everyone! If you haven't tried Beyond Compare, I suggest you do. If you have you already know how awesome it is.

I've been testing the Alpha for many months now and thought I'd throw together some instructions for getting it going with git.

You can download the beta here: http://www.scootersoftware.com/beta.php

After you have the App installed, the next step is to install the command line tools. All other steps require this.

From the App, go to the "Beyond Compare" drop down menu and choose "Install Command Line Tools...". It will then prompt you for your password. After this, you bcomp file1.txt file2.txt

Using with Git CLI

The next step is to set it up as a git diff tool and merge tool. Git already has native support for it built in thanks to the Linux client having existed for years now.

This can be achieved simply by running the following commands.

$ git config --global diff.tool bc3
$ git config --global difftool.prompt false
$ git config --global merge.tool bc3

This simple setup will leave git diff and git merge functioning as usual, as well as allowing you to use Beyond Compare for the task by doing git difftool and git mergetool.

I highly recommend giving Beyond Compare a go as a merge tool next time you need to do a merge as it makes it wonderfully simple (when you understand whats going on with the 4 sections anyway).

Using with Tower 1.x

Update: Tower 2.0.6+ include built in support for Beyond Compare which the following instructions will interfere with.

Quit Tower
Navigate to ~/Library/Application\ Support/Tower
Create a CompareScripts folder if one does not already exist.
Download bcomp.sh and place it in the new CompareScripts folder.
Make it executable via chmod +x bcomp.sh
Download CompareTools.plist and place it in the ~/Library/Application\ Support/Tower directory. Rename / move any old version that might exist.

Using with SourceTree

Open SourceTree
Open "Preferences" from the SourceTree menu
Along the top bar, choose the "Diff" tab.
Under External Diff / Merge
1. for Visual Diff Tool choose Other then in the Diff Command enter /usr/local/bin/bcomp and for Arguments enter $LOCAL $REMOTE
2. For Merge Tool choose Other and in Merge Command enter /usr/local/bin/bcomp and for Arguments enter $LOCAL $REMOTE $BASE $MERGED

Catching Fire (The Hunger Games, #2)

Apurva Shukla's RSS Feed — Wed, 25 Dec 2013 10:00:00 GMT

⭐ ⭐ ⭐ ⭐ ⭐ This book was amazing, I was thinking that the amount of pages the book offers wouldn’t be able to tell a good story but this…

Yet Another Vim Setup

Tyblog — Wed, 25 Dec 2013 09:00:00 GMT

Figure 1: Sample screenshot editing my .vimrc

Vim is an excellent text editor. I've used it for many years and like most vim users, have collected a fairly large collection of settings in my .vimrc and learned how to grok my vim usage effectively through a lot of trial and error.

To that end, I've tried to assemble a useful overview of my experience with vim.

Foreword: Why?

Why would you want to even put in the effort to beef up vim?

Portability. Carry your IDE everywhere with minimal effort, possibly even in just a single dotfile. (insert plug for homeshick here)
Performance. Your IDE will start in under a second and you won't lose your mind if it crashes.
Improved speed and precision. It takes a long time - don't get me wrong - but once you learn how to use vim the way it wants to be used, you'll like it.
Vibrant community. This is one of hundreds of community resources for vim. If somebody has ever needed to do $task in vim, somebody has probably figured out a good way to do it.

Prelude: abide by these principles

A few things to keep in mind:

Stop working with the new-file-new-tab paradigm. Read this answer on Stack Overflow for more.
Don't start with a pre-built/huge .vimrc. Build gradually to learn what you're doing.
Learn how to learn vim. Be cognizant of what slows you down, update your .vimrc with shortcuts you know, rinse, repeat.

Essential Settings

I mentioned not to get ahead of yourself with a massive .vimrc off the bat, but there are a few settings that you just plain need initially.

set nocompatible
- This will get rid of antiquaited backwards-compatability settings and make vim a bit more usable.
set number
- Turn on line numbers. This one is pretty obvious.
set ruler
- Always display the status line at the bottom of the vim window (column, filename, etc.)
syntax on
- Although other plugins build on this, the basic setting is a must.

Essential Plugins

These are plugins I use every time I open vim.

Ctrl-P

This will change the way you work with files. Stop browsing/pointing and clicking as you look for files and invoke a fuzzy text search for your file instead. Seriously handy.

Vim-Airline

By default vim's interface isn't terribly informative. Vim-airline is much more lightweight than other alternatives (like vim-powerline, which requires a lot of configuring) and offers out-of-the-box usefulness. Note that powerline-fonts can be tricky, but the exchange for your effort is an especially pretty interface.

Good-to-have Plugins

Vundle

There are many ways of managing plugins, namely pathogen and vundle. I used pathogen for a long time but now use Vundle as it can automate things a bit more, but either is a good choice and handy if you use many plugins.

Syntastic

Syntastic offers syntax and style checking without being overly complicated. If you're coding professionally, syntastic is pretty essential as it'll catch dumb mistakes like syntax errors, functionality that is pretty much taken for granted in a traditional IDE.

Easytags

Tags are a pretty basic function of vim, but using them right can be challenging. To that end, I use vim-easytags to handle the bulk of what can make tags complicated. Again, for professional software development, it's plum necessary.

NERDTree

Although I mostly use Ctrl-P for navigating files, NERDTree is good to have around to visualize directory structure or when simply browsing code. vim's built-in netrw has similar functionality but is more finicky.

Putting it together

I've mentioned good plugins and settings, but how does it look?

If I were to hand you a template .vimrc, I'd start with this:

Vimrc

Font used to highlight strings.
Font used to highlight function names.
Font used to highlight constants and labels.
Font used for Vim’s configuration options.
Font used for Vim Ex commands.
Font used to highlight comments.
Font used to highlight comment delimiters.

" Basic settings
set nocompatible              " Eliminate backwards-compatability
set number                    " Enable line numbers
set ruler                     " Turn on the ruler
syntax on                     " Syntax highlighting

" Plugins
filetype off                  " Req'd for vundle
set rtp+=~/.vim/bundle/vundle " Vundle prelude
call vundle#rc()              " ^

Bundle 'gmarik/vundle'
Bundle 'scrooloose/nerdtree'
Bundle 'kien/ctrlp.vim'
Bundle 'scrooloose/syntastic'
Bundle 'bling/vim-airline'
Bundle 'xolox/vim-misc'
Bundle 'xolox/vim-easytags'

" Post-vundle
filetype plugin indent on     " Req'd for vundle

Then use vundle to install your bundled plugins:

shell

git clone https://github.com/gmarik/vundle.git ~/.vim/bundle/vundle
vim +BundleInstall +qall

You're ready to go. Let's look at a practical example.

Navigating the Jekyll codebase

Using jekyll (what I'm using to generate this site) as an example, I'll illustrate how this setup works. First, let's get the code, enter the code root, and start up vim. Note that we're starting vim with our working directory at the jekyll root.

shell

cd
git clone https://github.com/jekyll/jekyll.git jekyll-tmp
cd jekyll-tmp
vim

You're looking at the generic vim splash screen. Vim is extremely task-oriented – although you could certainly browse around code using NERDTree, let's assume that there's a method you want to refactor in here.

First, recursively generate tags for all files in your current working directory. This only needs to be done once in a new project, every subsequent save you perform will update your global tags file. Thus, within vim:

:UpdateTags -R .

Nice. This uses the easytags plugin. Now, let's assume you're been working on a file called build.rb, changing the way jekyll dynamically regnerates changed files. Use Ctrl-P to perform a fuzzy search for build.rb and jump right to it: Hit control-p, type 'build', and the file will be highlighted - then hit enter.

<Ctrl-P> build <Enter>

Now you're in build.rb. You know that jekyll uses a method called watch() to observe your template files, regenerating static HTML if anything changes.

You can get to watch() in a couple of different ways:

Just search for it. You may have to hit n a few times to jump to the right "watch" string, but it's simple and works. /watch<Enter>nnn
Use Ctrl-P's builtin fuzzy tag searcher: :CtrlPTag<enter>watch<enter>
Use vim's builtin tag navigator: :tag watch

Any of those commands will get you to the watch() method. Now, looking inside the method (browse with the hjkl keys), let's say you want to look more in-depth at the process_site method. Fine - place your cursor over the method call (line 53, column 16 in my build.rb) and hit Ctrl-]:

/process_site<enter><Ctrl-]>

Vim used its tags file as an index to jump to where process_site is defined. From there you can hit Ctrl-T to jump up one level in the tag stack you're working on.

Back in watch() (use :tags watch to get back there if you aren't) find a line and create a ruby syntax error (if you want to make the change I did, execute 53gg$x and save the file :w (my errors have a custom unicode character for errors, your error marker may be different.)

Figure 2: Vim errors are highlighted in the sidebar and in vim-airline's status bar

If syntastic is working (it should) it'll highlight your syntax error. Many filetypes work by default (like ruby), others like python require more effort (to install the syntax checker binary.) However, that's just a matter of installing a binary in your $PATH like flake8. Look in ~/.vim/bundle/syntastic/syntax_checkers to figure out what syntax checkers syntastic is looking for.

Also note that vim-airline is integrating with syntastic to show you any errors or warnings in its status bar (it denotes a syntax error – vim-airline will also alert you to whitespace errors and the like.)

As a final demonstration, enter :NERDTree (note that you can tab-complete these vim commands.) NERDTree will open up and you can browse the directory structure from here to get an overview of the the jekyll project. :q closes the window.

Post-exercise

This was a contrived example, but you can extrapolate from here. For example, as fuzzy searching for files is useful, fuzzy searching for tags is even moreso. Ctrl-P has a function for this. Here's the steps you'd take to implement a shortcut for yourself.

Look at Ctrl-P's help page. :help ctrlp
Search for tag support (search for tags with /tags<enter> and hit n a few times before you find what you want)
You'll find that the command :CtrlPTag exists which will search available tags.
Create a nice shortcut to invoke the command. The following snippet will work:

Vimrc

Font used for Vim Ex commands.

nnoremap <leader>t :CtrlPTag<CR>

Now <leader>t will open up Ctrl-P's tag search window. Leader commands provide you with a good starting point for custom commands – by default, <leader> is mapped to \. Thus the keystroke \t while in normal mode will open up the fuzzy tag search window.

Conclusion

This only scratches the surface of what you can do with vim, and I myself have a big .vimrc with lots of changes not mentioned here. As I mentioned, start with a basic foundation and gradually build up your .vimrc as you think of ways to streamline your workflow or run into nice plugins or settings around the Internet.

The Heavenly Gift Tag

trv.rs — Wed, 25 Dec 2013 02:00:00 GMT

For unto you is born this day in the city of David a Savior, who is Christ the Lord... And suddenly there was with the angel a multitude of the heavenly host praising God and saying, (Luke 2:11, 13 ESV)

When one picks a present for a loved one, the shopping and careful research brings joy. Concealing the chosen gift in beautiful wrapping paper can summon a smile as we imagine the look on our loved one's face when they discover and unwrap. The last and perhaps greatest joy is the reading of the tag and presentation of the gift, for the anticipation and joy meet at their highest point.

The tag and presentation for the Greatest Gift of all occurred two-thousand years ago on the rolling hillsides around Bethlehem. The angelic choirs proclaimed "To: All mankind From: God" to a bleary eyed and wondering group of shepherds, but even they could not fail to recognize the royal print on the wrapping paper and holy handwriting on the note.

Thank you, Heavenly Father, for the joy and surprise of the gift receiver is ours today and on every Christmas. Let our hearts be filled with warmth and true gratefulness in this season, and may we never set aside the desire for more of that Gospel joy until the day we celebrate in eternity with the Gift-Giver. May we glow with joy and praise as the angels did that night, and may your glory draw all men to yourself. In Jesus' name, amen.

On GitHub

Nemo's Home — Wed, 25 Dec 2013 02:00:00 GMT

I am an Internet addict. And the website I’m most addicted to is called GitHub. GitHub is a social code hosting website that is totally awesome. Not your general run-of-the-mill awesome, but rather ass-kicking best-thing-in-the-world awesome. If GitHub was a ninja, it would be Po, defeating the evil clutches of SourceForge.

When Linux was released a couple of decades ago, it was hosted on a university FTP server. Today, the days of FTP are way past, and unless your code is hosted on a code-sharing website like GitHub, it is as good as dead. The last decade has seen an explosive grown in software and the open source movement. Things like GitHub, Linux, Android, Facebook have been made possible due to the combine efforts of millions across the globe following the Unix philosophy of doing one thing well.

Ahh, I digress. The point I’m trying to make is that it is very hard to explain to a layman how important GitHub has been to the software community. It has been used as a collaboration platform for writers, law makers, governments, programmers, and even musicians. People have used its issue tracking feature to even plan weddings. And above all, people adore GitHub. It is one of the few startups that have been accorded God status in the community.

The question here is what makes GitHub tick? As the largest hosting site for code, it obviously makes a huge impact just by virtue of being there. But its tide of features and innovative progression had made it a darling of all. For instance, their 1 click to fork feature has allowed people to contribute to any project so much easier.

GitHub has an amazing User Experience, making sure it works perfectly on all devices large or small. Their amazing support makes sure all of its users are happy as possible. Their regular meetups makes sure that GitHub is invested in the software community themselves. And their GitHub Store lets people invest back in GitHub by romoting them via Tees, stickers and even laptop sleeves.

My personal experience with GitHub has been overwhelmingly positive. People have stood beside GitHub even as they faced major issues, and for me that is indicative of a trust in GitHub that no money can buy. The GitHub API (which I’ve used more than once) lets developers create their own apps on top of GitHub which others can use to create even more awesome things.

For me GitHub is more than just a coding website. It is a testament to creativity and the Hacker Way, reminding me every day that anything is possible.

Lifting Up My Soul

trv.rs — Tue, 24 Dec 2013 02:00:00 GMT

Let me hear in the morning of your steadfast love, for in you I trust. Make me know the way I should go, for to you I lift up my soul. (Psalm 143:8 ESV)

Jesus, this whole Psalm is the song of my heart today and encouragement to my soul. I feel downtrodden and alone, and am wondering where to turn. I feel condemned by my past failures, and am haunted by the ghosts of my sins. They gibber and scream in the corners of my mind, pointing ghastly fingers of accusation at me, dragging me into the pit with guilt and sorrow.

But I will not fall to this. I will like David think on your mighty deeds. I will make my mind dwell on the history of your grace throughout all time and your personal mercies to me and my family. How can I doubt such boundless and eternal love when it stretches throughout all of history and extends to giving of yourself for my salvation?

Do not hide your face from me. The more parched I am, the more I thirst for your goodness. Let me hear in the morning of your steadfast love. Let the first whisper of thought and word in my mind as I awake be “YOU ARE LOVED” and may I rest in this truth, putting to shame the enemies of my soul.

Image: Serenity by me

Solved: Jetty doesn't show errors on web application start-up

Databases & Life — Mon, 23 Dec 2013 02:00:00 GMT

From a certain version of the “jetty” package in Debian Linux, if the web application didn’t start up (servlet init() throws an Exception), this error wasn’t logged anywhere. The solution is to install the libjetty-extra package.

sudo apt-get install libjetty-extra

It took some amount of experimentation to find the solution. I don’t know why you’d ever want to not log errors; i.e. why the logging of errors is an “extra”.

Prisoners

🦉 olshansky 🦁 — Sun, 22 Dec 2013 15:30:58 GMT

Olshansky's review of Prisoners

Drew Magary's Fantastic Interview with Phil Robertson

Zac Szewczyk — Sun, 22 Dec 2013 12:04:59 GMT

Recently, Phil Robertson of the sensational cable TV program Duck Dynasty has drawn quite a bit of flack for his very Christian views kept largely hidden until now through A&E’s refusal to air his more candid statements. Setting personal opinions aside though and totally disregard the absurdity of crucifying Phil for his beliefs because today’s hyper-sensitive, disgustingly entitled society seeks to vilify everyone who challenges their nuanced values, and looking at this from an unbiased standpoint, a very interesting lifestyle emerges in Drew Magary’s article for GQ — incidentally, the article that started this whole debacle. The entire piece is excellent, but if I had to pick my favorite line it came down to Drew’s revelatory experience toward the end, for I can relate to that very feeling myself:

Permalink.

Frequency-based improvement

D13V — Sun, 22 Dec 2013 02:00:00 GMT

When I joined college I was a pretty bad swimmer. During freshman year I took some beginner/intermediate swimming classes and learned proper swimming technique for stomach crawl, breaststroke and butterfly. The next year I saw this class called Master’s swimming, spoke to the coach and signed up for it. I was by far the weakest swimmer in the class. Everybody else had great stamina and technique. We would do series of 50 metres swimming for 50 seconds and then 10 seconds break until the next series. In the course of an hour others would cover around 3km. In the beginning I had such a low stamina I would barely make it past 1. 5km per practice.

I thought that the coach would tell me to switch to a less demanding class, but to my surprise he never did. Instead he gave me advice how to swim better. Some of his advice was about the technique- “keep your head low when you breathe”, “insert your hand at an angle when you swim crawl- it takes less energy”. But he also had some mindset advice which I think generalizes very well to other parts of life -“When you are tired focus on performing your technique correctly” and “Frequency is more important than intensity [of the workout] “

At the time, both of those advices were counterintuitive to me. When I was tired I would preserve my energy by being lazy, half-assing my technique and slowing down, barely surviving through the rest of the practice. I thought this wasn’t that bad but the coach got me corrected. When I practiced with improper technique my movements would get worse and worse over time as the improper technique becomes the norm. As I focus on technique, it helped get my mind off the tiredness, and also conscously think about exactly what I was doing. Surprisingly, this also improved my technique even in cases where I thought I had it figured out.

Regading his second advice, that the frequency is more important than the intensity, I noticed that by going regularly to practice (which for me was twice a week) I would get in a better shape and be able to swim 2+ km per practice. It would also make it easier to keep improving as it would be easier for me to pick up from where I left off. Without regular practice even if we focus on doing quality effort we get off-shape and our muscles atrophy. Thats why I think that the second advice, that frequency is more important than intensity is stronger advice than the first one- focusing on correctness.

Focusing on correctness could also be possible in situations where it is not very clear what correctness means, but some feedback is available - in this case I would consider regular practice plus feedback to be a better way to learn and improve.

I’ve read of this study [1] that asked students to make as good of a clay pot as possible. The students were divided into two groups, the ones in the first would make a new pot every day, while the ones in the second would work on one pot for fifty days to reach perfection. The kids that did a new pot everyfday outperformed that were perfecting their single pot. Their pots had better quality.

Did the students in the second group only cared about completing their daily assigned pot? But also they had self produced feedback - they could look at the differences in their process and in their results from day to day, learn what makes for better results and improve. They had the benefit of being able to start anew and thus not getting stuck with bad choices. If they thought there was a better design they were free to try it. Going for quantity won over going for quality alone; frequency won over intensity.

Practicing regularly collects a lot of examples and experience for our brains to learn from. The more varied the experience the better the learning. Focusing on correctness when tired, when reaching our physical or knowledge limits allows us to generate more informative experience, bringing more clarity and skill.

Whenever, I’m trying to get good at something I try use these m advices for guidance - “frequency is more important than intensity”, and “focus on doing it correctly”, even though it might feel slower or more painful. There is the hope and the promise that after enough repetitions i will get good at it, just as the kids who built the clay pots got good at them. Starting small and not worrying about perfection helps me keep the frequency high until I gradually improve to the point where I can start focusing on correct technique.

[1] http://www.lifeclever.com/what-50-pounds-of-clay-can-teach-you-about-design

One Game a Month (#1GAM) Done!

Liza Shulyayeva — Sun, 22 Dec 2013 01:23:40 GMT

Well, One Game a Month is done! I’ve managed to complete 12 games for the year. My motivation by the end was lacking, so I took it kind of easy this month and made a very simple and quick game called Simon Says. Last month’s game, 9 to 5, took much longer due to the number of art assets required. I’ll write a proper post about the challenge, how everything went, etc later.

Vagrant vsftp and other tricks

The Technical Blog of James on purpleidea.com — Sat, 21 Dec 2013 13:58:49 GMT

As I previously wrote, I’ve been busy with Vagrant on Fedora with libvirt, and have even been submitting, patches and issues! (This “closed” issue needs solving!) Here are some of the tricks that I’ve used while hacking away.

Default provider:

I should have mentioned this in my earlier article but I forgot: If you’re always using the same provider, you might want to set it as the default. In my case I’m using vagrant-libvirt. To do so, add the following to your .bashrc:

The Hangover Part III

🦉 olshansky 🦁 — Sat, 21 Dec 2013 04:31:34 GMT

Olshansky's review of The Hangover Part III

Does Facebook Hate Christmas?

Kevin Ohashi — Sat, 21 Dec 2013 00:16:28 GMT

Linkbait title aside. This is the story of a holiday card gone wrong because of Facebook's advertising rules.

Backstory: I work at a co-working space in Washington, DC called Affinity Lab. This happened to one of my co-workers, Mike who works at a company called ISG.

His company created a virtual holiday card and shared it on Facebook. It seems innocuous enough. In his words 'it's a no brainer to boost posts for $5, it goes from 10% to 100% for us.' This wasn't the first time he's done this and he's never had any issues. He just wanted all his clients to see the post.

And then it wasn't boosted.

And then this notification came through.

So the issue was too much text in a holiday card.

So we checked out with Facebook's tool. And it was astonishing how they calculated that it broke the rules. I can imagine a lot of content that is really awesome that you couldn't promote if this rule is really strictly enforced (every infographic ever?). I understand the spirit of the rule, but in practice it seems quite flawed.

Python script to check last exec time and exit code of script

zufallsheld — Fri, 20 Dec 2013 20:30:00 GMT

I needed a script that checks:

whether a cronjob ran at its determined date (that means it runs regularly)
if the cronjob ran successfully

It should also be monitor-able via Nagios. That means, it should provide a meaningful output for when something went wrong with the cronjob, e.g. “CRITICAL …

[12.20.13] Electric Scooter MK01: (WITH SNOW-MODE)

transistor-man.com — Fri, 20 Dec 2013 10:38:38 GMT

Detailed build log of 7kw electric scooter

Kick-Ass 2

🦉 olshansky 🦁 — Fri, 20 Dec 2013 05:53:47 GMT

Olshansky's review of Kick-Ass 2

The Wolverine

🦉 olshansky 🦁 — Fri, 20 Dec 2013 05:53:36 GMT

Olshansky's review of The Wolverine

Testing a NAS hard drive over FTP

Linux Engineer's random thoughts — Fri, 20 Dec 2013 01:00:00 GMT

So I have this NAS made by my ISP, that does a lot of things; but recently, I started having issues with its behavior. Recorded TV shows had lag/jitter while replaying, and the same happened with other types of videos I put on it. I narrowed it down to …

Digging in with Foreign Tables

CRAIG KERSTIENS — Thu, 19 Dec 2013 22:55:56 GMT

I wrote a couple months back about exploring FDWs. Its become quite clear to me, despite still having ample room for improvement, they’re not getting enough attention. Foreign data wrappers are perhaps better thought of as a foreign table, or even better yet as a view into some remote data source. They don’t take care of auto-updating or syncing data, thats all up to you, but it gives you a straight forward mapping to work with remote data easier.

The first step in working with FDWs is getting them setup. I wrote an earlier post on how to do this manually. And if you’re on Heroku theres an even easier solution if you want to setup a mapping entirely from one DB to another. The pg-extras CLI plugin has a command fdwsql which will generate the SQL to map all the tables for you. To run it simply specify the prefix app and database:

heroku pg:fdwsql yourprefix APP::DATABASE_URL

This will generate a lot of SQL. From here you’ll want to connect to the database where you want those foreign tables to be visible. Then run all the SQL. This will create all the foreign tables, this will mostly look just like another view or table to you in \d.

Tips on working with them

For the most part you can work with your foreign tables just like any other view or table. You can insert into them, read from them, join against them. Though currently foreign tables have some performance limitations, such as when joining it may return a lot more data than you expect then join. To make your performance a bit more ideal you can follow a few basic principles.

Lets look at some example tables to highlight this:

> \d
users
todos

In this case users is local and the todos are a foreign table. Looking at each of the schemas we have something like you might expect:

> \d users
Table "public.users"
Column | Type | Modifiers
-------------+-----------------------------+-----------
id | integer | not null
email | text |
created_at | timestamp without time zone |
Indexes:
"users_pkey" PRIMARY KEY, btree (id)
"users_created" btree (created_at)
> \d todo
Foreign Table "public.todo"
Column | Type | Modifiers
-------------+-----------------------------+-----------
id | integer | not null
user_id | integer |
desc | text |
created_at | timestamp without time zone |
status | boolean |
Indexes:
"users_pkey" PRIMARY KEY, btree (id)
"todo_created" btree (created_at)

Somewhere to Belong

Honest Musings — Thu, 19 Dec 2013 21:35:11 GMT

Somewhere to Belong In a place the wind sways, Is a meadow to fritter away, Has a flower to hold tears, And a shade until the sky clears. Lives a heart to hide a hurt, In the saint of the heart. Somewhere way way back, Near the river of the song, Says a tree of … Continue reading

Mailbox Updated With Support for iCloud and Yahoo Mail

Zac Szewczyk — Thu, 19 Dec 2013 12:09:21 GMT

Great news. Now, the only reason I have left to keep Apple’s Mail app around is for the occasional spam message, which Mailbox curiously does not have any way of handling. Once Mailbox builds that functionality in, I can happily say goodbye to Mail.

Permalink.

What. The. Fuck. Nokia.

Zac Szewczyk — Thu, 19 Dec 2013 10:10:20 GMT

Jim Dalrymple with his characteristically ambiguous thoughts regarding Nokia’s latest commercial, hot on the tails of Apple’s spectacular ad Misunderstood: “Kids, this is why you don’t do drugs while making a TV ad.” I normally wouldn’t have linked to such a thing as this, but it illustrates exactly why everyone devoted so much time and attention to Misunderstood when it came out: with such “competition”, how could we not? Jim had one more thought on For Work. For Play., which he posted to Twitter shortly after linking it:

“So Apple comes out with a TV ad that brings a tear to your eye and Nokia scares the shot out of me.”

Precisely.

Permalink.

Node.js and V8 history

GeekWare - Daniel Pecos Martínez — Thu, 19 Dec 2013 07:15:38 GMT

Talking about Node.js history, it’s talking a little bit about V8 history. But let’s start with a one line definition of what it is: Node.js is a platform built around Google Chrome V8 Javascript engine, to create lightweight, fast, scalable, event-driven and non-blocking I/O applications. So lets begin talking about Node.js origins, the V8 javascript engine.

V8 is an opensource project by Google and it is in the very core of Google Chrome browser. Its first public release was on September 2, 2008, same date Chrome’s first release was announced. It was a big step forward in browsers’ performance, and it pushed browsers’ technology to a new whole level. It’s written in C++ and its biggest revolution was that it precompiled the Javascript source code to machine code instead of just interpret it and then applied a JIT process again in runtime to improve dynamic code execution.

Ryan Dahl – Creator of Node.js

Then, around 2009, Ryan Dahl was trying to solve a tough problem in that days: making the browser know how much time of an upload process was left. Inspired by Ruby’s Mongrel webserver and by the recent release of Chrome and V8, he decided to give Javascript a chance, creating the seeds that would transform in short time into Node.js.

The project has been develop and sponsored by Joyent, company where Ryan was working. Nowadays he is still working there, but has stepped back, delegating the gatekeeper position to Isaac Schlueter on January 30, 2012.

If you are interested in further details about Ryan Dahl and how and why he decided to create Node.js, here you have a video of himself talking about that:

Historically, Javascript browser environments are limited to just one execution process / thread, making impossible to update DOM and execute some business logic simultaneously, and this also applied to V8, so, why someone would be interested in such limited and poor performance platform to run in a server environment?

Well, truth is that maybe Javascript is not the most calculation efficient language available, but its event-driven non blocking design, makes Node.js one of the lightweight platforms (runs really well in a RaspberryPI) and more performant web platforms, competing directly with the old JEE Java Platform, PHP and Ruby.

From a developer perspective, the amount of innovation the Node.js community is creating is simply astonishing, and that’s also because one of the three other key tools a Node.js developer must known: NPM.

But this is a story we will address another day.

References:

http://en.wikipedia.org/wiki/Nodejs
http://en.wikipedia.org/wiki/V8_(JavaScript_engine)
https://code.google.com/p/v8/

The end of the Facebook era

Zac Szewczyk — Wed, 18 Dec 2013 10:06:13 GMT

Via Ben Brooks, Chrys Bader takes a very interesting look at where Facebook came from, its current state, and the platform’s bleak future. With the exception of Twitter I have all but abandoned social networks, including the venerable elder statesman Facebook, so I rarely take any interest in articles examining them. I followed Ben’s link on a whim though, and I’m very glad I did.

Especially damning, I thought, was his comparison of Facebook to LinkedIn: “Teens likely see Facebook the same way the Facebook generation sees LinkedIn — like a utilitarian place to manage connections.” Facebook has crossed the Rubicon, so to speak; from here no amount of money will ever bring it back.

Permalink.

Converting from JUnit to TestNG

Craig Pardey — Wed, 18 Dec 2013 02:00:00 GMT

The TestNG Eclipse plugin has a feature that will convert your unit tests from JUnit to TestNG in a few simple clicks, and it works pretty well for the most part. However, I soon noticed that it was replacing Assert.assertX with AssertJUnit.assertX. Upon further inspection, this was because TestNG’s Assert uses different argument ordering. For example

// JUnit  
Assert.assertEquals(message, expected, actual);

// TestNG  
Assert.assertEquals(actual, expected, message);

Each argument has moved.

On 2013

Text(Greg); — Tue, 17 Dec 2013 21:51:28 GMT

But Greg... you can't post this stuff yet! Christmas isn't until, like, Wednesday!

Yeah, and Christmas is poised to invade Labor Day next year. Shut up.

About this time last year, I was just so ready for 2012 to end. It was a terrible, horrible, no

"We Need to Talk About TED"

Zac Szewczyk — Tue, 17 Dec 2013 17:40:26 GMT

I rarely find anything worthwhile on Hacker News — primarily interesting coding projects and the latest NSA story to catch the masses’ attention, rarely anything substantive — but when I do come across something interesting it really is truly exceptional. This article from Benjamin Bratton is one of those excellent pieces, one for the record books. I can’t wait to watch his talk.

Permalink.

The Sweet Setup

Zac Szewczyk — Tue, 17 Dec 2013 16:55:22 GMT

Four weeks old today and I have yet to at least mention Shawn Blanc’s The Sweet Setup. For the three people who still have not visited this site, The Sweet Setup collects and reviews best-in-class apps for iOS and OS X alike, with a special focus on interviewing “internet celebrities” to discuss their home and mobile computing setups. So far, Shawn Blanc and his impressive staff have conducted six of these interviews. As a recent Mac convert I have found this site invaluable in picking great new desktop apps, so if you haven’t yet, I strongly recommend you check this site out.

Permalink.

Ben Thompson on Apple's New Misunderstood Commercial

Zac Szewczyk — Tue, 17 Dec 2013 16:32:31 GMT

Having updated his article on Apple’s latest ad, Ben Thompson finally delved in to the reason so many fell in love with this commercial in the first place, and the reason so many have talked about it. As I said earlier this video hits so close to home because it does not focus on feature comparisons or implausible situations necessitating eighteen processors, but instead on the experiences Apple’s devices enable:

Permalink.

Misunderstood

Zac Szewczyk — Tue, 17 Dec 2013 14:14:45 GMT

Permalink.

Add to iCloud Reading List programmatically

Caius Theory — Tue, 17 Dec 2013 00:26:31 GMT

One piece of a larger puzzle I’m trying to solve currently, was how to add a given URL to my Apple “Reading List” that is stored in iCloud and synced across all my OS X and iOS devices. More specifically, I wanted to add URLs to the list from my mac running Mavericks (10.9). I had a quick look at the Cocoa APIs and couldn’t see anything in OS X to do this. (iOS has an API to do it from Cocoa-land it seems though.)

I figured Safari.app was the key to getting this done on OS X, given it has the ability itself to add the current page to the reading list, either via a keyboard command, a menu item, or a button in the address bar. One quick mental leap later, and I was wondering if the engineers at Apple had been nice enough to expose that via Applescript for me to take advantage of.

One quick stop in “Script Editor.app” later, and I had the Applescript dictionary open for Safari.app. Lo and behold, there is rather handily an Applescript command called “add reading list item”, which does exactly what I want. It has a few different options you can call it with, depending on whether you want Safari to go populate the title & preview text, or if you want to specify it yourself at save-time.

As I want to be able to call this from multiple runtimes, I’ve chosen to save it as an executable, which leans on osascript to run the actual Applescript. And here it is:

#!/usr/bin/env osascript

on run argv
 if (count of argv) > 0
 tell app "Safari" to add reading list item (item 1 of argv as text)
 end if
end run

Save it as whatever you want (eg. add_to_reading_list), make it executable (chmod +x add_to_reading_list), and then run it with the URL you want saving as the first argument.

$ add_to_reading_list "http://caius.name/"
$ add_to_reading_list "http://google.com/"
# … etc …

(Adding support for specifying preview text and title is left as an exercise for the reader!)

Have fun reading later!

Changes to First Crack

Zac Szewczyk — Mon, 16 Dec 2013 23:11:02 GMT

In The One Where I Disavow Gaming I outlined two goals I wished to work towards using this newfound time of mine previously wasted “mindlessly tapping the W, A, S, and D keys for hours on end”: to write more regularly and code more frequently. A week later the former remains a work in progress, while I can happily report that the latter has gone so well I not only successfully fixed a number of outstanding bugs and implemented quite a few new features in the process, but went on to add some impressive functionality I hadn’t even considered before then as well. Although this focus only allowed for a single post most days last week, I couldn’t be happier with the results.

Permalink.

Hello world! Node.js & Javascript blog

GeekWare - Daniel Pecos Martínez — Mon, 16 Dec 2013 14:35:57 GMT

Wellcome to this new site where you’ll find lots of information about Node.js, Javascript and HTML 5 technologies!

This project is a chance for me to share my passion about these new and amazing technologies, trying to make you easier to step into it and to discuss and enjoy technology talks to whomever who wants to.

It will be mainly focused on Node.js, but sometimes we will talk about generic Javascript or even frontend Javascript related to HTML5 capabilities.

And if you consider yourself kind of a Node.js guru or simply would like to participate, please just contact me and you will be very welcome to collaborate.

Hope you enjoy this content as much as I enjoyed creating it!

Pssst!! Don’t forget to follow us in twitter!

Daniel Pecos Martínez (@danielpecos)

Указ 60 и ЕЭП

blog — Mon, 16 Dec 2013 10:13:01 GMT

Давно думаю, не противоречит ли указ №60 принципам Единого экономического пространства Беларуси, России и Казахстана?

Вроде у нас свобода торговли, и вдруг раз - на территории Беларуси при оказании услуг с помощью информационных систем могут применяться только информационные сети, системы и ресурсы "национального сегмента сети Интернет, размещенных на территории Республики Беларусь и зарегистрированных в установленном порядке". Значит ли это, что например Российским системам, провайдерам хостинга и т.п. вход на Белорусский рынок закрыт?

issue 9999

blog — Mon, 16 Dec 2013 10:11:19 GMT

Have just opened another GAE issue, and it got number #9999
It's pretty. The next reporter will get number 10000.

Github support for org-mode in READMEs is unsatisfying

blog — Mon, 16 Dec 2013 10:11:19 GMT

Github support for org-mode in READMEs is unsatisfying - no code coloring and sometimes it even fails to render to html at all.

I am migrating all my README files to markdown. Googled also this tool for automatic conversion: https://github.com/alexhenning/ORGMODE-Markdown. Will try it next time.

Apart from READMEs I also would like to represent TODO.org files online. While org -formatted READMEs are more or less readable in gitbub's HTML representations, TODO.org files are not readable at all.

Using Factory Beans in Spring Java Configs

Craig Pardey — Mon, 16 Dec 2013 02:00:00 GMT

I recently went through an exercise of converting Spring XML configuration files to Java-based configuration. The process went well for the most part, but I encountered an oddity around how to use factory beans when using Java configs.

In XML, factory beans would be used like this

<bean id="MyDataSource"  
class="org.springframework.jndi.JndiObjectFactoryBean"  
p:jndiName="jdbc/MyDataSource"  
p:resourceRef="false"  
/>

In Java however, this has to be separated into two separate @Beans

@Bean  
public JndiObjectFactoryBean getJndiObjectFactoryBean() {  
	JndiObjectFactoryBean jndi = new JndiObjectFactoryBean();  
	jndi.setJndiName("jdbc/MyDataSource");  
	jndi.setResourceRef(false);  
	return jndi;  
}

@Bean  
public DataSource getSampleDataSource() {  
	return (DataSource) getJndiObjectFactoryBean().getObject();  
}

Raspi + SDR + ADS-B = awesome

Erethon's Corner — Sun, 15 Dec 2013 00:23:17 GMT

A lot of people have combined a RasPi and a SDR dongle to get a low power consumption ADS-B tracker. Tomasz Miklas has created an image for the Raspberry Pi, that has everything that is needed to run your own aircraft tracking "service" already set up. I've finally had a chance to experiment with it and this will be my short review.

2013-12-14

ho.dges.online — Sat, 14 Dec 2013 02:00:00 GMT

I spent a lot of school summer holidays in Eastbourne staying with my grandparents and spent countless afternoons in the arcade on the pier (my grandparents would decamp to the cafe to escape the noise). Years later, my wife and kids would stay in Eastbourne to visit my grandparents> One rainy evening I sneaked down to the front to try and get a picture of the pier. At first, I thought the rain would spoil the effect, but the reflections of the lights in the puddles actually make it more engaging.

Master and Commander

Zac Szewczyk — Fri, 13 Dec 2013 09:04:41 GMT

Last night I took Coin to task for extending their pre-order sale, again, in to the new year rather than allowing it to expire as should have happened sometime today. I briefly explained how this move has further devalued their product by virtually solidifying it at the $50 price point, and then talked about how Coin’s latest escapade showed a startling lack of respect for the individuals who put their hard-earned cash on the line so that this company could fulfill its one job in life by making a great device. Unlike the causes behind the former though, which I could explain with relatively simple examples, the latter — distilling the relationship between maker and consumer — proved much more difficult. I touched on this topic in my past articles on Coin, but have not actively sought to fully flesh out my thoughts on this topic until now.

Permalink.

The Technological Guide to a Foreign Language

Steren's essays — Fri, 13 Dec 2013 02:00:00 GMT

More Coin

Zac Szewczyk — Thu, 12 Dec 2013 23:33:52 GMT

I feel a bit like a broken record at this point, what with having already talked about Coin twice before, but the company’s latest stunt bears once again picking up my banner and going back off to war: earlier this evening, via their Twitter account, Coin posted a “BREAKING NEWS!” announcement that — you guessed it — extended the $50 off early adopter deal into the new year. Surprised? You should’t be.

Permalink.

To Infinity and Beyond

Separate Concerns — Thu, 12 Dec 2013 23:30:00 GMT

Goodbye Moodstocks

Friday 20th will be my last day at Moodstocks. I am leaving a company where, after three years and a half, I was the most senior employee. As you may imagine, it was not an easy decision.

Moodstocks has grown up since I joined it. After several pivots, the founders have assembled a great team I will miss, and together I dare say we have advanced the state of mobile image recognition. Recently, we have also been looking at other technologies related to mobile.

We have released two new products. The first one is what was known as Physalis and took the commercial name Winch. This is what I have been mostly involved with for the last few months. I believe it has the potential to become the reference solution to write native mobile applications that react quickly and work offline.

The second product is Overlay, a mobile application that lets you buy products from paper catalogs online. Years after Pikadeo and Notes, it is finally time for a real application available in the stores, leveraging Moodstocks’ image recognition SDK and Winch, showcasing the best of both technologies. But beyond pure tech, it is also a demonstration of Augmented Reality as we like it: fast, predictable, purposeful. No need for 3D models.

With those two products in the pipes, choosing to leave was incredibly difficult. But I did nevertheless, because of an opportunity I could not turn down.

Hello Lima

So, what next for me? After two weeks to see my family, eat too much and have some welcome rest, I will be joining the team developing the Lima as a core developer.

The Lima, which promises no less than to solve the personal data storage problem, is the first hardware product I backed on Kickstarter. I was thinking: “this won’t be easy, but if those guys can do it, I want that device.”

The Kickstarter went (very) well, so they started looking for help and got in touch. I was curious and decided to meet the founders. After a Saturday morning spent discussing the project at Starbucks, I was convinced: they are the right people to do this.

For years I have been convinced that ubiquitous computing is one of the next big things in technology and wanted to be part of it. As I see it, Lima gives me this opportunity today.

So it looks like my short-term future holds some Unix development and a good dusting of my rusty C. I may try to sneak a Lua interpreter in that box at some point, but please don’t tell the others! ;) Severin and Gawen have high expectations and I do not expect much relaxing but hey, it should be fun to live the adventure of Early Stage again.

On responsibility, real and imagined

Text(Greg); — Thu, 12 Dec 2013 22:28:11 GMT

I recently inherited some money, and as a consequence was able to pay off most of my long term, PITA, oh god how are we ever gonna get out of this, debt. The day I went from website to website zeroing everything out was supposed to be a good day;

Lisp parentheses

Honza Pokorný — Thu, 12 Dec 2013 19:44:00 GMT

Perhaps the number one reason why people are afraid to try Lisp or don’t like it is the huge amounts of parentheses cluttering up the code. It’s said to be hard to read the code when it’s full of parentheses.

Any experienced Lisp programmer will tell you that the parentheses disappear fairly early on. After a while, you hardly notice them as something annoying. In fact, going back to C-family languages will make you feel like you need to type all kinds of crazy punctuation.

While Clojure technically doesn’t use significant whitespace like Python, in reality, careful identation is crucial to writing clear code.

(defn crop-photo [user photo]
  (when (authenticated? user)
    (when (admin? user)
      (crop photo))))

In this snippet, there are four levels of indentation, four nested expressions. It’s easy to quickly scan this function guess what it does. When a user is authenticated and when they are an admin, crop the photo. If any of the when expressions return a falsy value, the whole function will return nil. All of this is possible because Clojure uses prefix notation. This means that the first element in the (...) form is the name of the function. Therefore, you only need to scan the beginnings of lines to see what functions are being called. Also, you never have to pay attention to closing parentheses because they are all sitting together at the end of the function.

In Clojure, it’s also idiomatic to put function arguments on new lines and align them.

(or (admin? user)
    (staff? user))

In this example, the or macro usually takes two arguments. We put each argument on its own line and align them. This way it’s visually clear what the code does.

Finally, when writing Clojure code, you rarely have to worry about matching up your parentheses. This is a job for your text editor. Inserting a new expression usually involves typing the ( key and having its friend ) inserted for you.

On keeping secrets

Text(Greg); — Thu, 12 Dec 2013 15:10:12 GMT

Derek Sivers:

We got two ciders and she patiently waited while I spent 20 minutes reading through it. Pages filled with words about processing family drama, formulating goals, plans for life changes, romantic details, lists of regrets, contemplations, etc.

I was surprised it was all meaningless to me. These pages

Why Lean Startup sucks for startups.

Blog posts of Andreas Klinger — Thu, 12 Dec 2013 02:00:00 GMT

If you go to Lean Startup events you will find first time founders, consultants, accelerator managers, r&d people, enterprise intr...

JavaScript and Canvas version of Conway's Game of Life

Thomas Hunter II — Thu, 12 Dec 2013 02:00:00 GMT

The Week of Code is Here!

The David Brownman Blog — Thu, 12 Dec 2013 02:00:00 GMT

undefined

Read the whole thing.

Castro

Zac Szewczyk — Wed, 11 Dec 2013 21:30:21 GMT

After all the talk of Castro in the last twenty-four hours since its release, and as an avid podcast listener myself, I couldn’t help but feel obligated to weigh in. With articles from John Moltz, Cody Fink, and Shawn Blanc waiting unread in my Instapaper queue, I downloaded Castro earlier this evening expecting to burn the midnight oil to get this article out. It came as a great surprise, then, when I tried every one of Castro’s features and saw every screen within about fifteen minutes.

Permalink.

Masterless Saltstack

Honza Pokorný — Wed, 11 Dec 2013 20:55:00 GMT

This is a simple guide on how to use Saltstack, the configuration manager, in masterless mode. In most scenarios, you will use a Saltstack master to control many minions. Saltstack contains a lot of utilities to check the state of minions, gather information about them, etc.

However, if you are working on a small, single-server application, Saltstack’s master-minion setup might be overkill. You can indeed use a single minion.

A bit of setup first

Your project will need two directories for Saltstack’s files.

pillar/
salt/

The salt directory will contain the scripts that are responsible for setting up a particular part of your server, e.g. nginx, postgresql, etc. pillar on the other hand will contain the configuration value for each environment that your app will run in. So, you might have a staging and a production environment set up there.

Each of these directories needs a top.sls file which is what’s loaded first. For fun, let’s just install vim into a production environment.

pillar/
    top.sls
    production.sls
salt/
    top.sls
    vim.sls

Salt

The salt/top.sls file will have a case-expression-like structure, matching on hostnames of your app.

base:
    'production':
        - vim

Note that sls files use YAML syntax.

Here we are installing vim in the production hostname.

The salt/vim.sls file will look something like this:

vim:
    pkg:
        - installed

This simply says that we want the vim package installed. Saltstack will automatically detect your package manager (i.e. apt-get, yum, etc).

Pillar

The pillar/top.sls file has the same structure as the main file from the salt directory.

base:
    'production':
        - production

When the production hostname is detected, use the production.sls file for configuration. You can put just about anything you want to the production.sls file, be it the servers IP address or the SMTP settings.

Where to put things

After you’ve installed Saltstack on your server, you should copy or symlink the salt/ and pillar/ directories to the /srv directory

/srv/salt
/srv/pillar

Running it

Once the configuration files are in place, you can run the minion’s provisioning command to get everything configured and installed.

$ salt-call --local state.highstate

Don’t ask me why it’s like this. Makes no sense.

Saltstack will run everything and then report what happened during the run.

The Wolf of Wall Street

🦉 olshansky 🦁 — Wed, 11 Dec 2013 14:35:53 GMT

Olshansky's review of The Wolf of Wall Street

Hercules

🦉 olshansky 🦁 — Wed, 11 Dec 2013 14:25:54 GMT

Olshansky's review of Hercules

Changes to the blog and website

Carey Metcalfe — Wed, 11 Dec 2013 13:30:00 GMT

I used to run this site on two different platforms. There was a static landing page hosted on my server, and a blog hosted on Blogger.

While the landing page was reasonably nice-looking (screenshot here), the blog looked terrible. Free Blogger templates are generally not the nicest-looking things to look at and the one I used was no exception.

More importantly though, the Blogger composer made really hard to generate nice-looking articles. For just writing text posts, it wasn't bad (aside from the crazy HTML it generated), but for inserting code snippits or doing any kind of advanced formatting it was incredibly frustrating.

A few weeks ago I finally decided to deal with the situation. My general plan was to find a static site generator that allowed for writing posts in Markdown syntax and use it to create a website that would host some static content as well as the blog.

Static sites are exactly what they sound like. Just some static HTML files for a webserver to serve to clients. No fancy frameworks, databases, or server-side processing involved. This is advantageous primarily because it makes site blazing fast and very light on server resources.

After looking at a few static site generators, I decided to go with Pelican. Pelican is a Python-based static site generator that uses the awesome Jinja2 templating library and understands content written in a number of formats, including Markdown. It's extremely easy to set up and requires only a single command to regenerate the entire site.

Transferring content from the old blog into the *.md files that Pelican reads was also really simple. Pelican includes a tool called pelican-import that allows for reading in data from a variety of sources. I used this tool to pull all my previous posts down from the RSS feed of the old blog.

After fixing up the imported data (the import tool is good, but not perfect), I started looking into templates.

Like with Blogger themes, I was having a hard time finding anything I liked, until I came across a template called svbhack. It had a nice page layout and the general aesthetic was good, but needed a fair bit of tweaking. I forked the repository (+1 for open-source) and over the next few weeks used my limited HTML and CSS knowledge to transform it into the one you see today.

There are still a bunch of things I want to change/fix/add, but at this point I feel that the site is ready to be released. The code for the template and the site is all freely availible on GitHub.

If you have any comments or suggestions I'd love to hear them!

Making Steam for Linux close to the system tray

Carey Metcalfe — Wed, 11 Dec 2013 13:00:00 GMT

Steam for Linux is a little odd in how it handles a user clicking the close button. Instead of exiting the program or mimimizing the application to the system tray, it just minimizes it to the taskbar. The developers have said that this is temporary and that it will be changed in the future, but for now, there is a workaround.

To make Steam always minimize to the system tray, just add STEAM_FRAME_FORCE_CLOSE=1 to your environment.

For more information see the original GitHub issue.

Godzilla

🦉 olshansky 🦁 — Wed, 11 Dec 2013 08:48:27 GMT

Olshansky's review of Godzilla

Atomic construction

Craig Pardey — Wed, 11 Dec 2013 02:00:00 GMT

Bugs caused by multi-threading can be very difficult to find. Here’s one I encountered recently.

private static MyObject INSTANCE;

public void init() {  
	if( INSTANCE == null) {  
		initInstance();  
	}  
}

private static synchronized void initInstance() {  
	if( INSTANCE != null) {  
		return;  
	}  
	INSTANCE = new MyObject();  
	INSTANCE.initThis();  
	INSTANCE.initThat();  
}

At first glance, this code is fine. It uses a synchronized static method to create the singleton, using double-checked locking to make sure it only gets created once. But on closer inspection it is possible for the null check in init() to pass before the INSTANCE has been fully initialized.

Michael Fitzgerald: CEO of Submittable

Sam Solomon — Wed, 11 Dec 2013 02:00:00 GMT

Michael Fitzgerald is the CEO of Submittable, a submission management tool with clients such as Playboy and CBS. He is the author of Radiant Days.

Dear Aunt Rose Comma Thank You for the Speech Recognition Software Exclamation Point.

Zac Szewczyk — Tue, 10 Dec 2013 20:58:15 GMT

Linked to by Shawn Blanc, this is absolutely hilarious. Coincidentally Marco just posted an article titled Siri Accuracy Continues to Improve, where he complained about Siri’s frequent inability to process his requests. Since I finally upgraded to a 4S last month I have been using Siri daily, and with the exception of a few incorrect words it has worked both flawlessly and exceptionally quickly regardless of my cellular connection strength. I have yet to see see the, “Sorry, I can’t take requests right now” error message.

Permalink.

Heat of the Moment Insurance Policy

Zac Szewczyk — Tue, 10 Dec 2013 19:00:34 GMT

I have spent the last two or three months occasionally hearing Aaron Mahnke and Dave Caolo talk about an app capable of completely cutting a computer off from a certain set of domains as a means to increase productivity. By making it impossible for one to get distracted, the creators of the aptly-named SelfControl reason, productivity must increase accordingly. I downloaded SelfControl Sunday night, and even in my brief experience with it so far I can attest to its effectiveness.

Permalink.

Incredibly High-Level Discourse

Zac Szewczyk — Tue, 10 Dec 2013 16:30:43 GMT

Sunday evening shortly after I wrote The One Where I Disavow Gaming, as I scrolled through Zite looking for something to read, I happened across a headline that immediately caught my attention: iPhone 6 Release Date And Recent Rumors. Given that the article came from a site I had never heard of before and because the Apple sphere has remained relatively quiet with regards to iPhone 6 rumors as of late, I opened the article with low expectations. What could Value Walk know that John Gruber didn’t? Turns out, absolutely nothing. In fact, the extraordinary simplicity of these rumors and the fact that one would devote an entire section to speculating as to the iPhone 6’s release date were so absurd that it made me realize something rather profound.

Permalink.

Cerberus 0.5 is out (and it breaks stuff)

Nicola Iarocci — Tue, 10 Dec 2013 02:00:00 GMT

The new release changes the way validation errors are reported. Please note that these changes will also affect future releases of Eve, the Python REST API Framework.

What we had before was basically a list of human-readable errors. Each item in the list, while perfectly fine for human reading, wasn’t really ideal for algorithmic parsing. Why would you want to parse the errors with an algorithm? A common case would be when your client is using business objects to represent API resources (think a client-side ORM), and would have a hard time binding validation errors to the objects themselves.

Takua Chair Renders

Code & Visuals — Tue, 10 Dec 2013 02:00:00 GMT

A while back, I did some test renders with Takua a0.4 to test out the material system. The test model was a model of an Eames Lounge Chair Wood, and the materials were glossy wood and aluminum. Each render was done with a single large, importance sampled area light and took about two minutes to complete.

These renders were the last tests I did with Takua a0.4 before starting the new version. More on that soon!

Vagrant on Fedora with libvirt

The Technical Blog of James on purpleidea.com — Mon, 09 Dec 2013 22:14:51 GMT

Apparently lots of people are using Vagrant these days, so I figured I’d try it out. I wanted to get it working on Fedora, and without Virtualbox. This is an intro article on Vagrant, and what I’ve done. I did this on Fedora 19. Feel free to suggest improvements.

Intro:

Vagrant is a tool that easily provisions virtual machines, and then kicks off a configuration management deployment like Puppet. It’s often used for development. I’m planning on using it to test some Puppet-Gluster managed GlusterFS clusters.

Now syndicated on “Planet Fedora”

The Technical Blog of James on purpleidea.com — Mon, 09 Dec 2013 21:18:56 GMT

I’m now syndicated on the Fedora Project planet. If you haven’t read through my blog yet, let me introduce myself, I’m James, and I write The Technical Blog of James.

I’m a sysadmin, DevOps/Puppet hacker, I.T./network architect and physiologist. Hi! I run Fedora as my primary desktop, but I also use it for servers, particularly for development before future versions of RHEL and CentOS release.

I’m most well-known for Puppet-Gluster, but I’ve also written a decent Puppet-IPA (FreeIPA) module. I’m currently working on porting Puppet-Gluster to Fedora and looking forward to the upcoming release of Fedora 20.

The One Where I Disavow Gaming

Zac Szewczyk — Sun, 08 Dec 2013 23:47:40 GMT

As I write this I have wasted almost an entire weekend. I got home Friday afternoon and spent the evening collecting gift ideas for my family and playing a video game; Saturday I wrote the first draft of an essay and reviewed three months’ worth of notes for an upcoming exam all before lunchtime, then proceeded to waste five hours playing that same game before cramming an article in with one foot out the door as I prepared for my girlfriend’s choir concert that evening. After the concert we went to a party. Sunday morning I dragged myself out of bed for church, and then proceeded to spend the rest of my day playing video games once again. I have probably spent just as much time gaming this weekend as I have sleeping, and I really despise this about myself.

Permalink.

Missing the Forest for the Trees

Zac Szewczyk — Sun, 08 Dec 2013 23:47:37 GMT

With the release of Tweetbot 3 Tapbots brought a complete user interface overhaul to the beloved Twitter app alongside a whole slew of other improvements and changes. One such change saw the removal of both Tweetbot’s double- and triple-tap functionality. Citing increased responsiveness as the app would no longer have to wait for iOS to discern whether the user intended multiple taps, Tapbots replaced this feature with a curious swipe gesture. Believing it would work similarly to Mailbox’s finicky yet workable gestures where swiping different distances invoked different actions, I looked forward to this improvement; however, in this regard Tweetbot 3 fell far short of excellence.

Permalink.

Lost Trust

Zac Szewczyk — Sat, 07 Dec 2013 13:59:17 GMT

Every time I save an article to Instapaper I immediately open the app to make sure it actually went there. Although quite some time has passed since this proved a worthwhile exercise, my unfortunate habit stems from a fear derived of Instapaper’s past inability to parse Cabin Porn URLs. Because I once had faith in the system I happily sent every post I planned to write about over to Instapaper, intending to come back to those articles at a later date. However, this practice came back to bite me when Instapaper failed to accurately record the correct article URLs, much less successfully parse their contents, and I lost several weeks’ worth of effort spent in aggregation. I seem to remember something similar happening with other sites around this time, but Cabin Porn is the sole site that Instapaper consistently failed to handle appropriately.

Permalink.

Make Hard Things Easier by Removing Friction

Josh Thompson — Sat, 07 Dec 2013 02:00:00 GMT

Friction resists movement. Lots of things count as (negative) friction.

Anything that consumes resources (time, energy, money, physical goods.)
Anything that causes negative feelings (shame, doubt, guilt, fear.)
Anything that could have a downside (losing money, respect, your job.)
Anything that may have no benefit. (Joy, money, respect, a better job.)

If you want to make something happen in your life, chances are good that you’re not doing it already because of friction.

Think about it - if you wanted to do something, the benefits were obvious, and the barriers non-existent… wouldn’t you already be doing it?

So - if you are not content with where you are now, and you have an idea of where you want to be, examine hard the possible sources of friction. If you can eliminate most of that friction, you’ll suddenly find it much, much easier to make that thing happen.

I have two examples of changes I wanted to make that were impeded by lots of friction.

Creating a digital product

I’ve wanted to create a digital product that sells itself for a long time. Sounds perfect, right? People give me their money and, after initially setting everything up, it doesn’t take any additional work on my behalf.

Here’s all the friction I’ve run into:

I’ve never done this before. Everyone out there who hasdone it, has, by definition, done it. So I am quantifiably different from those folks that have done this thing.
I don’t have any customers. What if I put all this work out, and can’t get anyone to buy it?
I’ve never built a website, or earned money outside of “normal” jobs.
There are 1000 different things I could spent my time on related to this project. How do I know I’m spending my time effectively?
Most people want to do this, and most people never try. Those that do… most of them fail, right? Why would I do anything different.
I already have a full-time job. Why should I spend my limited time finding even more work?
I don’t know anything that unique about anything.

Here’s how I got over all of this friction:

Every single action I take is a learning experience. If something doesn’t work, I’ve learned. (Along those lines - there is no good way to do cold calling.)
If I hit a barrier, I figure out a way to either not need it, or get around it. (Call people, get email addresses, email them, then call again. It’s no longer a cold call.)
If I feel out of my element and outside of my comfort zone, I’m doing it right. That stress is now encouragement.
My wife is encouraging, That helps a lot.
All great products and entrepreneurs have sucked or been unsuccessful at one time (or many times!). I’m just running with it - it’s OK to feel like I’m making it up as I go.
I’m not done, and I don’t think I ever will be. But it is all a learning experience.

The Blame Apple Game

Zac Szewczyk — Fri, 06 Dec 2013 15:47:02 GMT

Another unsurprisingly great article from Ben Brooks, and my favorite piece of his for quite some time. I absolutely love how he describes PandoDaily’s post: in a day and age where everyone pulls their punches for fear of offending someone by implying one thing while unconsciously omitting something else and finally ending the sentence with a period, Ben’s candid characterization is a breath of fresh air. Made all the more worthwhile by his ultimate point, I could not recommend that you go read Ben’s article and subscribe to his site more strongly. I have been critical of his views in the past, but at the end of the day his site is consistently one of my favorites.

Permalink.

Bad Coin

Zac Szewczyk — Fri, 06 Dec 2013 15:25:58 GMT

While neither a fan of DROdio’s website or the author’s writing style, Dissecting Coin’s Massively Successful Product Launch nevertheless gives me a way in to talk about Coin once again. Last month, shortly after Coin launched to great fanfare, I condensed some of my thoughts into a post titled Thoughts Regarding Coin. I explained the device’s premise, areas I thought it would excel, and those in which I felt it would fail or needed improvement. I did not, however, go into some of my less tangible concerns with the product; specifically, I did not talk about any of my issues with its marketing and pre-launch strategy. Given that Daniel devoted a significant amount of time to this topic in his article though, I feel now is as good a time as any.

Permalink.

Three Weeks with Two iPads

Zac Szewczyk — Fri, 06 Dec 2013 13:58:19 GMT

“After 3 weeks, I’m actually leaning slightly more towards the mini if I had to pick one. Though I do work a lot from my iPad, the iPad is not my main work machine. I still spend most of my time at my desk working from my MacBook Air. And so, for the things I do use an iPad for, the iPad mini is better for about 80-percent of them and ‘good enough’ for the other 20-percent. I plan to keep using both iPads, side by side, for at least another month or two, so I’ll check back in again soon.”

As an avid iPad user — although less so lately after purchasing my MacBook Pro — I have followed this discussion with great interest since the retina iPad Mini’s launch. Of all the articles I have seen so far, Shawn’s is one of the best.

Permalink.

Filson 4x4

Zac Szewczyk — Fri, 06 Dec 2013 10:12:47 GMT

I love overachievers in the world of cars much more than in person, hence my unbridled enthusiasm when I happened across Mercedes’ six-wheeled monster the G63 AMG and Ghe-O’s indomitable Rescue. Something about these trucks, for their rugged ability to tackle literally any terrain imaginable truly epitomizes the colloquial definition of the term¹, awakens a visceral desire to pack my backpack and spend a long weekend trekking through uninhabited back country with nothing but my thoughts to keep my company; they ignite within me a base midwestern American desire to go outside and spend time in nature. Unsurprisingly, then, Filson’s Jeep 4x4 was no exception. My only hesitation in pushing its limits on a narrow mountain trail would be that I tarnish its carefully crafted exterior and spoil the bespoke interior; once I got past that though, I have no doubt it could handle anything I decided to throw at it.

I don’t mean to go on a rant, but as a brief aside I do not understand the appeal of such small trucks. I can see the place of cars, vans, SUVs, and F-150-esq trucks in the jobs consumers hire vehicles to do, but when it comes to these small “trucks” I am at a loss. Granted, their perpetuated existence indicates continued demand for such a form factor, but I can’t for the life of my understand its appeal. Perhaps this is the naivety of youth and machismo of a nineteen-year-old speaking, but if I had the need for a flat bed and an additional four miles to each gallon without the bulk of an F-150 or above — the only reasons I could see someone purchasing one of these vehicles — I would swallow my second and third criteria and buy a Ford F-series anyways.

↩ As opposed to the dinky Ford Rangers that have somehow managed to subsume the moniker.

Permalink.

Quora answer about writing a search engine

Ben E. C. Boyter — Fri, 06 Dec 2013 03:31:30 GMT

The following I posted on Quora in response to the question “I am planning to make a small scale search engine on my local system, but I don’t know from where to start?”. It’s a reasonable answer so like my Mahalo one I thought I would make a copy for myself.

I agree with Wolf Garbe and that you are better off in your case starting with existing technologies, have a look at http://yacy.net/ and SphinxSearch as well. However if you are doing this to learn and not just deliver a product I can provide a few links for you.

Bezos and His Drones

Zac Szewczyk — Thu, 05 Dec 2013 21:13:00 GMT

Towards the end of Amazon and the Benefits of Vision Ben Thompson explained the importance of vision — and the consequences of a deficiency in this department — using many of today’s top tech companies as examples. At that point not particularly interested in Amazon’s alleged plans slated for years down the road,, I found this all too brief examination much more fascinating than his actual topic. And then I read an article by Kevin Roose of the New York Magazine, which John Gruber linked to on Tuesday.

Permalink.

Let the Right One In

🦉 olshansky 🦁 — Thu, 05 Dec 2013 11:41:30 GMT

Olshansky's review of Let the Right One In

Ip Man

🦉 olshansky 🦁 — Thu, 05 Dec 2013 11:41:04 GMT

Olshansky's review of Ip Man

Good Will Hunting

🦉 olshansky 🦁 — Thu, 05 Dec 2013 11:37:33 GMT

Olshansky's review of Good Will Hunting

Everything Must Go

🦉 olshansky 🦁 — Thu, 05 Dec 2013 11:37:10 GMT

Olshansky's review of Everything Must Go

AngelList is the NASDAQ of our generation.

Blog posts of Andreas Klinger — Thu, 05 Dec 2013 02:00:00 GMT

It’s fair to say that Angellist is the most exciting (web/mobile) tech startup in 2013. Even before they launched syndicates, earl...

Benchmark Analysis Of PHP Array Loops

KernelCurry — Thu, 05 Dec 2013 02:00:00 GMT

UPDATE: Migrated from a post I wrote when working on leve.rs

The last post I wrote provided examples of different ways to use array manipulation in PHP Link. An amazing number of people replied with a compelling argument, saying it’s better to use a foreach statement instead of the array_walk function.

As all comments I receive from my articles, I thought hard on the idea. What is the fastest way achieve the end result?

Wrap IDs in objects

Databases & Life — Thu, 05 Dec 2013 02:00:00 GMT

In Java, I like to wrap ID values in objects, rather than just passing them around the code as their native "int" or "long" or "String" values.

The reasons are twofold why using an object is better:

Code becomes more readable, for example foo(LoginId x) is more readable than foo(long x). (Although perhaps neither foo nor x are good names, so perhaps the example over-exaggerates this improvement.)
The compiler can do more checking. If you pass the ID of one type of object (as a long) to a function expecting the ID of a different type of object (as a long), the compiler cannot warn you of your mistake. This becomes particularly relevant if you have a function taking two IDs and you pass them the wrong way around.

Things to consider when writing such an “ID object”

Cabin Porn Roundup

Zac Szewczyk — Wed, 04 Dec 2013 22:49:33 GMT

Starting with November month, I have decided to take a different approach to posting links to cabins I find inspiring, attractive, or otherwise worthy of note: rather than make an individual post each time I come upon such a structure, from here on out I will hold them for the end of the month when I can collect my favorite posts and pictures. This will not only reduce the volume of “Wow.” and “Beautiful.” one-word link posts I have made a habit of publishing since discovering the Cabin Porn Tumblr last year, but will also allow me to centralize these relevant thoughts into a single monthly post.

Permalink.

Thoughts on Bitcoin

Zac Szewczyk — Wed, 04 Dec 2013 22:17:00 GMT

When news of a new currency dubbed “Bitcoin” first began circulating, I paid little attention: it seemed like a fad, something no one would remember in a month or two. Instead of fading away though, Bitcoin continued to gain popularity until not a day went by without someone writing an article either glorifying the currency for its upsides or crucifying it for any number of perceived downsides, whether real or not. An interesting parallel could be drawn between these fickle emotions and the manner in which many publications report on certain topics as of late, but I will let sleeping dogs lie.

Permalink.

cell flash cache read hits vs. cell writes to flash cache statistics on Exadata

Tanel Poder Blog — Wed, 04 Dec 2013 13:57:09 GMT

When the Smart Flash Cache was introduced in Exadata, it was caching reads only. So there were only read “optimization” statistics like cell flash cache read hits and physical read requests/bytes optimized in V$SESSTAT and V$SYSSTAT (the former accounted for the read IO requests that got its data from the flash cache and the latter ones accounted the disk IOs avoided both thanks to the flash cache and storage indexes). So if you wanted to measure the benefit of flash cache only, you’d have to use the cell flash cache read hits metric.

This all was fine until you enabled the Write-Back flash cache in a newer version of cellsrv. We still had only the “read hits” statistic in the V$ views! And when investigating it closer, both the read hits and write hits were accumulated in the same read hits statistic! (I can’t reproduce this on our patched 11.2.0.3 with latest cellsrv anymore, but it was definitely the behavior earlier, as I demoed it in various places).

Side-note: This is likely because it’s not so easy to just add more statistics to Oracle code within a single small patch. The statistic counters are referenced by other modules using macros with their direct numeric IDs (and memory offsets to v$sesstat array) and the IDs & addresses would change when more statistics get added. So, you can pretty much add new statistic counters only with new full patchsets, like 11.2.0**.4**. It’s the same with instance parameters by the way, that’s why the “spare” statistics and spare parameters exist, they’re placeholders for temporary use, until the new parameter or statistic gets added permanently with a full patchset update.

So, this is probably the reason why both the flash cache read and write hits got initially accumulated under the cell flash cache read hits statistic, but later on this seemed to get “fixed”, so that the read hits only showed read hits and the flash write hits were not accounted anywhere. You can test this easily by measuring your DBWR’s v$sesstat metrics with snapper for example, if you get way more cell flash cache read hits than physical read total IO requests, then you’re probably accumulating both read and write hits in the same metric.

Let’s look into a few different database versions:

Letting PHP know that its connection behind NGINX is over HTTPS

Thomas Hunter II — Tue, 03 Dec 2013 02:00:00 GMT

Go Binary Sizes Are Growing out of Control

Donat Studios — Tue, 03 Dec 2013 01:25:43 GMT

Update 2019-07-17: I have released a follow up post Go Binary Sizes Are Relatively Stable which speaks on what's happened in the time since this was published.

Note: This is not intended as a "Go Sucks" post. I love Go. I am not saying the developers are lazy or dumb or any of the things Reddit has implied. I am not implying I could build a better compiler. Rob Pike and the Go team are geniuses whom I look up to. The tone of this was intended to be a light "man I wish binaries were smaller" but that is not how Reddit seemed to take it. Also, the title is hyperbole and not meant to literally mean no one has control over it.

I started toying with Go about two years ago before the 1.0 release. I love the language, it meets me in a comfortable place between C and a scripting languages like PHP. I find it fun to write and an easy way to bust out performant code quickly. The binaries for a simple Hello, 世界 were large though, around 55KB. I figured this was something the Go team would work out later; it is a lot of space just to send a string to standard out.

With the release of Go 1.0 though, I noticed the binary size had grown slightly to 242KB. Discouraging but livable. I was quite hopeful with the 1.1 release, but it had actually nearly doubled in size coming out to a whopping 405KB. Then this morning I compiled it again in the newly release 1.2 and to my horror the ever simple program came out to 557KB.

What on earth is going on in that binary? I am no expert on compilers but I would imagine the vast majority of what is in there is completely unnecessary and could be optimized out. Changing the script to "Hello, World" rather than Go's flaunted unicode version has zero effect on binary size, as one would expect but I was hopeful.

For reference the complete source of my Hello, 世界 follows. Using fmt comes out even larger.

package main

func main() {
    println("Hello, 世界")
}

Here is a collection of binaries compiled in different versions of Go. Notice how imgavg grows from 1.9MB to 3.7MB. My applications are all small tools. I can only imagine the effect this has an already large application.

I really hope something is done about this. I would love to see tiny (<32KB) binaries from Go but right now that doesn't seem to be a priority for them. The fact that Hello, 世界 fills half a floppy means the language is not be useful for lighter or embedded environments.

As noted in the header there is an addendum to this:

Go Binary Sizes Are Relatively Stable

On Why I Still Prefer Traditional Books to eBooks

Nicola Iarocci — Mon, 02 Dec 2013 02:00:00 GMT

I’ve been using a Kindle for a long time now, and I love it. But I keep buying paper books. Lots of them. Actually I buy a lot more books than ebooks and it doesn’t even stop there. Admittedly, I am guilty of repeatedly buying paper editions of ebooks I’ve read on the Kindle.

For a very long time I’ve not been able to tell the precise reason why I keep going back to traditional books. It’s not about the reading experience or the sexiness of turning physical pages. Well of course that matters too, as I’ve always been kind of a book fetishist, but since the very beginning of my love-hate relationship with the Kindle I’ve always known there had to be something else, and I couldn’t pin it down.

See which user accounts hackers try to access on your server the most

Thomas Hunter II — Mon, 02 Dec 2013 02:00:00 GMT

Monthly Review: November

Josh Thompson — Sun, 01 Dec 2013 02:00:00 GMT

This is my second monthly review, and I’m hooked. I’ve thought this coming review frequently, but I thought about that as I was conducting my month. This proactive review is in line with Viktor Frankl’s admonition to “live every day as if it were your second chance to live it.” This simple piece of advice, and another one, are packaged for free and available in the Storyline Productivity Schedule (it’s free, and worth reading).

November Review

My marriage Kristi and I are growing, and as any relationship does, go through ups and downs. The trend is up, and as I have thought and prayed about our relationship, we have both been able to identify a few specifics that we want to work on and improve. We can (usually) converse easily about the health of our relationship, and work together to love each other better. This month we have both gotten to spend time with our respective families, and we have enjoyed ourselves. There had sometimes been friction with each others families, so this is a big win.
Significant relationships I write this from my parents house in TN, where more of my family has assembled then has been together in at least three years. I called each of my grand parents once last month, which is one time more than I’d called them in months. Positive progress.
Side projects I’ve been so excited about two side projects I’ve sometimes been unable to fall asleep at night. One is still under wraps, but the other is one I need help with (from all you climbers). I’m writing an e-book about dealing with fear while lead climbing. Last month I said I had to have my edits done by this coming month, and so it’s done. I want to get out and get more feedback, then release it to the world.

This side project has quickly morphed into a complicated beast, but I’ve allowed the total complexity to hinder progress in the small but important ways, like… you know… writing the book. I’m done with the first draft. This is a big deal.

My job At work we had some of our busiest days of the hear, and in some important ways, at least one day was an almost total failure. It wasn’t my fault at all, but it’s frustrating. I’ve found that working in short bursts with a little break is good (when I’m in the office, a sprint up and down the ten flights of stairs is a life changer). I’ve struggled with hopelessness there, so… I’m still wrestling with that in my head.
Physical goals My current project is handstands. I can hold myself in the handstand position against a door for about 90 seconds, and I can “hold” a freestanding handstand for, at best, five seconds. But that’s five seconds longer than last month. I started with this blog, and have branched out from there. I’ve never spent more than five minutes a day practicing. You should give it a shot too.

I’ve encountered another interesting issue - I fear the opinions of others when practicing this kind of stuff. Seriously. Even practicing at home around my wife, I feel like I had to prove I wasn’t insane. She stopped me and said “Josh. You can practice what every you want. You’re not in trouble.”

Practicing outside is even harder. I’ve also noticed I don’t want to do sprint training in a field by myself, because it will look weird. It’s strange, having all this fear, but it’s nice recognizing it. Onward!

Finances Still an important factor to us. Kristi and I had fun conversation when it turned out our credit card was not automatically synching with our money tracking tool, so all of our non-debit spending was not being accounted for. We’ve fixed that, but we’re still nailing these details down.
Debt reduction (student loans, car loan) Debt reduction ration of 1.0. Sufficient, but far from ideal.
My monthly reviews On my second monthly review, I’ve felt that this is extremely good for me. I don’t like waiting for a full month, though, so I may toy with a bi-monthly review. Every two weeks. Or maybe a bi-monthly review on some select topics (side projects, finances, and habits being the top candidates). Either way, this reflectivity is extremely helpful. I’d encourage y’all out there to try it. Blogging can be free (I pay $18/yr for the domain, and that’s my only cost. So… we’ll call it $1.50/mo. Pretty cheap) but can encourage a lot of good things.
Habits I’ve struggled to get up early, because I’m struggling to go to bed early. My evening routine is not a routine at all, and I think this is part of the problem. I also lose control of my early-rising habit when traveling. I think it’ll help me to lay my clothes out in the morning, and have a clear reason for why I am trying to get up early. That will help get me out of bed. (This all ties back to the PM routine.)

Sometimes I get up at 5:30, feeling great. Sometimes I can’t get out of bed before 8:00. Not consistent at all.

For my entire adult life, I’ve been convinced I don’t have dreams, because I never have been aware of any. Then I read Tim Ferris’s article on lucid dreaming, and I decided to give it a shot. I’m still in the “write down what you can remember when you wake up” phase, but I’m now aware that I dream, and have vague memories of them.

I’ve picked up kettlebell swings again. I feel like I’m not challenging myself physically, so I’m back at them. I need more weight - I want to get to 100lb swings, but only have 60lbs of weight to work with. I’ll check out local gyms for discarded plates to see if I can get any more weight.

Significant events Nothing life changing happened in the last few weeks, but there have been lots of little shaping experiences. Serendipitous conversations with important people, or feeling on-the-spot when I didn’t have time to prepare. Opportunities to surprise my wife, or be kind to a stranger. These incidents are the stuff of life, and I don’t want them to pass me by.

This concludes my monthly review. Stay tuned for updates on side projects. If you climb, I will need your help!

Tips for assembling the O2 (Objective2) Headphone Amplifier Kit

Thomas Hunter II — Sun, 01 Dec 2013 02:00:00 GMT

Hard Drive Predictive Failures on Linux and Exadata

Tanel Poder Blog — Fri, 29 Nov 2013 14:50:00 GMT

This post also applies to non-Exadata systems as hard drives work the same way in other storage arrays too – just the commands you would use for extracting the disk-level metrics would be different. Scroll down to smartctl if you wan’t to skip the Oracle stuff and get straight to the Linux disk diagnosis commands.

I just noticed that one of our Exadatas had a disk put into “predictive failure” mode and thought to show how to measure why the disk is in that mode (as opposed to just replacing it without really understanding the issue ;-)

SQL> @exadata/cellpd
Show Exadata cell versions from V$CELL_CONFIG....

DISKTYPE             CELLNAME             STATUS                 TOTAL_GB     AVG_GB  NUM_DISKS   PREDFAIL   POORPERF WTCACHEPROB   PEERFAIL   CRITICAL
-------------------- -------------------- -------------------- ---------- ---------- ---------- ---------- ---------- ----------- ---------- ----------
FlashDisk            192.168.12.3         normal                      183         23          8
FlashDisk            192.168.12.3         not present                 183         23          8                     3
FlashDisk            192.168.12.4         normal                      366         23         16
FlashDisk            192.168.12.5         normal                      366         23         16
HardDisk             192.168.12.3         normal                    20489       1863         11
HardDisk             192.168.12.3         warning - predictive       1863       1863          1          1
HardDisk             192.168.12.4         normal                    22352       1863         12
HardDisk             192.168.12.5         normal                    22352       1863         12

So, one of the disks in storage cell with IP 192.168.12.3 has been put into predictive failure mode. Let’s find out why!

A Perk of Using WebGL

Varun Ramesh's Blog — Fri, 29 Nov 2013 02:01:00 GMT

WebGL games can use HTML/CSS for GUIs. It's a lot easier to use than most game engine UI frameworks.

Recent Hackathon Projects

Varun Ramesh's Blog — Thu, 28 Nov 2013 23:46:00 GMT

I write about some recent hackathon projects I worked on.

kotlin - a new hope

zserge's blog — Thu, 28 Nov 2013 02:00:00 GMT

I’ve been looking for Java alternatives since my first days of Android development. I can’t say I don’t like Java. It’s a nice language, very easy to learn and pretty logical. But the lack of proper functional style constructions often inspires me to check what’s new in the field of JVM languages. So far I’ve tried (tried, I never learnt these languages properly): Mirah - a very nice Ruby-translated-to-Java language.

Raspberry Pi Pulling the Plug

peanball.net — Thu, 28 Nov 2013 02:00:00 GMT

While browsing for different breakout boards for the Rover I’ve discovered a nice little board that has a push button and logic pin to control a MOSFET.
This little contraption allows switching on and off the power, say through a USB cable.

Making HackerTray

Nemo's Home — Thu, 28 Nov 2013 02:00:00 GMT

A few days back, I found the excellent HackerBarApp via Hacker News. Hacker News, for those of you who don’t know, is tech news website run by YCombinator. Hacker Bar was the simplest way of accessing HN stories that I’d ever seen. Unfortunately, it was only for Mac (made using rubymotion) and even though the source was available, it was of no use to me as a Linux User.

I decided to make a clone of Hacker Bar that would work on Linux. My first choice of the stack was node-webkit, an application framework that allows you to build cross-platform applications using HTML, CSS, JS, and modules from the node.js ecosystem. After reading a lot about node-webkit, I figured out that building this application in node-webkit (as it stands) would not be possible. Or rather, it would not work under Ubuntu and its derivatives because of lacking appindicator support in node-webkit. More details here.

The next obvious language and stack of choice was Python + Gtk. I’d already played a little bit with Gtk and Python some time back, so I knew the basics. But I’d never build a real application with PyGtk, just toys and small scripts. I found a basic skeleton app that was written for AppIndicator and modified it somewhat to form the base of HackerTray.

The next challenge I faced was keeping the check boxes always checked despite of any number of clicks after the first. That is, we don’t want any menu item to be “un-checked” at any moment. A basic idea is to do this (partial code):

def open(self, widget):
	if(widget.get_active() == False):
		widget.set_active()
	webbrowser.open(widget.url)

def addItem(self, item):
	#create a new CheckMenuItem (i)
	i.connect('activate', self.open)

However, this does not work as expected, because the widget.set_active() call also results in the activate event being fired, which ultimately calls open. This means on a click to an unchecked menuItem, the open function is called twice. This results in the browser opening the link twice.

As a workaround, I disabled the event handler in case it is a checked menuItem:

def open(self, widget):
	if(widget.set_active() == False)
		wiget.disconnect(widget.signal_id)
		widget.set_active(true)
		widget.signal_id = widget.connect('activate', self.open)
	webbrowser.open(widget.url)

def addItem(self, item):
	#create a new CheckMenuItem (i)
	i.connect('activate', self.open)
	i.signal_id = i.connect('activate', self.open)

The next thing I worked on was a persistent memory for the app. In a nutshell, I needed to make sure that the tick on an item remained there, even if the app was restarted. This meant writing a list of all the “viewed” items into a file. After looking at shelve for a bit, I just rolled my own implementation , based on storing the data into ~/.hackertray.json file.

After that I worked on packaging the app into a python package, so that it could be easily installed. The python packaging tutorial was an easy to use guide that let me create the package easily and push it to the Python Package Index. A few issues in the package were found, and were fixed quickly thanks to the pull request by @brunal.

After improving the README a bit, I posted about it on Hacker News, where it failed to get any traction. I re-tried with a link to the HackerTray website, and that fell flat as well. It was on the next day, when I posted it to HN for the third time, that it took off. After 50 or so upvotes, I found that my instance refused to run because it had hit the API Rate Limit on the excellent node-hnapi. I quickly pushed a fix that used a list of servers to hit as fallback in case it crossed the Rate Limits.

After a lot of feedback from HN, I started work on a node-webkit based clone of hackertray for Windows. I should be able to release it in a few more days, if nothing else crops up. Keep watching this space for info. If you have any queries, just file an issue on GitHub or contact me.

Impressed by a 10 year old desktop computer

Jason Eckert's Website and Blog — Thu, 28 Nov 2013 02:00:00 GMT

Long story short, I scored a free SGI Fuel computer along with the SGI Origin 300 computer I described two posts ago.

But the SGI Fuel is a much more “usable” computer because it is a powerful single-processor graphical desktop computer (what Silicon Graphics was best known for).

Here is what it comes with:

4GB RAM
600MHz R14000A MIPS CPU (64-bit)
Two SCSI hard disks
DVD writer
Odyssey video card (DVI) that takes up the entire bottom of the cabinet
IRIX 6.5 UNIX
Street cred among UNIX nerds

To the right is a picture of the case.It’s far larger and heavier than a standard desktop PC case. And no, it’s not pink……it’s fuchsia ;-)

University Presentation

Tom Forbes — Wed, 27 Nov 2013 20:19:28 GMT

So I did a presentation on Information Security at University today. I think it went rather well, however I couldn’t show a couple of the demonstrations due to some SkyDrive files only being available online. That sucked because those were my best demonstrations, but overall I was happy. A few peopl...

When do Oracle Parallel Execution Slaves issue buffered physical reads – Part 2?

Tanel Poder Blog — Wed, 27 Nov 2013 13:32:36 GMT

In the previous post about in-memory parallel execution I described in which cases the in-mem PX can kick in for your parallel queries.

A few years ago (around Oracle 11.2.0.2 and Exadata X2 release time) I was helping a customer with their migration to Exadata X2. Many of the queries ran way slower on Exadata compared to their old HP Superdome. The Exadata system was configured according to the Oracle’s “best practices”, that included setting the parallel_degree_policy = AUTO.

When do Oracle Parallel Execution Slaves issue buffered physical reads – Part 1?

Tanel Poder Blog — Wed, 27 Nov 2013 12:32:38 GMT

This post applies both to non-Exadata and Exadata systems.

Before Oracle 11.2 came out, it was true to say that Oracle Parallel Execution slaves always do direct path reads (bypassing buffer cache) when doing full segment scans. This should not be taken simplistically though. Even when you were doing full table scans, then yes the scanning was done with direct path multiblock reads – but if you had to visit other, additional blocks out of the scanning sequence, then these extra IOs were done with regular buffered reads. For example, next row piece fetching of chained rows or or undo block access for CR reads was done with buffered single block reads, or even buffered multiblock reads, if some form of prefetching kicked in.

In addition to that, random table/index accesses like index range scans and the following table block fetches are always done in a buffered way both in serial and parallel execution cases.

Starting from Oracle 11.2 though, Oracle parallel execution slaves can also do the parallel full segment scans via the buffer cache. The feature is called In-Memory Parallel Execution, not to be confused with the Oracle 12c upcoming In-Memory Option (which gives you a columnar, compressed, in-memory cache of your on-disk data).

PostgreSQL - It's kind've a nifty database

Brightball Articles — Wed, 27 Nov 2013 11:42:00 GMT

This is a presentation I recently gave to provide an overview of PostgreSQL and some of it's excellent features, including full-text search, multiple built in datatypes, data compression and extensions. Also, Morgan Freeman is narrating. You're welcome.

Amateur Hour is Over

Zac Szewczyk — Wed, 27 Nov 2013 11:25:16 GMT

I love The Verge — I really do. Not long after posting Credibility and Bullies with Blogs, where I took Josh Topolsky to task for his wholly inappropriate reaction to many justifiable criticisms regarding his publication’s device reviews, I subscribed to The Verge. Today it not only serves as my primary news source, but I also follow The Vergecast and tune in for their live coverage of Apple’s events. Lately, however, I have been increasingly disappointed with their work.

Permalink.

Advanced recursion and memoization in Puppet

The Technical Blog of James on purpleidea.com — Wed, 27 Nov 2013 02:03:15 GMT

As a follow-up to my original article on recursion in Puppet, and in my attempt to Push Puppet (to its limit), I’ll now attempt some more advanced recursion techniques in Puppet.

In my original recursion example, the type does recurse, but the callee cannot return any value to the caller because it is a type, and not strictly a function. This limitation immediately limits the usefulness of this technique, but I’ll try to press on! Let’s try to write a Fibonacci series function in native Puppet.

pixelsim

Matt Keeter — Wed, 27 Nov 2013 02:00:00 GMT

Squishy pixel-art spaceships on the GPU

Sound in Python

bastibe.de — Wed, 27 Nov 2013 02:00:00 GMT

Have you ever wanted to work with audio data in Python? I know I do. I want to record from the microphone, I want to play sounds. I want to read and write audio files. If you ever tried this in Python, you know it is kind of a pain.

It's not for a lack of libraries though. You can read sound files using wave, SciPy provides scipy.io.wavfile, and there is a SciKit called scikits.audiolab. And except for scikits.audiolab, these return the data as raw bytes. Like, they parse the WAVE header and that is great and all, but you still have to decode your audio data yourself.

The same thing goes for playing/recording audio: PyAudio provides nifty bindings to portaudio, but you still have to decode your raw bytes by hand.

But really, what I want is something different: When I record from the microphone, I want to get a NumPy array, not bytes. You know, something I can work with! And then I want to throw that array into a sound file, or play it on a different sound card, or do some calculations on it!

So one fateful day, I was sufficiently frustrated with the state of things that I set out to create just that. Really, I only wanted to play around with cffi, but that is beside the point.

So, lets read some audio data, shall we?

import soundfile
data = soundfile.read('sad_song.wav')

done. All the audio data is now available as a NumPy array in data. Just like that.

Awesome, isn't it?

OK, that was easy. So let's read only the first and last 100 frames!

import soundfile
first = soundfile.read('long_song.flac', stop=100)
last = soundfile.read(start=-100)

This really only read the first and last bit. Not everything in between!

Note that at no point I did explicitly open or close a file! This is Python! We can do that! When the SoundFile object is created, it opens the file. When it goes out of scope, it closes the file. It's as simple as that. Or just use SoundFile in a context manager. That works as well.

Oh, but I want to use the sound card as well! I want to record audio to a file!

from pysoundcard import Stream
from pysoundfile import SoundFile, ogg_file, write_mode
with Stream() as s: # opens your default audio device
    # This is supposed to be a new file, so specify it completely
    f = SoundFile('happy_song.ogg', sample_rate=s.sample_rate,
                  channels=s.channels, format=ogg_file,
                  mode=write_mode)
    f.write(s.read(s.sample_rate)) # one second

Read from the stream, write to a file. It works the other way round, too!

And that's really all there is to it. Working with audio data in Python is easy now!

Of course, there is much more you could do. You could create a callback function and be called every four¹ frames with new audio data to process. You could request your audio data as int16, because that would be totally awesome! You could use many different sound cards at the same time, and route stuff to and fro to your hearts desire! And you can run all this on Linux using ALSA or Jack, or on Windows using DirectSound or ASIO, or on Mac using CoreAudio². And you already saw that you can read Wave files, OGG, FLAC or MAT-files³.

You can download these libraries from PyPi, or use the binary Windows installers on Github. Or you can look at the source on Github (PySoundFile, PySoundCard), because Open Source is awesome like that! Also, you might find some bugs, because I haven't found them all yet. Then, I would like you to open an issue on Github. Or if have a great idea of how to improve things, please let me know as well.

UPDATE: It used to be that you could use indexing on SoundFile objects. For various political reasons, this is no longer the case. I updated the examples above accordingly.

You can use any block size you want. Less than 4 frames per block can be really taxing for your CPU though, so be careful or you start dropping frames.↩
More precisely: Everything that portaudio supports.↩
More precisely: Everything that libsndfile supports.↩

Kirill Zubovsky: Founder of Scoutzie

Sam Solomon — Wed, 27 Nov 2013 02:00:00 GMT

Kirill Zubovsky is the founder of Scoutzie, an online marketplace that connects designers and clients.

My Dimension in Rift

Ben Overmyer's Site — Wed, 27 Nov 2013 02:00:00 GMT

I started playing Rift again, after trying out Everquest 2 and Guild Wars 2 also. Until Everquest Next Landmark comes out, Rift may be my fantasy MMO of choice. We'll see.

Book Two: Spirits

Zac Szewczyk — Tue, 26 Nov 2013 21:51:48 GMT

Back in May I wrote Nickelodeon’s Experiment where I talked about the network’s hit animated series Avatar: The Last Airbender and its sequel, Avatar: The Legend of Korra. Last week the latter’s show finished its second season with the final episode of “Book Two: Spirits”. In preparation for the third, I thought I would post a mid-series update. As with my last article on this topic, spoiler alert, I will give away big parts of the story in this piece; if you haven’t seen the excellence that is Nickelodeon’s Avatar franchise, read the next two paragraphs and then go watch it before continuing on.

Permalink.

Auto-generating JSON serialization code in Objective C

Evan Todd — Tue, 26 Nov 2013 13:10:01 GMT

I wrote this article for the Sidebolt company blog. Reposting it here for your reading pleasure!

Our latest game Skyward Slots makes extensive use of JSON. We send Gigabytes of it flying back and forth haphazardly between client and server over a WebSocket connection. At first, we wrote code by hand to pack and unpack each message. Later on we decided that life is too short for that.

In the beginning, we just dove into the JSON right where we needed it.

Simulating UIScrollView in Cocos2D

Evan Todd — Tue, 26 Nov 2013 13:07:40 GMT

I wrote this article for the Sidebolt company blog. Reposting it here for your reading pleasure!

We publish our games on both Mac and iOS. Since UIKit is not available on Mac, we have to build all of our UI by hand in Cocos2D. One of the hardest parts to get right was emulating the UIScrollView bouncy scroll formula. Here it is in action:

There are tons of implementations available in nearly every language and framework, but few of them nail all the important properties of the UIKit scroll:

GitHub: Convert an issue to a pull request

Carey Metcalfe — Tue, 26 Nov 2013 08:46:00 GMT

GitHub currently doesn't provide a way to convert an issue to a pull request in their interface. However, the capability exists in their Pull Request API.

Update

I've built a self-hostable webapp called gh-i2p that makes this process easier.

To call the API using a simple curl command, run the command:

curl --user "[github username]" \
     --request POST \
     --data '{"issue": "[issue num]", "head": "[branch to merge from]", "base": "[branch to merge into]"}' \
     https://api.github.com/repos/[user]/[repo]/pulls

For example, to make user1 change issue 13 into a pull request to merge branch test_branch into master in the testing_repo repository belonging to user2, the command would be:

curl --user 'user1' \
     --request POST \
     --data '{"issue": "13", "head": "test_branch", "base": "master"}' \
     https://api.github.com/repos/user2/testing_repo/pulls

To specify a fork of a repository to merge from, put the username followed by a semicolon in front of the branch name like so: "username:branch_name"

After running the command, you will be prompted for your GitHub password. Enter it and curl should output the JSON response from the API. Make sure to check this response for errors!

Rover with Raspberry Pi

peanball.net — Tue, 26 Nov 2013 02:00:00 GMT

Using the Motor Controller

peanball.net — Tue, 26 Nov 2013 02:00:00 GMT

The Raspberry Pi has only a single PWM output. The Dagu Rover 5 chassis has 4 motors and 4 optical encoders that need reading as well. So my approach was to get a PWM servo/logic controller that could control the Dagu Motor Controller and additionally some servos for the camera pan/tilt.

New Web Site Skin

peanball.net — Mon, 25 Nov 2013 02:00:00 GMT

I’ve updated the skin on the web site for something better looking.

It’s based on the UP skin.

GitLab 6.3 with Apache and Passenger. On an ARM

kyrofa's blog — Mon, 25 Nov 2013 02:00:00 GMT

As I’ve mentioned in previous posts, I run all my websites on a MiraBox– my nifty, low-power ARM server. As awesome as it is having a low-power server, it does make things more difficult. I’m a Ruby on Rails developer, and I run three websites on this thing, along with a gitolite installation so I can host my own code. However, I recently began a few projects collaborating with other people, and as the projects grow, gitolite is not the collaboration platform of success.

Visualizing a security disaster, part I

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sun, 24 Nov 2013 21:11:50 GMT

The recent security blunder by Adobe (definitely an epic on the fail scale) should have reached everyone by now. In case the consequences are still not clear, I decided to visualize parts of the leaked database dump. More precisely, I wanted to get a sense of the password hints used by people in order to see if some trends emerged. I started out by simply counting the frequencies of words used in the password hints–not removing anything stop words, just a simple frequency analysis. Here’s the (very simple) Python script:

#!/usr/bin/env python

import re
import collections

word_frequencies = collections.Counter()

with open( "cred" ) as f:
  for line in f:
    line   = line.strip()
    line   = line[:-3]

    fields =  re.split( '-\|-', line )

    if len( fields ) >= 5 and fields[4]:
      for word in fields[4].split():
        word_frequencies[ word.lower() ] += 1

for pair in word_frequencies.most_common():
  print pair[0], "\t", pair[1]

Afterwards, I used wordle to generate a word cloud of the password hints. This is the result (click the image for a larger version):

Not surprisingly, people seem to use names very often when generating passwords. This is why spouses are also mentioned very often, along with pets. Interestingly, dog was mentioned more often than cat. Some lone number either refer to a password scheme, i.e. combining passwords 1 and 2 to form a longer one, or to the actual password–I did not check this for the same reason I am not releasing any data other than the word cloud. Those poor users already have enough problems as it is, they do not need one more idiot (yours truly) trying to guess stuff about them.

There are some appalling things, though: First, note how often the word usual appears. This is not a good idea, people! If you use the same “usual” password for multiple services, all it takes is one weak link and attackers will be able to compromise large parts of your digital life, and probably at least some parts of your real life, as well. Furthermore, there are obviously still many people who believe that birthdays or social security numbers are good passwords. In short, they don’t. In fact, professional attackers will check those low-hanging fruits first. Checking names for a hubby, a cat, a dog, or the date of a birthday takes tremendously less time than checking all possible combination in a, say, 52-character alphabet.

The security community thus obviously still has some work to do here. First, one should start with explaining people how to choose secure passwords. Second, incompetence of this scale needs to be punished. To clarify: The fact that Adobe’s data got copied does not bother me as much as their stupidity in storing it! I again refer you to this very enlightening article about the errors in storing passwords (and password hints) the way Adobe did. This is inexcusable for a company this large.

Systematic Casting Call

Zac Szewczyk — Sat, 23 Nov 2013 11:36:58 GMT

Yesterday morning Brett Terpstra posted an article to his blog calling for open auditions to guest on his podcast Systematic. Like many, many others I’m sure, I made a submission. I briefly introduced myself then, in typical Systematic fashion, went on to my top three picks for the “show”. Looking to increase my chances of getting the spot, I decided to make an extra effort by posting an article here in case Brett decides to look for further information on my website.

Permalink.

How to Sell a Blog for $36,200

Zac Szewczyk — Sat, 23 Nov 2013 09:38:37 GMT

An interesting story made all the more absorbing by the model Amanda employed in stark contrast to the one nearly all writers in the circles I frequent employ. Whereas we hold the individual’s reputation on high — I read people, not websites — she takes the opposite approach in impersonally finding, occupying, and ultimately cashing out on an existing niche rather than create her own as I and many others are want to do. A thought-provoking approach, to say the least, and inarguably effective: I can’t argue with her results.

Permalink.

Hack things, acquire clothing.

Tom Forbes — Fri, 22 Nov 2013 18:59:42 GMT

I discovered an XSS flaw in a website a month ago and reported it to the owners. As a thank you they sent me a hat, a rather large american sized t-shirt and a pair of “DeFeet” socks (guaranteed to stay cooler and drier than any other brand). I didn’t expect them to ship something like that overseas...

Man of Steel

🦉 olshansky 🦁 — Fri, 22 Nov 2013 16:21:16 GMT

Olshansky's review of Man of Steel

It was a Good Week

duncanlock.net — Fri, 22 Nov 2013 12:57:06 GMT

Figure 1. Taken from my Wife’s office window, around 10am.

The weather was great this week - crisp and autumnal, with beautiful sunshine all week. It snowed a little on the local mountains and Cypress Mountain has opened for (limited) Skiing already, using the lower temperatures to make lots of extra snow. Whistler also opened this week, along with Grouse.

Figure 2. Taken from my Wife’s office window in the afternoon, during the Golden Hour, which is now around 4pm.

In other, even better news, I’m starting a fantastic new job with PHEMI Health Systems on Monday - allowing me to afford to actually go skiing. I’ll be working as a front-end web developer, helping to build their healthcare information system, directly helping to improve clinical productivity, patient outcomes and medical research. Very excited to be using my skills for something worthwhile & interesting - while working with an amazing group of very smart people.

I am a very, very luck guy - and I have a lot to be thankful for.

A Year of Firsts

Zac Szewczyk — Thu, 21 Nov 2013 15:28:11 GMT

This year marked the first time I have taken any interest in reading long-form hardware and software reviews of any kind. Previously, as I described in Diary of a Convert, I rarely made it past the first few pages; this time around, however, I not only plowed through John Siracusa’s twenty-four page epic, but many others’ as well. I learned a great deal about Apple’s latest hardware and software offerings through this process, something I look to repeat from here on out. In preparation for next year, then, I paid great attention to reviewers and their work so that rather than shopping around for yet another iOS 8 review next fall, I can instead read the thoughts of a select few writers and in doing so enable myself to devote much more time and energy to my own work, which trends would indicate will increase once more after Tim Cook closes his keynote address.

Permalink.

Building a Rover

peanball.net — Thu, 21 Nov 2013 02:00:00 GMT

Recently I’ve started building a remote-controllable rover. The main purpose of this is the exercise of controlling an embedded system and make actual things move with code.

Hoards Of Novices

Text(Greg); — Wed, 20 Nov 2013 15:36:47 GMT

Uncle Bob Martin:

Is the software industry trying to write the script for Hamlet by hiring a million monkeys to bang on keyboards? Perhaps we should rethink that strategy and hire one bard instead. Perhaps, instead of hoards of novices, we need a small team of professionals.

http://blog.8thlight.

Documentation for Puppet-Gluster

The Technical Blog of James on purpleidea.com — Wed, 20 Nov 2013 08:36:19 GMT

Ironically, one of the reasons that I started writing Puppet code, was so that I could spend more time designing and building, and less time writing documentation. I suppose I’m a victim of my success, because Puppet-Gluster has grown large enough to warrant its own documentation.

So I gave in, and put together some documentation.

It’s available as markdown, and, also as a pdf. As before, there is an examples/ directory which you might want to use as additional reference.

I Will Do Such Things by William Shakespeare

ho.dges.online — Wed, 20 Nov 2013 02:00:00 GMT

“I will do such things – What they are yet, I know not; but they shall be The terrors of the earth!”_
King Lear, Act 2, Scene 4

FTL: A Blend of Narrative and Gameplay

The David Brownman Blog — Wed, 20 Nov 2013 02:00:00 GMT

undefined

Read the whole thing.

Retrospectively Thankful

Zac Szewczyk — Tue, 19 Nov 2013 21:44:56 GMT

I think about my English classes almost every day when I sit down to write, and even some days when I don’t. I think about how much I hated them, how I dreaded each pointless class and similarly meaningless assignment, and then I think about the eternal debt of gratitude I owe those three teachers for seeing me through.

Permalink.

New Geek Badge: Soldering

Pete's Points — Tue, 19 Nov 2013 08:08:35 GMT

So after a few months of Chinese holiday delays, my ErgoDox DIY keyboard kit has finally arrived. There are amazing videos of how to assemble the thing on youtube, and thankfully my roommate was an electrical engineering student at CU and lent me his soldering station. I've started the process of soldering extremely tiny surface mounted diodes to the printed circuit boards. All together the project will require over 300 solder joints by my arithmetic. Pretty ambitious for a first project given my meatspace skills are severely deficient. The SMDs are so tiny that I need a magnifying glass to check they are facing the right direction. The project will for sure be sloppy, but I'm hoping it will indeed function once done. We'll see. I put about 18 SMDs on tonight and by the third row of 6 I was markedly improved from the first few. But there is a real skill to this soldering stuff.

Anyway, when I get it done, assuming it functions at all, it will be pretty kick-ass and by far the geekiest thing I have ever done. Tomorrow night I'll be taking it with me to the Solid State Depot hacker space open house to work on it some more and maybe get some pro tips.

How to create thumbnails for PDFs with ImageMagick on Linux

duncanlock.net — Tue, 19 Nov 2013 06:05:38 GMT

To create image thumbnails from a PDF document, run this in a terminal window:

$ convert -thumbnail x300 -background white -alpha remove input_file.pdf[0] output_thumbnail.png

The parameters to convert do the following things:

Parameter Effect

-thumbnail Similar to -resize, but optimized for speed and strips metadata.

x300 Make the thumbnail 300px tall, and whatever width maintains the aspect ratio.

-background white Sets the thumbnail background to white.

-alpha remove Removes the alpha channel from the thumbnail output.

input_file.pdf The PDF file to use as input.

[0] The page number of the input file to use for the thumbnail.

output_thumbnail.png The output thumbnail file to create.

Parameter	Effect
`-thumbnail`	Similar to -resize, but optimized for speed and strips metadata.
`x300`	Make the thumbnail 300px tall, and whatever width maintains the aspect ratio.
`-background white`	Sets the thumbnail background to white.
`-alpha remove`	Removes the alpha channel from the thumbnail output.
`input_file.pdf`	The PDF file to use as input.
`[0]`	The page number of the input file to use for the thumbnail.
`output_thumbnail.png`	The output thumbnail file to create.

If you want larger thumbnails, just change the x300 parameter to match. If you want to output .jpg’s (or anything else, like .gif), just change the file extension on the output_thumbnail.png parameter. If you leave the [0] off the end of the input filename, you’ll get a thumbnail for each page, not just the first; setting it to [1] will get you a thumbnail of the second page, and so on…

Do a whole folder at a time

To create thumbnails for a whole folder of PDF’s, do this:

$ for f in *.pdf; do convert -thumbnail x300 -background white -alpha remove "$f"[0] "${f%.pdf}.png"; done

This will create thumbnails with filenames that match the input PDF’s, except with an extra .pdf extension.

Requirements

This requires ImageMagick and Ghostscript, which you can install like this:

$ sudo apt-get install imagemagick ghostscript

This technique should also work on a Mac, provided you have these both installed.

MongoDB and REST API go for a picnic (video and slides)

Nicola Iarocci — Tue, 19 Nov 2013 02:00:00 GMT

I had the opportunity to give my RESTful WeB APIs and MongoDB Go For A Picnic talk at both MongoTorino and NoSQL Day. The folks at PUG Friuli where so nice to record all the NoSQL Day sessions, so here you have it: the full length video of yours truly speaking to a fully packed room crowded with 120 very attentive attendees.

Unfortunately audio is horrible and while all MongoTorino talks were in english, NoSQL Day was an italian-only event. The slide deck is in english however, and is available on both SpeakerDeck and SlideShare.

Cute MailChimp Subscriber Count Buttons

Graham Stevens – Grh.am — Tue, 19 Nov 2013 02:00:00 GMT

This post is rather outdated now, and so the details contained within are no longer valid. Read with caution.

I recently came across the rather snazzy looking subscriber count button on the Smashing Magazine website. A quick Google revealed that these are no longer available after MailChimp redesigned their service. Boo!

An example of the Smashing Magazine counter:

So, a quick look through the coding on this Smashing Magazine page revealed the following:

Tumblr as a Subdirectory (On Apache)

Graham Stevens – Grh.am — Tue, 19 Nov 2013 02:00:00 GMT

Not on nginx, but still want your Tumblr blog in a subdirectory? Henrik Nyh has got your back.

Have not personally used this, being a fan of nginx, but should at least be a good starting point to get you on your way.

Books I read in 2013

Krishna's blog — Tue, 19 Nov 2013 02:00:00 GMT

A list of books read in 2013, including fantasy, historical fiction, and science fiction.

Technology Adoption Curves vs. Birth Year and Life Expectancy

Dan Stroot — Tue, 19 Nov 2013 02:00:00 GMT

Asymco has done a fascinating piece of research mapping technology adoption curves, technology refresh rates, and human lifespan, to predict technology lifetime ownership. "...knowing how what innovations become universal and the speed at which these technologies are replaced can give us an idea of what individuals might experience in their lifetimes."

This post Technology Adoption Curves vs. Birth Year and Life Expectancy first appeared on Dan Stroot's Blog

The power of Big Data and the failures of online advertising

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 19 Nov 2013 00:27:57 GMT

Data is the new oil. Big data is poised to transform society. Soon everybody from individuals to government will be measuring and optimizing everything possible. In the meantime, though, lots of things may go wrong. There is an article out there on this very topic. It says that “nothing underscores the consequences of data analysis gone awry more than the story of Robert McNamara”. Maybe. As far as I’m concerned instead, nothing screams “data analysis gone awry” like the banner I found in that article and the point where it was placed:

The best Postgres feature you're not using – CTEs aka WITH clauses

CRAIG KERSTIENS — Mon, 18 Nov 2013 22:55:56 GMT

SQL by default isn’t typically friendly to dive into, and especially so if you’re reading someone else’s already created queries. For some reason most people throw out principles we follow in other languages such as commenting and composability just for SQL. I was recently reminded of a key feature in Postgres that most don’t use by @timonk highlighting it in his AWS Re:Invent Redshift talk. The simple feature actually makes SQL both readable and composable, and even for my own queries capable of coming back to them months later and understanding them, where previously they would not be.

The feature itself is known as CTEs or common table expressions, you may also here it referred to as WITH clauses. The general idea is that it allows you to create something somewhat equivilant to a view that only exists during that transaction. You can create multiple of these which then allow for clear building blocks and make it simple to follow what you’re doing.

Lets take a look at a nice simple one:

WITH users_tasks AS (
SELECT
users.email,
array_agg(tasks.name) as task_list,
projects.title
FROM
users,
tasks,
project
WHERE
users.id = tasks.user_id
projects.title = tasks.project_id
GROUP BY
users.email,
projects.title
)

Using this I could now just append some basic other query on to the end that references this CTE users_tasks. Something akin to:

SELECT *
FROM users_tasks;

But where it becomes more interesting is chaining these together. So while I have all tasks assigned to each user here, perhaps I want to then find which users are responsible for more than 50% of the tasks on a given project, thus being the bottleneck. To oversimplify this we could do it a couple of ways, total up the tasks for each project, and then total up the tasks for each user per project:

total_tasks_per_project AS (
SELECT
project_id,
count(*) as task_count
FROM tasks
GROUP BY project_id
),
tasks_per_project_per_user AS (
SELECT
user_id,
project_id,
count(*) as task_count
FROM tasks
GROUP BY user_id, project_id
),

Then we would want to combine and find the users that are now over that 50%:

overloaded_users AS (
SELECT tasks_per_project_per_user.user_id,
FROM tasks_per_project_per_user,
total_tasks_per_project
WHERE tasks_per_project_per_user.task_count > (total_tasks_per_project / 2)
)

Now as a final goal I’d want to get a comma separated list of tasks of the overloaded users. So we’re simply giong to join against that overloaded_users and our initial list of users_tasks. Putting it all together it looks somewhat long, but becomes much more readable. And as a bonus I layered in some comments.

--- Created by Craig Kerstiens 11/18/2013
--- Query highlights users that have over 50% of tasks on a given project
--- Gives comma separated list of their tasks and the project
--- Initial query to grab project title and tasks per user
WITH users_tasks AS (
SELECT
users.id as user_id,
users.email,
array_agg(tasks.name) as task_list,
projects.title
FROM
users,
tasks,
project
WHERE
users.id = tasks.user_id
projects.title = tasks.project_id
GROUP BY
users.email,
projects.title
),
--- Calculates the total tasks per each project
total_tasks_per_project AS (
SELECT
project_id,
count(*) as task_count
FROM tasks
GROUP BY project_id
),
--- Calculates the projects per each user
tasks_per_project_per_user AS (
SELECT
user_id,
project_id,
count(*) as task_count
FROM tasks
GROUP BY user_id, project_id
),
--- Gets user ids that have over 50% of tasks assigned
overloaded_users AS (
SELECT tasks_per_project_per_user.user_id,
FROM tasks_per_project_per_user,
total_tasks_per_project
WHERE tasks_per_project_per_user.task_count > (total_tasks_per_project / 2)
)
SELECT
email,
task_list,
title
FROM
users_tasks,
overloaded_users
WHERE
users_tasks.user_id = overloaded_users.user_id

CTEs won’t always be quite as performant as optimizing your SQL to be as concise as possible. In most cases I have seen performance differences smaller than a 2X difference, this tradeoff for readability is a nobrainer as far as I’m concerned. And with time the Postgres optimizer should continue to get better about such performance.

As for the verbosity, yes I could have done this query in probably 10-15 lines of very concise SQL. Yet, most may not be able to understand it quickly if at all. Readability is huge when it comes to SQL to ensure its doing the right thing. SQL will almost always tell you an answer, it just may not be to the question you think you’re asking. Ensuring your queries can be reasoned about is critical to ensuring accuracy and CTEs are one great way of accomplishing that.

If you’re looking for a deeper resource on Postgres I recommend the book The Art of PostgreSQL. It is by a personal friend that has aimed to create the definitive guide to Postgres, from a developer perspective. If you use code CRAIG15 you’ll receive 15% off as well.

More on the iPad Pro

Zac Szewczyk — Mon, 18 Nov 2013 10:11:33 GMT

I feel like Gene Munster, where just as he perpetually beats upon his iTV drum so, too, do I all too frequently return to the iPad Pro. Since Apple’s iPad event, after receiving my MacBook Pro, and all throughout the ensuing period during which I began to define the different roles this new device and my trusty iPad would fill, this topic and Tim Cook’s comment to that effect have occupied a great deal of my consciousness. Unfortunately, I could find no written record of Tim Cook referring to such a device despite numerous verbal accounts; however, when questioned before October’s iPad event as to whether Apple would release an iPad Pro, he responded (with a smile) in saying, “We already make one: the 11″ MacBook Air.” I find this statement interesting for a number of reasons.

Permalink.

Rick Knudtson: Co-Founder of Flywheel

Sam Solomon — Mon, 18 Nov 2013 02:00:00 GMT

Rick Knudtson is a co-founder of Flywheel, a WordPress hosting and management company built for designers.

Tumblr as a Subdirectory (On Nginx)

Graham Stevens – Grh.am — Mon, 18 Nov 2013 02:00:00 GMT

Tumblr will let you run a blog as a sub-domain (blog.domain.com) rather than using their own URL scheme (username.tumblr.com), allowing your blog to appear much more professional and appear directly linked to your domain/website.

However, it is argued within the SEO scene that a subdomain is bad practice for maximising your search engine optimisation. This is because subdomains do not always receive the benefits from the root domain they’re on. For example, just because tumblr.com is a highly ranked domain, does not mean that this ranking will affect deadblog.tumblr.com or john doe.tumblr.com.

Submit Elasticsearch metrics to Graphite

Jelle Smet — Sun, 17 Nov 2013 21:36:00 GMT

If you're running an Elasticsearch cluster you might want to keep track of the metrics it produces. In this article I explain how you can aggregate the metrics of an Elasticsearch cluster and submit them to Graphite.

Prerequisites

You need to have following software installed:

Main software (installable from Pypi …

Fixing fullscreen flash video playback in GNOME 3

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sun, 17 Nov 2013 19:37:30 GMT

After making the switch to Ubuntu 13.10 (Saucy Salamander), my friend’s laptop was unable to play flash videos in fullscreen mode with Chromium. Taking a closer look at the problem, it seemed as if the window manager was unable to focus the fullscreen window correctly. Usually, only the first video would play in fullscreen mode.

Scouring the usual places for some answers, we only found the usual “helpful” suggestions, i.e. reinstalling the system, replacing the laptop with a better model, sacrificing a goat to the Gods of Canonical…

Luckily, I remembered similar problems a while back, back in the days of yore, when Metacity was still the window manager of (then) GNOME 2: Use the excellent Devil’s Pie to match the flash window and force the window manager to focus it. This resulted in the following configuration, which should be placed as fullscreen_flash.ds in ~/.devilspie:

(if
  (is (application_name) "exe")
    (begin
    (focus)
  )
)

While the syntax looks pretty insane, Devil’s Pie does an admirable job and forces the window manager to behave correctly. Note that if you are using Mozilla Firefox, you should look for plugin-flashcontainer or something similar. xwininfo and related tools are very helpful in this regard.

To end on a more critical note: While it is certainly nice that Linux gives us the tools to deal with its deficiencies (see also the XKCD comic about command line fu), I sometimes feel that GNOME has been steadily going downhill for some years now. At work, every Ubuntu upgrade broke something different in GNOME, finally driving me straight into the arms of KDE (for now). Configurations have become inconsistent and very complex, while the user interface nowadays seems extremely constrained. And for a setup with multiple displays, the “new” desktop environments (I am looking at you, GNOME 3 and Unity) seem very clunky to me. At home, I long ago ditched GNOME for the awesome window manager on my laptop (mostly due to screen space considerations). My friend is also more or less determined to make the switch (possibly to XFCE). Although she generally likes the look and feel of GNOME 3, her foremost wish is a stable and consistent system–and at least at the moment, GNOME 3 is neither.

Initial Impressions

Zac Szewczyk — Sun, 17 Nov 2013 17:30:05 GMT

When linking to Shawn Blanc’s excellent iPad Mini and Air review I mentioned Jim and Marco’s altercation on Twitter the day before in passing. Brought on when Marco criticized Jim’s lack of time spent with the Mini preluding an article titled “review”, I found the entire exchange humorous and representative of the pair’s similar personalities. I considered writing this article then at peak relevance, but instead pushed it into Drafts for another time. Four days and two posts later though, the fact that this topic remains at the front of my mind is a testament to the importance of a first impression.

Permalink.

Nootropic selfexperiments

Coornail's Thoughts — Sun, 17 Nov 2013 10:03:54 GMT

I have always been fascinated by the idea that we can significantly improve our wellbeing by making relatively small changes: exercising, changing our diet, adding some supplements.

Iteration in Puppet

The Technical Blog of James on purpleidea.com — Sun, 17 Nov 2013 06:25:01 GMT

People often ask how to do iteration in Puppet. Most Puppet users have a background in imperative programming, and are already very familiar with for loops. Puppet is sometimes confusing at first, because it is actually (or technically, contains) a declarative, domain-specific language. In general, DSL’s aren’t always Turing complete, nor do they need to support loops, but this doesn’t mean you can’t iterate.

Until recently, Puppet didn’t have an explicit looping construct, and it is quite possible to build complex modules without using this new construct. There are even some who believe that the language shouldn’t even contain this feature. I’ll abstain from that debate for now, but instead, I would like to show you some iteration techniques that you can use to get your desired result.

Napkin tower

D13V — Sun, 17 Nov 2013 02:00:00 GMT

I’ve had a few major changes in my life which made me think that there is no singular self. Me today is a very different person than me 5 years ago. Me now thinks about different things in a different language than me 5 years ago. Me now have different goals in life than me 5 years ago. Me now makes much different decisions than me 5 years ago. Me now has experienced some really bitter moments and lost some close people. Once I get slapped almost by definition I get a bit less naive… hopefully.

I’ve had this thought and concept of multiple selves for a while now, but just today I thought of a corollary to it. The corollary is that there is no such thing as “remembering”. There is transfer of information from the past self to the present self to the future self. Often that transfer is achieved by storing information in the brain memory. We have only a limited amount of operating memory that we use from day to day. We also have a lot of longer term memory but is is not super reliable or organized. It is like the past self communicates by writing important messages on paper napkins and spreading them around a room, as he exits and lets the current self enter. Napkins are not very durable and are very light - can be blown away by the wind from an open window or the vacuum cleaner, or they can get wet and dissolve.

Writing down our thoughts on something a little bit more persistent like a journal, or note taking app or email can capture out thoughts the way photo camera can capture our smiles and trips. By capturing our thoughts and our smiles on a durable medium we can share them with our future self. And also with others! Maybe we can start thinking of our thoughts as not really belonging to us - just as the photons that reflect our bodies and enter the camera do not belong to us. We can capture the photons by wearing black or avoid them by staying in the dark. The same way we can keep our thoughts to ourselves and forget them eventually or share them with our future self or other people by recording them down.

Sometimes the details of what we were thinking about or working with are impossible or very hard to remember. For example somebody’s phone number. We don’t remember everybody phone number. Instead we have a phone book or a contacts app in out phone. We also have bookmarks bar for our favorite and useful links and applications to remember our passwords to various different websites. We might be doing some detailed calculation in a spreadsheet, and we definitely write the score down when we play cards. It is just too hard to bother our minds with too much unnecessary details. Because when we free our minds from remembering these details we can focus on the higher level concepts. I think that that I want to call my friend Peter, or that I need to go to my project wiki page or that I need to login to my bank account rather than remembering the phone number, the link or the automatically generated complicated password.

But we can go beyond using tools to avoid remembering details. When we start recording our thoughts we can clarify them but also just point to them and combine them the way we would combine lego blocks. We can abstract away the specific sentences and start building larger ideas. We might have few simple thoughts about a given concept but not necessarily see the connections and relationships between them until we actually write them on post it notes or notepad.exe or doodle them in the side field of a notebook. Once we have put our thoughts down into a something tangible we can then rearrange them in the way we want, and the way they fit.

Throwback- Holiday Card 2011

Code & Visuals — Sun, 17 Nov 2013 02:00:00 GMT

Two years ago, I was asked to create CG@Penn’s 2011 Holiday Card. Shortly after finishing that particular project, I started writing a breakdown post but for some reason never finished/posted it. While going through old content for the move to Github Pages, I found some of my old unfinished posts, and I’ve decided to finish up some of them and post them over time as sort of a series of throwback posts.

This project is particularly interesting because almost every approach I took two years ago to finish this project, I would not bother using today. But its still interesting to look back on!

Amy and Joe wanted something wintery and nonreligious for the card, since it would be sent to a very wide and diverse audience. They suggested some sort of snowy landscape piece, so I decided to make a snow-covered forest. This particular idea meant I had to figure out three key elements:

Conifer trees
Modeling snow ON the trees
Rendering snow

Since the holiday card had to be just a single still frame and had to be done in just a few days, I knew right away that I could (and would have to!) cheat heavily with compositing, so I was willing to try more unknown elements than I normally would throw into a single project. Also, since the shot I had in mind would be a wide, far shot, I knew that I could get away with less up-close detail for the trees.

I started by creating a handful of different base conifer tree models in OnyxTree and throwing them directly into Maya/Vray (this was before I had even started working on Takua Render) just to see how they would look. Normally models directly out of OnyxTree need some hand-sculpting and tweaking to add detail for up-close shots, but here I figured if they looked good enough, I could skip those steps. The result looked okay enough to move on:

The textures for the bark and leaves were super simple. To make the bark texture’s diffuse layer, I pulled a photograph of bark off of Google, modified it to tile in Photoshop, and adjusted the contrast and levels until it was the color I wanted. The displacement layer was simply the diffuse layer converted to black and white and with contrast and brightness adjusted. Normally this method won’t work well for up close shots, but again, since I knew the shot would be far away, I could get away with some cheating. Here’s a crop from the bark textures:

The pine needles were also super cheatey. I pulled a photo out of one of my reference libraries, dropped an opacity mask on top, and that was all for the diffuse color. Everything else was hacked in the leaf material’s shader; since the tree would be far away, I could get away with basic transparency instead of true subsurface scattering. The diffuse map with opacity flattened to black looks like this:

With the trees roughed in, the next problem to tackle was getting snow onto the trees. Today, I would immediately spin up Houdini to create this effect, but back then, I didn’t have a Houdini license and hadn’t played with Houdini enough to realize how quickly it could be done. Not knowing better back then, I used 3dsmax and a plugin called Snowflow (I used the demo version since this project was a one-off). To speed up the process, I used a simplified, decimated version of the tree mesh for Snowflow. Any inaccuracies between the resultant snow layer and the full tree mesh were acceptable, since they would look just like branches and leaves poking through the snow:

I tried a couple of different variations on snow thickness, which looked decent enough to move on with:

The next step was a fast snow material that would look reasonably okay from a distance, and render quickly. I wasn’t sure if the snow should have a more powdery, almost diffuse look, or if it should have a more refractive, frozen, icy look. I wound up trying both and going with a 50-50 blend of the two:

The next step was to compose a shot, make a very quick, simple lighting setup, and do some test renders. After some iterating, I settled for this render as a base for comp work:

The base render is very blueish since the lighting setup was a simple, grey-blueish dome light over the whole scene. The shadows are blotchy since I turned Vray’s irradiance cache settings all the way down for faster rendertimes; I decided that I would rather deal with the blotchy shadows in post and have a shot at making the deadline rather than wait for a very long rendertime. I wound up going with the thinner snow at the time since I wanted the trees to be more recognizable as trees, but in retrospect, that choice was probably a mistake.

The final step was some basic compositing. In After Effects, I applied post-processed DOF using a z-depth layer and Frischluft, color corrected the image, cranked up the exposure, and added vignetting to get the final result:

Looking back on this project two years later, I don’t think the final result looks really great. The image looks okay for two days of rushed work, but there is enormous room for improvement. If I could go back and change one thing, I would have chosen to use the much heavier snow cover version of the trees for the final composition. Also, today I would approach this project very very differently; instead of ping-ponging between multiple programs for each component, I would favor a almost pure-Houdini pipeline. The trees could be modeled as L-systems in Houdini, perhaps with some base work done in Maya. The snow could absolutely be simmed in Houdini. For rendering and lighting, I would use either my own Takua Render or some other fast physically based renderer (Octane, or perhaps Renderman 18’s iterative pathtracing mode) to iterate extremely quickly without having to compromise on quality.

So that’s the throwback breakdown of the CG@Penn Holiday 2011 card! I learned a lot from this project, and looking back and comparing how I worked two years ago to how I work today is always a good thing to do.

Code and Visuals Version 4.0

Code & Visuals — Sat, 16 Nov 2013 02:00:00 GMT

I’d like to introduce the newest version of my computer graphics blog, Code and Visuals! On the surface, everything has been redesigned with a new layer of polish; everywhere, the site is now simpler, cleaner, and the layout is now fully responsive. Under the hood, I’ve moved from Blogger to Jekyll, hosted on Github Pages.

As part of the move to Jekyll, I’ve opted to clean up a lot of old posts as well. This blog started as some combination of a devblog, doodleblog, and photoblog, but quickly evolved into a pure computer graphics blog. In the interest of keeping historical context intact, I’ve ported over most of my older non-computer graphics posts, with minor edits and touchups here and there. A handful of posts I didn’t really like I’ve chosen to leave behind, but they can still be found on the old Blogger-based version of this blog.

The Atom feed URL for Code and Visuals is still the same as before, so that should transition over smoothly.

Why the move from Blogger to Jekyll/Github Pages? Here are the main reasons:

Markdown/Github support. Blogger’s posting interface is all kinds of terrible. With Jekyll/Github Pages, writing a new post is super nice: simply write a new post in a Markdown file, push to Github, and done. I love Markdown and I love Github, so its a great combo for me.
Significantly faster site. Previous versions of this blog have always been a bit pokey speed-wise, since they relied on dynamic page generators (originally my hand-rolled PHP/MySQL CMS, then Wordpress, and then Blogger). However, Jekyll is a static page generator; the site is converted from Markdown and template code into static HTML/CSS once at generation time, and then simply served as pure HTML/CSS.
Easier templating system. Jekyll’s templating system is build on Liquid, which made building this new theme really fast and easy.
Transparency. This entire blog’s source is now available on Github, and the theme is separately available here.

I’ve been looking to replace Blogger for some time now. Before trying out Jekyll, I was tinkering with Ghost, and even fully built out a working version of Code and Visuals on a self-hosted Ghost instance. In fact, this current theme was originally built for Ghost and then ported to Jekyll after I decided to use Jekyll (both the Ghost and Jekyll versions of this theme are in the Github repo). However, Ghost as a platform is still extremely new and isn’t quite ready for primetime yet; while Ghost’s Markdown support and Node.js underpinnings are nice, Ghost is still missing crucial features like the ability to have an archive page. Plus, at the end of the day, Jekyll is just plain simpler; Ghost is still a CMS, Jekyll is just a collection of text files.

I intend to stay on a Jekyll/Github Pages based solution for a long time; I am very very happy with this system. Over time, I’ll be moving all of my other couple of non-computer graphics blogs over to Jekyll as well. I’m still not sure if my main website needs to move to Jekyll though, since it already is coded up as a series of static pages and requires a slightly more complex layout on certain pages.

Over the past few months I haven’t posted much, since over the summer almost all of my Pixar related work was under heavy NDA (and still is and will be for the foreseeable future, with the exception of our SIGGRAPH demo), and a good deal of my work at Cornell’s Program for Computer Graphics is under wraps as well while we work towards paper submissions. However, I have some new personal projects I’ll write up soon, in addition to some older projects that I never posted about.

With that, welcome to Code and Visuals Version 4.0!

2013-11-16/01

ho.dges.online — Sat, 16 Nov 2013 02:00:00 GMT

A picture found literally on my doorstep - this leaf was on my driveway one morning when I opened the front door. The X100’s close-focussing capability meant that I could get right in close to it and capture the beads of rain on the leaf.

2013-11-16/02

ho.dges.online — Sat, 16 Nov 2013 02:00:00 GMT

A close up of the Auld Wives Lifts on Craigmaddie Muir near Mugdock Park. The boulders sit in a natural ampitheatre and makes it an eerie spot. Nobody is quite sure when the boulders were arranged and the faces carved into the rock. See also 2013-11-16-03.

2013-11-16/03

ho.dges.online — Sat, 16 Nov 2013 02:00:00 GMT

A wide shot of the Auld Wives Lifts. See also 2013-11-16-02.

The Retina iPad Mini's Soft Release

Zac Szewczyk — Fri, 15 Nov 2013 17:42:17 GMT

Recently I have begun exercising more restrain when deciding whether to publish a link post or not, attempting to decrease the lopsided original content to echo piece ratio by posting more of my own work than others’. I find it somewhat ironic, then, that today’s first link post goes to John Gruber’s linked list item commenting on Ed Dale’s Smart Move Apple.

Permalink.

Thoughts Regarding Coin

Zac Szewczyk — Fri, 15 Nov 2013 12:37:34 GMT

Yesterday afternoon Benedict Evans had something interesting to say regarding a new product-service pairing called Coin, questioning why anyone considered it anything more than a toy. Having never heard of the site, I continued scrolling until coming across Cody Fink’s referral link, at which point my “when in doubt wait until more than one person talks about it before taking the bait” rule kicked in and I opened Coin’s website. Over the next 1:45 Adam Lisagor serenaded me in a promo video nothing short of beautiful¹ that brought me — generally very averse to spending any significant amount of money — the closest I have ever come to impulse-buying anything, and especially something in the neighborhood of $50.

Permalink.

Pythonista Updated for iOS 7

Zac Szewczyk — Thu, 14 Nov 2013 21:17:17 GMT

Shortly after Ole Zorn released Editorial for iPad I adopted a workflow heavily reliant on this and his other — some would say companion — app Pythonista. Employing Editorial for all my writing needs and Pythonista to run a retrofitted version of FirstCrack thus enabling me to post on the go, I read, wrote, and updated my website almost exclusively on my iPad. Although recent months have seen a reversal of that shift in conjunction with my purchase of a new MacBook Pro, certain circumstances still make me thankful for the ability to not only consume but also produce content on such a portable device. Pythonista 1.4 brings a whole host of exciting changes to this already excellent app; perhaps even more exciting, though, is what these changes indicate for the future of Editorial.

Permalink.

iPad Mini and iPad Air First Impressions

Zac Szewczyk — Thu, 14 Nov 2013 17:41:17 GMT

Shawn Blanc posted by far and away the best iPad and iPad Mini first look I have read thus far. I enjoyed the flame war over Jim’s article immensely, Marco’s own “review” — if it even merits such a designation — had its own humorous high point, but up till now nothing impressed me to the extent that Shawn’s piece did.

Permalink.

The Lord of the Rings

Apurva Shukla's RSS Feed — Thu, 14 Nov 2013 10:00:00 GMT

⭐ ⭐ ⭐ ⭐ ⭐ This was an amazing journey for me, the entire storyline seemed amazingly well thought out. The characters were in depth, and…

Processes Vs. Goals (or, Systems vs. Accomplishments)

Josh Thompson — Thu, 14 Nov 2013 02:00:00 GMT

In this excellent article on systems vs. goals, James argues that even if you did not pursue any specific goals, with the right system, you will still go a long way. This idea has been floating around my head for over a year, now, and I think it’s slowly coalescing into something useful.

Ten Lessons About Systems

Systems are awfully close to habits.
If you can modify, create, and eliminate habits, you can build any sort of system you’d like. (Start this process here: http://tinyhabits.com/)
Reading about things is completely different than doing things. They don’t even belong on the same continuum.
Reading about things is still a great way to learn and shape your character.
A goal of “habit change” fails to meet the criteria for setting a good goal.
Failure is not absolute. Extract the useful, discard the rest.
Create, don’t just consume. This will sharpen you in many ways.
Personal observation: I am most defensive when others do not carefully consider my points of view. I’ve grown to see this better in recent months. Don’t know what to do with it, but I’m happy to have noticed!
A good system, even without a goal, is powerful.
Create a space where the desired habit/system is the easy route, and you’ll be successful. Struggling to build a habit = failure.

I struggle with systems. I am writing this blog post as an excuse to avoid working on a project. Ironic, yes?

Rather than beating myself over the head for failing to work on a goal that I want to work on, I’m stepping back. What makes this project so distasteful to me? I pursued on my own accord, and still want to go through with it. I think I’m fearful of the undefined, which this thing is. I don’t know an obvious next step. Which means the next step is obvious:

Determine the next step. Or the next five steps. Then break each one down into little tiny goals. I’ve been using Trello for this, and it’s been helpful.

Phew.

Privacy Happens at the Endpoints

Zac Szewczyk — Thu, 14 Nov 2013 00:29:37 GMT

Ben Brooks put it quite well when he linked to this article, characterizing it as a “fantastic post from Watts Martin”; I wholeheartedly agree. More often than not I consider Ben to have gone off the deep end some time ago, the result of which we see today in his near-constant advocation for privacy often taken to the extreme. However, Mr. Martin — and, by extension, Ben in his explicit endorsement of this piece — hit the nail on the head with this one.

Permalink.

Clocking Down the Mini

Zac Szewczyk — Wed, 13 Nov 2013 10:09:10 GMT

Yesterday Jason Snell made an interesting tweet regarding Apple’s A7 SoC, presumably after reading the MacRumors article Retina iPad Mini Has 1.3 GHz A7 Processor With 5X the Performance of the Original Mini: “The iPad Air’s processor is running at 1.39GHz; the iPad mini’s is clocked down to 1.27GHz.” Amidst nearly every discussion surrounding the iPad Mini, especially building up to its release earlier today, much of that discourse has lauded synonymous computing power between both devices as enabling those wishing to buy an iPad to make their decision based purely on form factor rather than performance. Today, however, we find that despite possessing identical processors, the Air will outperform the Mini as many suspected it would leading up to last month’s event.

Permalink.

Benchmarking Asynchronous PHP vs NodeJS Properly

Kevin Ohashi — Wed, 13 Nov 2013 09:23:06 GMT

I had fun this evening working on this with Samuel Reed. Performance and programming language choice is always a hotly debated topic and it's always fascinating the explore. It was truly interesting to see async php code. I know NodeJS is known for it, but PHP really isn't at all.

The actual article is here: http://reviewsignal.com/blog/2013/11/13/benchmarking-asyncronous-php-vs-...

They had copied all my articles. No problem

Welcome to Marco Fioretti's website! on Stop at Zona-M — Wed, 13 Nov 2013 08:08:16 GMT

Saturday morning I discovered that a certain Web services company had integrally copied on their own website, without even proper attribution, most of the articles I have written for a magazine. Do they believe

Blogging with Emacs

bastibe.de — Wed, 13 Nov 2013 02:00:00 GMT

When I first started blogging, it was on blogger.com (on the now-abandoned domain daskrachen.com). On blogger, writing new posts (back then) involved typing raw HTML into a web form. Not what I would call ideal. This improved somewhat when they introduced a fancy rich text editor that would automatically transform beautiful text into a horrible formatting mess.

Thus I switched. Getting my blog posts out of blogger was... Let's just say that I lost anything I didn't have a plain-text backup of. And I switched to Pelican, a static site generator written in Python. It worked beautifully, until I updated something, at which point it resorted to just throwing errors. Now I don't have anything in particular against Python stack traces, but these particular traces traced deep into stuff that was (then?) too complex for me to understand.

Thus I switched again. This time to C()λ∈slaw■, a static site generator written in Common Lisp. Mainly because I was interested in Common Lisp at the time. It worked really well. However, this was supposed to give me a chance to delve into Common Lisp, and I failed to understand C()λ∈slaw■'s code. Realistically though, this is probably not C()λ∈slaw■'s fault. My knowledge of Common Lisp is far from perfect.

Thus it was time to switch again. Having been enamored with Emacs for the last few years, it made sense to blog with Emacs as well. Besides, I am kind of fed up with the many conflicting flavors of Markdown out there and have switched my personal note-taking to Org mode long ago. So let's set up Emacs and Org as a blogging platform!

Before we start though, a short disclaimer: This will be a very bare bones blogging engine. It will consist of some articles, a front page, an archive page, and an RSS feed. And you will have to manage the front page and RSS feed semi-manually. No tags, no fancy history. Just what you see here.

On the plus side, this will be implemented entirely within Emacs and very simple to understand. Writing a new blog post will be as simple as writing an Org file and hitting a key combination! And you will get all of Org's fancy syntax highlighting and export magic for free!

Getting the pages to work is rather simple: You have to create a "publishing project" that specifies a base-directory where your Org files live and a publishing-directory, where the HTML files are going to be stored. Since this is Emacs, you could make your publishing directory any TRAMP path you like and insta-publish your workings!

(BTW, I am using Org 8.2.2 and I believe you need at least 8.0 for these examples to work)

(require 'ox-html)
(require 'ox-rss)
(require 'ox-publish)
(setq org-publish-project-alist
      '(("blog-content"
         :base-directory "~/Projects/blog/posts"
         :html-extension "html"
         :base-extension "org"
         :publishing-directory "~/Projects/blog/publish"
         :publishing-function (org-html-publish-to-html)
         :recursive t          ; descend into sub-folders?
         :section-numbers nil  ; don't create numbered sections
         :with-toc nil         ; don't create a table of contents
         :with-latex t         ; do use MathJax for awesome formulas!
         :html-head-extra ""   ; extra <head> entries go here
         :html-preamble ""     ; this stuff is put before your post
         :html-postamble ""    ; this stuff is put after your post
)))

Now hit M-x org-publish, type in blog-content, and you have a blog! Awesome! We are done here.

Well, how about an archive page that lists all your previous blog entries?

Emacs can auto-generate this for you. Simply add these lines to blog-content:

:auto-sitemap t
         :sitemap-filename "archive.org"
         :sitemap-title "Archive"
         :sitemap-sort-files anti-chronologically
         :sitemap-style list
         :makeindex t

Also, you can put something like

<a href="archive.html">Other posts</a>

into your :html-postamble to make every page link to this. You can also add your Disqus snippet there to enable comments.

Adding a front page is simple, too. My front page is simply a normal page called index.org, which contains links and slugs for every article I want to have on the front page. For example:

#+TITLE: RECENT POSTS

 * [[file:2013-05-30-speeding-up-matplotlib.org][Speeding up Matplotlib]]
 #+include: "~/Projects/blog/posts/2013-05-30-speeding-up-matplotlib.org" :lines "4-9"
 [[file:2013-05-30-speeding-up-matplotlib.org][read more...]]

But a blog is more than just text. There are images and CSS, too. I keep all that stuff in a separate directory and use a separate publishing project to copy it over to the publishing directory. Just add to your publishing-alist:

("blog-static"
 :base-directory "~/Projects/blog/static"
 :base-extension "png\\|jpg\\|css"
 :publishing-directory "~/Projects/blog/publish/static"
 :recursive t
 :publishing-function org-publish-attachment)

Setting up the RSS feed works similarly. The RSS feed is created from a single Org file. Create a new publishing project and put it into your publishing-alist

("blog-rss"
 :base-directory "~/Projects/blog/posts"
 :base-extension "org"
 :publishing-directory "~/Projects/blog/publish"
 :publishing-function (org-rss-publish-to-rss)
 :html-link-home "http://bastibe.de/"
 :html-link-use-abs-url t
 :exclude ".*"
 :include ("rss.org")
 :with-toc nil
 :section-numbers nil
 :title "Bastis Scratchpad on the Internet")

Make sure to exclude this rss.org from the blog-content project by adding it's name to the :exclude variable though. This rss.org file should contain headlines for every blog post. Every headline needs a publishing date and a permalink as property and the body of the post as content:

* Speeding up Matplotlib
 :PROPERTIES:
 :RSS_PERMALINK: "http://bastibe.de/2013-05-30-speeding-up-matplotlib.html"
 :PUBDATE: <2013-05-30>
 :END:
 #+include: "~/Projects/blog/posts/2013-05-30-speeding-up-matplotlib.org" :lines "4-"

I exclude the first three lines, since they only contain #+title, #+date, and #+tags. You should at least exclude the #+title line. Otherwise, ox-rss will get confused about which title to choose for the feed.

You can even create a meta publishing project that executes all three projects in one fell swoop!

("blog"
 :components ("blog-content" "blog-static" "blog-rss"))

There is one more thing that is kind of fiddly though: As I said, I use Disqus for comments, but I don't want to have comment boxes on the front page or the archive. Thankfully though, ox-html allows you to set :html-preamble and :html-postamble to a function, in which case that function can decide what pre/postamble to draw! The function can take an optional argument that contains a plist of article metadata. In this case, I decide on the :title metadata whether to print the archive link and Disqus, only the archive link, or neither:

:html-postamble
(lambda (info)
  "Do not show disqus for Archive and Recent Posts"
  (cond ((string= (car (plist-get info :title)) "Archive")
         "")
        ((string= (car (plist-get info :title)) "Recent Posts")
         "<div id=\"archive\"><a href=\"archive.html\">Other posts</a></div>")
        (t
    "<div id=\"archive\"><a href=\"archive.html\">Other posts</a></div>
     <div id=\"disqus_thread\"></div>
     <script type=\"text/javascript\">
     ..."

This should get you started! For completeness, here is my complete configuration:

(require 'ox-html)
(require 'ox-rss)
(require 'ox-publish)
(setq org-publish-project-alist
      '(("blog"
         :components ("blog-content" "blog-static" "blog-rss"))
        ("blog-content"
         :base-directory "~/Projects/blog/posts"
         :html-extension "html"
         :base-extension "org"
         :publishing-directory "~/Projects/blog/publish"
         :publishing-function (org-html-publish-to-html)
         :auto-sitemap t
         :sitemap-filename "archive.org"
         :sitemap-title "Archive"
         :sitemap-sort-files anti-chronologically
         :sitemap-style list
         :makeindex t
         :recursive t
         :section-numbers nil
         :with-toc nil
         :with-latex t
         :html-head-include-default-style nil
         :html-head-include-scripts nil
         :html-head-extra
         "<link rel=\"alternate\" type=\"appliation/rss+xml\"
                href=\"http://bastibe.de/rss.xml\"
                title=\"RSS feed for bastibe.de\">
          <link href='http://fonts.googleapis.com/css?family=Roboto&subset=latin' rel='stylesheet' type='text/css'>
          <link href='http://fonts.googleapis.com/css?family=Ubuntu+Mono' rel='stylesheet' type='text/css'>
          <link href= \"static/style.css\" rel=\"stylesheet\" type=\"text/css\" />
          <title>Basti's Scratchpad on the Internet</title>
          <meta http-equiv=\"content-type\" content=\"application/xhtml+xml; charset=UTF-8\" />
          <meta name=\"viewport\" content=\"initial-scale=1,width=device-width,minimum-scale=1\">"
         :html-preamble
         "<div class=\"header\">
              <a href=\"http://bastibe.de\">Basti's Scratchpad on the Internet</a>
              <div class=\"sitelinks\">
                  <a href=\"http://alpha.app.net/bastibe\">alpha.app.net</a>  | <a href=\"http://github.com/bastibe\">Github</a>
              </div>
          </div>"
         :html-postamble
         (lambda (info)
           "Do not show disqus for Archive and Recent Posts"
           (cond ((string= (car (plist-get info :title)) "Archive") "")
                 ((string= (car (plist-get info :title)) "Recent Posts")
                  "<div id=\"archive\"><a href=\"archive.html\">Other posts</a></div>")
                 (t
             "<div id=\"archive\"><a href=\"archive.html\">Other posts</a></div>
              <div id=\"disqus_thread\"></div>
              <script type=\"text/javascript\">
              /* * * CONFIGURATION VARIABLES: EDIT BEFORE PASTING INTO YOUR WEBPAGE * * */
              var disqus_shortname = 'bastibe';
              /* * * DON'T EDIT BELOW THIS LINE * * */
              (function() {
                var dsq = document.createElement('script');
                dsq.type = 'text/javascript';
                dsq.async = true;
                dsq.src = 'http://' + disqus_shortname + '.disqus.com/embed.js';
                (document.getElementsByTagName('head')[0] || document.getElementsByTagName('body')[0]).appendChild(dsq);
                  })();
              </script>
              <noscript>Please enable JavaScript to view the
                  <a href=\"http://disqus.com/?ref_noscript\">comments powered by Disqus.</a></noscript>
              <a href=\"http://disqus.com\" class=\"dsq-brlink\">comments powered by <span class=\"logo-disqus\">Disqus</span></a>")))
         :exclude "rss.org\\|archive.org\\|theindex.org")
        ("blog-rss"
         :base-directory "~/Projects/blog/posts"
         :base-extension "org"
         :publishing-directory "~/Projects/blog/publish"
         :publishing-function (org-rss-publish-to-rss)
         :html-link-home "http://bastibe.de/"
         :html-link-use-abs-url t
         :exclude ".*"
         :include ("rss.org")
         :with-toc nil
         :section-numbers nil
         :title "Bastis Scratchpad on the Internet")
        ("blog-static"
         :base-directory "~/Projects/blog/static"
         :base-extension "png\\|jpg\\|css"
         :publishing-directory "~/Projects/blog/publish/static"
         :recursive t
         :publishing-function org-publish-attachment)))

All other sources, including the source code to all blog posts, can be found on Github (the master branch contains HTML, the source branch contains Org).

Addendum: I have since discovered that org-rss-publish-to-rss only handles top-level headlines, but disregards second-level or higher-level headlines. Thus, if you have a post with nested headlines, your RSS feed will only include the text of the top-level one. To fix this, I advised org-rss-publish-to-rss to use org-html-headline for non-top-level headlines like this:

(defadvice org-rss-headline
  (around my-rss-headline (headline contents info) activate)
  "only use org-rss-headline for top level headlines"
  (if (< (org-export-get-relative-level headline info) 2)
      ad-do-it
    (setq ad-return-value (org-html-headline headline contents info))))

Now, the RSS feed includes the full text of all articles.

Cracking my iPhone 4

Zac Szewczyk — Tue, 12 Nov 2013 17:42:09 GMT

The whole debacle surrounding New York Times writer Catherine Rampell’s article Cracking the Apple Trap holds almost no interest to me. However, after yesterday’s The Talk Show during which John X. Gruber and very special guest Paul X. Kafasis devoted a fair amount of time to ridiculing the entire enterprise, I feel it at least merits some attention.

Permalink.

Benedict's Mobile Newsletter

Zac Szewczyk — Tue, 12 Nov 2013 15:10:09 GMT

Every Sunday Benedict Evans, whose articles I have linked to numerous times in the past, publishes an excellent newsletter providing insightful observations into the tech and mobile industries’ news to a subscriber base growing at an impressive rate of 1,000 every month. Every week I look forward to the next installment of this thought-provoking newsletter, and Benedict always exceeds my expectations. If you need more convincing than my own personal endorsement of this invaluable resource though, take not just my word for it but a thousand others as well.

Permalink.

Fun with Instaparse

John Jacobsen — Tue, 12 Nov 2013 02:00:00 GMT

One of my favorite talks from this month’s excellent Clojure/conj was Carin Meier's presentation, which combined storytelling, live coding, philosophy, the history of computing, and flying robotic drones. She used the relatively new Instaparse library to create her own language to explore something called “Speech Acts” (which I won’t go into here, but do catch the video of her talk when it goes up).

My university work was in physics (and art) rather than CS, but I have long been interested in the implementation of programming languages, even going so far as to write a simple parser for Lisp-style math expressions in Pascal many years ago. Last year I had the opportunity to take the first “write a compiler in Python” class offered by David Beazley here in Chicago, in which we implemented a subset of the Go language. His PLY library is a great way to get started with implementing language parsers in Python, and the relative ease of doing so, compared with classic C implementations described in the infamous Dragon Book, inspired me to do some further experimentation of my own.

With this background, and inspired by Carin’s talk, I have been waiting for an opportunity to try out Instaparse, which is getting great press in the Clojure world. Instaparse takes a grammar as input (in the form of a string), and gives you a parser in the language specified by that grammar. It will also let you specify rules for transforming the resulting tree into something your Clojure program can use more directly (for example, by converting data types or removing unneeded elements from the parse tree).

When the need arose this weekend to read in Python configuration files into a Clojure program, I decided the time was ripe. I also wanted to document the journey using some form of literate programming. A library called Marginalia (Michael Fogus et. al.) made this pretty easy.

The results are on GitHub.

My impressions, after doing this project in just a few hours, are that (1) literate programming is great fun; and (2) Instaparse sets a new standard for power and expressiveness when converting structured text into abstract syntax trees. If you have a DSL or some other text-based, formal language you want to parse, and you are either literate in Clojure or interested in becoming so, Instaparse would be a great tool to check out.

Berlin Marathon 2014 Participants

Tafkas Blog — Tue, 12 Nov 2013 02:00:00 GMT

After the 2013 Berlin Marathon sold out in less than four hours, the organizers decided to alter the registration process for 2014. First there was a pre-registration phase followed by a random selection from the pool of registrants to receive a spot. Those who were selected had to register until November 11th, 2013. Any spots that were not confirmed till the 11th would be offered to pre-registered candidates according to the order in which they were randomly selected.

The biggest lie on the Internet...

Welcome to Marco Fioretti's website! on Stop at Zona-M — Mon, 11 Nov 2013 22:42:02 GMT

is that ridiculous disclaimer plastered over too many clueless websites

Chris Bowler on App Fatigue

Zac Szewczyk — Mon, 11 Nov 2013 20:19:02 GMT

In the wake of iOS 7’s release very few developers skipped the godsend of an opportunity to update their apps and charge once more in the process. Unfortunately, interspersed amongst the Tapbots of Apple’s ecosystem who shipped a product rebuilt from the ground up, others instead chose a shallow strategy Ben Brooks quantified quite well in the title of his article linking to Chris’s piece, Let’s make it 2.0 so we can charge for it again. Like Chris, I had no problem paying for Tweetbot 3; I happily bought Instacast 4 when it came out too. But by and large those two were the exceptions, not the rule.

Permalink.

Restricting Thrift clients to specific IP addresses with Twisted

Tom Forbes — Mon, 11 Nov 2013 19:17:11 GMT

Apache Thrift is pretty awesome - you can build Twisted bindings for your Thrift interface file that work fantastically. There is one thing that took me a while to figure out: I want to restrict clients connecting to the service to a specific set of IP addresses stored in a database. There were thre...

Benedict Evans on Amazon's Profits

Zac Szewczyk — Sun, 10 Nov 2013 16:32:16 GMT

Speaking of Ben Evans and Amazon back in August¹, when Amazon was the hot topic of discussion amongst the small circles we tend to frequent, he neatly and concisely explained many of the mysteries surrounding the company. For instance, why does Amazon turn nearly zero profit? And why, for crying out loud, do so many have such considerable faith in this curious company?

↩ This should give you a general idea as to how good I am at keeping up with my Instapaper queue.

Permalink.

Benedict Evans on Simplicity

Zac Szewczyk — Sun, 10 Nov 2013 16:00:04 GMT

From last month but no less applicable now, Benedict Evans takes a few moments to break down the core businesses of Apple, Amazon, and Google. And that’s all it took: a few moments. If only more “tech journalists” would read this before writing — or performing some semblance of the act — their next article.

Permalink.

2013-11-10/01

ho.dges.online — Sun, 10 Nov 2013 02:00:00 GMT

2013-11-10/02

ho.dges.online — Sun, 10 Nov 2013 02:00:00 GMT

2013-11-10/03

ho.dges.online — Sun, 10 Nov 2013 02:00:00 GMT

2013-11-10/04

ho.dges.online — Sun, 10 Nov 2013 02:00:00 GMT

Shall we waste twelve more years promoting Free office suites instead of open office formats?

Welcome to Marco Fioretti's website! on Stop at Zona-M — Sat, 09 Nov 2013 19:24:37 GMT

Twelve (TWELVE!!!) years ago I asked OpenOffice users “Are you advocating OO correctly”.

Prove, don't claim

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sat, 09 Nov 2013 11:10:53 GMT

In the wake of Edward Snowden’s activities, several new communication services started catering towards security-minded users. In principle, this is a good thing. However, these companies need to take the burden of proof more seriously. It is simply not good enough to claim that you “value the privacy of your costumers”. Quotes such as

We take your privacy seriously. We will never collect data about you. We use state-of-the-art encryption to guarantee that your files cannot be accessed by unauthorized persons.

simply evoke a “Huh, I guess that’s good for you” response from myself. In the worst case, they might trick users into believing your company without good cause. Why am I being so harsh? A simple reason: Good cryptography is hard to do right. Repeat after me: Good cryptography is hard to do right.

Take the guys from whistle.im, for instance. They “talk the talk” and even give some insights into their algorithms, yet a detailed analysis by neXus shows that they violated even the most basic principles of security. Darn. At least, I award them some points for being somewhat open about their protocols.

If your company does not talk openly about the detailed steps you are going to take to ensure that my data are encrypted properly, I will not even remotely trust you. Sorry. Shannon coined the adage “The enemy knows the system”. And at least in the cryptographic context, this is what I am assuming as well.

If you are unwilling to prove the security of your algorithms, I will assume that you are incapable of doing so. To be fair: I myself am incapable as well. To clarify: I consider myself capable of using established cryptographic systems such as Off-the-Record and GnuPG. But it is a very large step from being able to understand the workings of, say, RSA, to designing and running my own cryptosystem.

Would that all people and companies were aware of their limitations! As the aftermath of the recent Adobe hack shows, it is very easy to get things wrong. Adobe, for example, did not hash passwords properly. That is an epic on the fail scale. Some people are already working on analysing the passwords statistically or analysing the security problems in general. And it appears that there is already a list of the top 100 passwords used. I very much hope that the majority of the users did not use the same password for other services. Since their e-mail addresses have been included in the data dump, this would allow attackers to target things like e-mail accounts, e-commerce stuff (amazon, eBay, …), and so on. And what does Adobe have to say? The usual drivel, it turns out:

We value the trust of our customers. We will work aggressively to prevent these types of events from occurring in the future. Again, we deeply regret any inconvenience this may cause you.

In the official security announcement, there is not a word about their abysmal security practices. Not even an honest summary of the situation.

So, if even a large company like Adobe can get something that basic that wrong–why should I trust your new & hot startup? If you pretend to care about the privacy of your customers, you are required to disclose your algorithms completely. Not because somebody should poke fun at them but rather because you might have overlooked something, which in turn might negatively affect the efficiency of your encryption schemes. This happens to the best of us. The most recent example is probably Moxie Marlinkspike’s critique of Lavabit. Cryptocat, had its share of problems, as well.

To all the people involved in privacy-aware services, be it whistle.im, Cryptocat, myIDkeeper, Lavabit, or something else entirely, I say: Thanks for your work and dedication. If you really want the trust of your users, please disclose your algorithms. Prove the security to me, don’t just claim it. Given enough eyeballs, all bugs are shallow. Even those in cryptography.

On vlogs

Craig Pardey — Sat, 09 Nov 2013 02:00:00 GMT

Video blogs, or vlogs, are becoming increasingly popular and if you have a decent following on Twitter/Facebook/etc then you probably also have a YouTube channel from which to pontificate.

Vlogs are great. I get to know you a little better because I can hear your accent, the tone of your voice, and see all the non-verbal facial expressions that add so much to any communication.

But there are several downsides, too.

Overthrowing alcohol

D13V — Sat, 09 Nov 2013 02:00:00 GMT

Like most fun stories this one starts with getting drunk. One summer night I got very drunk at a party. In the morning I hated the hangover and myself.

I wanted to try something new. I was going for my first internship the following week, travelling to California. Getting to a new place, I decided to try an experiment - try to make it until my birthday without drinking - month and a half on the dry. I didn’t. I gave in and watched Batman drinking two bottles of Corona after about 26 days.

But hey, I still made it 26 days without alcohol. I was proud and happy for my new personal record. I told myself that next year I will beat that record. The challenge motivated me. And I did beat it by a tiny bit. Six years in a row I have been setting a new personal best - beating the score from the previous year by few hours or a day. Now my best is 29 days.

Most surprising was the observation that I can be having so much fun without drinking. I reasoned that if there are people who don’t drink but are always ready to laugh, dance or do something crazy, then I want to be one of them. I didn’t want no-drinking to make me boring. Alcohol makes it easier to start and keep partying but I thought that since the brain is the one deciding what to do, then maybe I can tell my brain to party without alcohol. I tricked myself to imagine that I was buzzed and to act accordingly. And it worked for me - I could relax and dance, make jokes and enjoy the party.

It all happened very slowly and gradually. Dancing on the sober was pretty hard to start, but easier to keep once I had started. I pushed myself to dance for a couple of minutes even if I didn’t feel like it, and then I just kept it going. And the rest of the party felt different when I had my head working and could think more clearly than when intoxicated.

I noticed that after putting myself in fun mode at parties without booze, it become easier to put myself in fun mode in my everyday life. By changing the way I party, I got more out of my non-party time. As a result I now drink less on average because I value my sober and non-hangover time more, and every time I drink it costs me few hours to a day. I still love a nice cold beer in a hot day, or a glass of red wine with a tasty meal. I’ll never go completely boozeless, because I don’t want to. Overthrowing alcohol didn’t mean killing it, but rather getting an improved, more balanced relation with it. I’ve increased my enjoyment threshold for alcohol. It better be really good or it wouldn’t be worth it.

Anything to MQTT

Jelle Smet — Sat, 09 Nov 2013 00:00:00 GMT

In this blog post I would like to demonstrate the how easy it is to setup a Wishbone server which allows you to send data from bash to a MQTT broker.

To install Wishbone you can follow the instructions found in the project documentation.

Our setup

Have a server up …

Monsters, Inc.

🦉 olshansky 🦁 — Fri, 08 Nov 2013 13:59:48 GMT

Olshansky's review of Monsters, Inc.

Monsters University

🦉 olshansky 🦁 — Fri, 08 Nov 2013 13:59:36 GMT

Olshansky's review of Monsters University

Monthly Review: October

Josh Thompson — Fri, 08 Nov 2013 02:00:00 GMT

This is my first monthly review. I’ll spend some time fleshing out the why and the how, and then get right to it. If you don’t want to read a lot of introspective Josh, stop reading. I use the word “I” dozens of times. Consider yourself warned. For a long time I have feared life passing me by, and after years have passed, I will be largely the same person that I was years ago. I know my temptation is to be passive, so these reviews are an experiment to encourage me to be proactive. more

Categories for Monthly Review (and why they made the list)

My marriage (Kristi is more important to me than everything else on this list, and as my marriage is strong, these other projects go well. If my marriage saps my energy, nothing else moves forward. My marriage brings joy. Everything else can make me happy, but not joyful.)
Significant relationships “Josh, there are two kinds of people in the world. Those who pick up the phone and call people, and those who don’t have long-term relationships with their family.” - Paraphrase of my uncle, who called me every Thursday while I was in college. I want to build that sort of intentionality into important relationships in my life.
Side projects Side projects are the most significant method of personal development a person can do, without making it their full-time gig. It is a “safe” way to test ideas, and if any pan out, they can turn into extra forms of income. Money is not, however, the primary goal. This blog is a side project.
My job My job provides my primary income, and I need to do well at it. I also should figure out how to develop myself as much as possible within the role, but my job is hardly the most important thing in my life. That would be bad for me and my employer.
Physical goals I enjoy being physically active, and I like improving/learning, so I’m going to always try to have a tangible goal on the horizon. (Right now I’m working on learning handstands, for example.)
Finances Money is sort of like oxygen. You notice when it’s gone, but more than a certain amount and it doesn’t do much for you. Kristi and I want to be wise stewards of our resources, and be generous. It is obvious that finances (no matter how much or how little we earn) are important.
Debt reduction (student loans, car loan) A sub-component of finances. I want to be debt-free, and I want it badly. Since I don’t want to reveal tons of details of our finances (I’m not sure why) I will talk about debt reduction as a decimal based off of payments made:minimum payments. If we have to make a $100 payment, and do so, we are 1:1 on debt for the month. If we make a $200 payment on a $100 minimum payment, we’re 2:1 on debt, or 2.0. The higher the number the better. As we reduce our debt, we should be able to sustain higher and higher numbers.
My monthly reviews I’ve never done a monthly review before. I need to make them effective, so I’ll always reflect on the quality and utility of the review.
Habits Habits are the way we live at least 95% of our life. It’s foolishness to try to make big changes to your life without looking at your habits. I want to make big changes, so I’m monitoring my habits.
Significant events Sometimes big things happen. I don’t want to live my life from big event to big event, but I’m not going to skip over it either.

How do I remember my month?

Since I don’t remember my day-to-day very well, I will rely upon pretty regular entries in 750words.com. It’s a tool that simply encourages you to write 750 words a day. I don’t always write every day, but for the last two weeks, I’ve missed only a few days. It’s an accurate snapshot of my day.

I plan projects (sometimes) in a physical journal, and will refer to that as well.

October Review

My marriage Kristi and I did well. Few memorable disagreements, and we handled those while still being loving to each other. ( Conflict management is a key quality indicator, remember?)

Our relationship is so much more than just not arguing, though. She felt like I delighted in her, and we did a lot of things together. Kristi’s picked up running, as she’s training for a five mile race in a few weeks. We went to Krav Maga together at least once a week. We went on dates. All-in-all, we have enjoyed each other and are growing together. I am blessed to be married to her.

Side Projects Lots of progress here, but I have too many, which allows me to follow one side project until it gets hard, then I’ll jump to another project until THAT gets hard, then move to another one. I “consulted” a few times with the Krav Maga DC Training Center (it’s ongoing) and I’m working on tools to help people learn to belay, and deal with fear in lead belaying. I want to keep my projects to just those.

Significant relationships I made almost zero attempts to reach out to those important to me. There is infinite room for improvement here. Stay tuned for November’s review, where I will have progress to report.

My job I have learned my roll just fine, and I’ve been able to teach a lot of what we do to two newly-hired staff. I had lunch with one of them, and really enjoyed building that relationship. There’s room for improvement, though. I struggle with feeling content when it feels like key elements of my job are completely out of my control. Stay tuned.

Physical goals I went to the New River Gorge for a weekend, and while I have lost a lot of strength, I managed to send Toxic Hueco (11d), and was pretty happy about that, since I’ve not trained or done a pull-up almost since June.

I have started learning handstands. I can hold a handstand against a wall for a minute and a half, and I can do little mini-pushups. I want to do a free-standing handstand pushup. So far, I have to build a lot of strength, but I’m ready to take the next steps. I need to learn how to fall out of a handstand, so I can get away from the wall.

Finances More money went out this month than came in, because I put a fair chunk of change into paying off our car loan.

**Debt reduction (student loans, car loan)** 3.5 (ratio of debt paid off:minimum payment) This is a great number. Definitely not going to happen this month.

My monthly reviews This is my first review. It’s been helpful so far. Probably tons of room for improvement, but I’m not concerned.

Habits I’ve been using 750words regularly. It’s helpful in me planning my day. I’ve done ~5 minutes of hand-stand training every day. I have been in Krav Maga twice a week, but I’d like to get that up to three times most weeks.

I am trying to get back into using my “hangboard” door frame, but have not systematized that yet. This coming month we’ll see improvement, I hope.

I’ve not been able to reliably wake up early (before 6:00), especially after Krav Maga in the evenings. I’m still experimenting with how to firm up my morning routine.

Significant events Nothing major here. A few minor things that caused me great elation followed by disappointment, so the lesson learned is either 1) be wary of false expectations or 2) don’t get so excited and disappointed. I don’t like squashing my emotions, though, so this is not a good option.

Summary, and going forward

October was a good month, but not very intentional. Everything I did just sort of happened. I really want to make progress with building intentional relationships with my family (by calling them. Hi Mom!) and I want to drill down my focus on building the climbing-related tools. More on that later.

And here ends my first monthly review, only a week after the end of the month. This has been a useful tool, just writing and categorizing and thinking hard about my month. This makes it easier to make good choices going forward, knowing that I’ll be analyzing my decisions in three weeks. If any of you are thinking about doing a similar review, I strongly recommend it!

Submit Nagios metrics to Graphite with ModGearman and MetricFactory revisited

Jelle Smet — Fri, 08 Nov 2013 00:00:00 GMT

When it comes down to monitoring Nagios is still the weapon of choice for many. I would have abandoned it if there weren't projects like Livestatus, Mod_Gearman and Thruk which to my opinion should never be missing from any Nagios setup. Mod_Gearman, the framework which makes Nagios scalable, has a …

The 512 Mavericks Review

Zac Szewczyk — Thu, 07 Nov 2013 23:34:21 GMT

Amidst all the hubbub that invariably follows every Apple event as embargoes lift and reviews flood the internet, as writers formulate, present, and respond to thoughts and opinions regarding Apple’s latest moves, it’s easy to lose a diamond in the rough. The problem is further compounded when amongst other diamonds, to continue stretching this metaphor, such as John Siracusa’s famous Mavericks review. Such was the case when Stephen Hackett posted his own article reviewing OS X 10.9, which I just now got around to reading more than two weeks after its publication. While it will not replace John’s in-depth analysis and historical perspective I enjoy so much, Stephen’s much quicker pace and more jovial approach did earn his annual review a spot among those I will look out for and read every year from here on out.

Permalink.

John Gruber on Apple's October Event

Zac Szewczyk — Thu, 07 Nov 2013 21:11:47 GMT

I realize I have come late to the party, but after just two weeks that does not change the relevancy of John Gruber’s article written in the wake of Apple’s October iPad event. Many wrote about a single aspect: Marco chimed in on the presentation itself, and I devoted an entire article to the notion of an upcoming iPad Pro; others, such as Jim Dalrymple, attempted the more monumental task of tackling the entire event; still others put forth more opinion-based pieces, such as Shawn Blanc’s Best in Class, Built to Last. None, however, did such a good job as John in not only conveying his thoughts and observations regarding the event, but presenting both those ideas and Apple’s announcements in context born from years of experience in this industry.

This is why John Gruber is so famous amongst the generation of writers, and why so many respect him; this is why I read Daring Fireball, for these impressively insightful pieces that inspire me to become a better writer myself. John gives me a bar to strive for, and one that I someday hope to reach.

Permalink.

Instapaper for iPad Receives a Facelift

Zac Szewczyk — Thu, 07 Nov 2013 14:56:01 GMT

This completely blindsided me. I had the lack of foresight to uninstall the betas after Instapaper 5 hit the market, so I had no idea a revamped iPad app was in the works until coming across the announcement in my Twitter feed late yesterday evening. Thanks iOS 7’s automatic update feature, I got to experience Betaworks’ latest revision firsthand as soon as I opened the app; and as I said on Twitter, I really like the new design. The folks over at Betaworks also implemented the much-acclaimed sorting and filtering abilities Instapaper 5 for iPhone shipped with three months ago, along with some other, more minor tweaks and updates. For a full list, head on over to the blog post: Redesigned Instapaper for iPad.

Permalink.

Harry Marks Interviews Matt Alexander

Zac Szewczyk — Thu, 07 Nov 2013 14:36:58 GMT

When I started writing Need, Fashion, and Matt Alexander I began with the title “Harry Marks Interviews Matt Alexander on Need”. Those curious can look to the post’s URL for confirmation, which still reads as described despite the fact that I changed its title. I set out with such a headline intending to make a short congratulatory post linking to Harry Marks’ article Interview with Matt Alexander of Need; however, ambition got the better of me and I ended up writing something I feel quite proud of as one of my better think pieces in a while. Those original motifs I pushed to the wayside still clamored for attention though, attention that I will grant them in this follow-up piece.

Permalink.

Load a Github Gist with Composer

Donat Studios — Thu, 07 Nov 2013 04:36:45 GMT

Composer is amazing for pulling in packages, but what if you find a Gist that isn't Composer aware? Fear not, as Composer has the magical ability to pull in repositories not explicitly set up in Packagist by defining them in the "repositories" section.

But what if you wanted to load a single class from a git gist?

You can add the following repositories section to your composer.json file, adjusting name and url as necessary. The name should be a vendor/package (all lower) style name you make up for it, and url will be from the Clone this gist box on GitHub.

"repositories": [
    {
        "type":"package",
        "package": {
            "name": "turin86/wssoapclient",
            "version": "master",
            "source": {
                "url": "https://gist.github.com/5569152.git",
                "type": "git",
                "reference":"master"
            },
            "autoload": {
                "classmap": ["."]
            }
        }
    }
]

Then in your require section, add your selected name as follows.

"require": {
    "turin86/wssoapclient": "dev-master"
}

If the name of the class doesn't match the filename in a friendly autoload-able manner, you'll have to replace "classmap": ["."] with "files": ["ClassToAutoload.php"] replacing ClassToAutoload.php with the filename. More info on autoloading can be found here. Note that if you are experimenting with autoload settings you may need to remove your vendor directory and composer install, as updates to the autoload were not reflected for me after a composer update.

After this, just run composer update and voilà, you are loading a gist with Composer.

Diagnosing buffer busy waits with the ash_wait_chains.sql script (v0.2)

Tanel Poder Blog — Thu, 07 Nov 2013 03:54:01 GMT

In my previous post ( Advanced Oracle Troubleshooting Guide – Part 11: Complex Wait Chain Signature Analysis with ash_wait_chains.sql ) I introduced an experimental script for analysing performance from “top ASH wait chains” perspective. The early version (0.1) of the script didn’t have the ability to select a specific user (session), SQL or module/action performance data for analysis. I just hadn’t figured out how to write the SQL for this (as the blocking sessions could come from any user). So it turns out it was just matter of using “START WITH ” in the connect by loop. Now the paramter 2 of this script (whose activty to measure) actually works.

Comparing ExpressJS Session Stores

Mustafa Akın — Thu, 07 Nov 2013 00:11:21 GMT

For my next project, I was exploring the session storages for ExpressJS, and I found a question on StackOverflow, but I was frustrated with the accepted and 30 upvoted answer, which compares local in memory session store with remote session stores. The answer is very misleading, there is no chance that remote storage can beat local storage, even if the in-memory solution does O(n^9) calculations, it would be faster than going to web.

Need, Fashion, and Matt Alexander

Zac Szewczyk — Wed, 06 Nov 2013 20:56:23 GMT

In the works for nearly a year, Matt Alexander’s new startup Need addresses a fascinating deficiency of not just fashion, but any degree of concern with respect to one’s physical appearance all too prevalent in today’s society, especially amongst young people. At nineteen a young person myself, I speak from first-hand experience: you would not believe the things I see my peers wearing, especially on a college campus. I am not wholly exempt in this respect — I have worn my fair share of tattered jeans and undershirts in public — but I also have enough sense to realize my shortcomings in this area. And acceptance is the first step towards recovery, right?

Permalink.

Redefining Success

Josh Thompson — Wed, 06 Nov 2013 02:00:00 GMT

It’s been pretty quiet around here lately. It’s been almost a month since my last entry. I thought about writing something here almost every day, but here is why I didn’t:

I want to produce “content” that is helpful and relevant to those who might read it. I felt like nothing I had done or experienced in the last few weeks, even if expertly documented, could help anyone. I have a few big projects that will be awesome when they are done, but that requires that 1) I finish them, and 2) they are awesome.

Here’s why this is still worth reading: No one can be a failure for failing to meet a few specific goals, because failing is a necessary component of success. I have often felt like I have failed. Failures don’t have anything interesting to say, right?

I had that attitude that I should pipe up only when I’ve figured out some cool way to make money on the side, or when I’ve created this really cool website. (I can’t code worth crap, by the way. “Creating a really cool website” is not around the corner.)

I am human, but I want to create this persona that looks like me, but has no weaknesses and makes no mistakes.Fortunately, everyone that knows that this is not true.

A Fair Trade

trv.rs — Wed, 06 Nov 2013 02:00:00 GMT

And after you have suffered a little while, the God of all grace, who has called you to his eternal glory in Christ, will himself restore, confirm, strengthen, and establish you. (1 Peter 5:10)

O Lord. Let this verse sink into my soul and take deep root in my thinking. This is the hope to which we were called. Thank you for calling us to yourself in Christ, that we might experience your love and grace. The troubles of this present life should be regarded as nothing compared to the surpassing glories described:

To be restored by you. O to be remade! To have all the sin, hurt, fear burned away and reforged into a new creation. When I bewail my current state of doublemindedness, when I feel the old and new man tugging at my mind, fighting for mastery, this verse will bring me courage. Restored is defined as “bringing back a previous state, to reinstate.” I will be made whole, without a touch of the old broken self. To walk with you in the new heavens and new earth, talking with you. Come quickly Lord.

To be confirmed. To be taken gently by the hand, and told that we are safe. There is no guarantee here in this brief and tumultous life, but this… this is a promise to which to look forward. To be confirmed is described as to be “firmly established in a particular habit, belief, or way of life and unlikely to change.” Hallelujah.

To be strengthened. To never again worry and doubt, or feel victimized and terrorized by sin within and without. To be buoyed up by the power and strength of our Savior, never to falter or fall again.

To be established. I love this one. To be established is to be “set up in a firm or permanent basis.” We are going to be in your glory for all eternity… what more firm or permanent basis can I ask for? Life may change, friends come and go, positions and jobs fall out from under my feet but my soul is established in you, now and forever.

I will take this trade, Lord. I will exchange the suffering for a short while for a permament, established, strengthened, perfect existence with you. Whisper this promise in my ear as I'm tempted to despair today. Allow me to live as one who has traded everything for this one, precious pearl, and not as one grasping for grip on a house made of sand. I pray this for myself, and for the ones I love in your precious name, amen.

Image: Terebithia by me

Diary of a Convert

Zac Szewczyk — Tue, 05 Nov 2013 21:07:26 GMT

Following Apple’s event last week and after I ordered a top of the line 15“ Retina MacBook Pro, I sat down to read John Siracusa’s famous Mavericks review. I started last year’s Lion review with good intentions, but without any incentive to finish I only read a few pages. This year though, with a shiny new Mac already on its way from China, I finally had more of a reason to persevere than simply to say that I had. Surprisingly, that gray ”24“ page marker — for I read it on Ars just as John suggested — turned up much faster than I expected it to after more than 24,000 words; unsurprisingly, I enjoyed every minute of John’s epic. Less than a week later, I received a FedEx email whose subject line told me everything I needed to know: ”FedEx shipment delivered".

Permalink.

End of an Era

Text(Greg); — Tue, 05 Nov 2013 18:43:26 GMT

Greg 1.0

Born in the Bronx. Grew up in upper middle class suburban New Jersey. College at Virginia Tech: went in a Computer Science major, came out with a B.A. in Interdisciplinary Studies. College summers working at Walt Disney World, first at Cosmic Ray's Starlight Cafe

Pushing Puppet at Puppet Camp DC, LISA 2013

The Technical Blog of James on purpleidea.com — Tue, 05 Nov 2013 17:00:19 GMT

Hi there,

I hope you enjoyed my “Pushing Puppet (to its limit)” talk and demos from Puppet Camp D.C., LISA 2013. As requested, I’ve posted the code and slides.

Here is the code: https://github.com/purpleidea/puppet-pushing

This module will require three modules as dependencies. The dependencies are:

My Puppet-Common module https://github.com/purpleidea/puppet-common
My Puppet-Runonce module https://github.com/purpleidea/puppet-runonce
My Puppet-FSM module https://github.com/purpleidea/puppet-fsm

Each example doesn't require all the dependencies, so if you're only interested in the FSM, you only need that module.

Here are the slides: https://github.com/purpleidea/puppet-pushing/blob/master/talks/pushing-puppet.pdf

Gluster Community Day, LISA 2013, Monday

The Technical Blog of James on purpleidea.com — Tue, 05 Nov 2013 03:30:05 GMT

I’m here at LISA 2013 at the Gluster Community Day. I’ve been asked by Joe Brockmeier to give a little recap about what’s been going on. So here it is!

Wesley Duffee-Braun started off with a nice overview talk about GlusterFS. The great thing about his talk was that he gave a live demo, running on virtual machines, on his laptop. If you’re a new GlusterFS user, this is good exposure to help you get started. He also has the nicest slides I’ve ever seen. Someone needs to send me the .odp template!

Javascript Allongé: a review

GeekWare - Daniel Pecos Martínez — Mon, 04 Nov 2013 17:02:50 GMT

Javascript Allongé@raganwald is one of the more refreshing coding books I have read in a big while. Usually when I face a programming language book, I skip the beginner chapters (if I already know the language, of course) and go directly for the juicy ones, but with this one I tried to follow it from end to end because I read some comments on twitter telling that the way basics are explained, become a really solid base for the language, so I gave it a chance.

And they were right! This book is not the usual Learn the language in 24 hours or something like that. It’s actually a very sharp and deep reading about Javascript and function composition.

The way the author explains how to create really simple functions and use them to build more complex ones just blowed my mind. The resulting code is so clear and easy follow that is almost impossible to imagine a better way to express that functionality.

This book is a total recommendation if you deal with Javascript in your day-to-day. I bought a digital copy in Leanpub, but recently the author made it opensource, so you’re free to get a copy of it:

Buy it: https://leanpub.com/javascript-allonge
Buy it (Kindle): Amazon
Read it online: https://leanpub.com/javascript-allonge/read
Get the sources: https://github.com/raganwald/javascript-allonge

Some python idioms

xenodium.com @alvaro — Mon, 04 Nov 2013 02:00:00 GMT

Prefer double quotes if escaping single quotes.
Prefer string interpolation over join. Eg. "'%s'" % member_default.
Prefer double underscore for privates.
Prefer with statement to implicitly close file.

with open(path, 'r') as text_file:
    text = text_file.read()

Prefer list comprehensions to filter.
Prefer using separate modules over classes if only using for separation.
Keep in mind: "eafp vs lbyl" (ie. just let it throw).
Prefer exceptions over assertions.
Throw ValueError for wrong input.
Return explicit False if remaining case is always false.

[^1]: Been using powder milk since lockdown, end-result's been tasty.

[^2]: The app's been fairly stable, but who knows… please backup your org file before feeding it to the lion.

[^3]: The app's been fairly stable, but who knows… please backup your org file before feeding it to the lion.

[^4]: The app's been fairly stable, but who knows… please backup your org file before feeding it to the lion.

[^5]: Yes, this post was written in org mode.

[^6]: Been using powder milk since lockdown, end-result's been tasty.

[^7]: Only tried raw honey so far.

[^8]: Can likely use ground cardamom. I enjoy the scents while crushing.

The Lean Startup

june.kim — Mon, 04 Nov 2013 02:00:00 GMT

Speaking at LISA 2013 about Puppet and GlusterFS

The Technical Blog of James on purpleidea.com — Sun, 03 Nov 2013 21:40:08 GMT

I’m speaking at LISA 2013, the “Large Installation System Administration” conference. This conference runs all week in Washington. I’ll be giving two talks during the week, and attending at least one BOF.

My first talk is on Monday during the Gluster Community Day. I’ll be speaking about puppet-gluster, and giving a live demo. I’ll be showing some new features too. If you’d like to talk more about puppet-gluster, or want to attend the talk, give me a shout, or sign up at the above Gluster Community Day link.

Tiny Tiny RSS on CentOS with nginx and MYSQL

zufallsheld — Sun, 03 Nov 2013 18:34:00 GMT

Today I want to present my Tiny Tiny RSS-installation, running on my own VPS.

tt-rss is “an open source web-based news feed (RSS/Atom) reader and aggregator, designed to allow you to read news from any location, while feeling as close to a real desktop application as possible.”

Preface …

JS Error using X-Editable?

MattCrampton.com — Sun, 03 Nov 2013 07:00:00 GMT

JS Error using X-Editable If you're trying to use X-Editable and getting a JS error similar to this... TypeError: $.fn.popover.defaults is undefined It may be because you're using Bootstrap 3 and using their CDN urls for including their JS and CSS. Their CDN currently only hosts their Bootstrap 2 code. To use it with Bootstrap 3, you need to download their repository and host it locally.

Nucleotide Repetition Lengths

John Jacobsen — Sun, 03 Nov 2013 02:00:00 GMT

After a long hiatus, let’s continue our foray into amateur genomics with Clojure, in which we continue to encounter elegant expressions of Clojure’s power as well as a few additional wrinkles in the Clojure ecosystem (in this case, Incanter).

In our last post we upgraded our genome decoder and used it to show frequencies of the four nucleotides, illustrating Chargaff’s Rule.

Another simple question to be asked of the data is, What is the distribution of nucleotide repetition lengths? In other words, if we represent the number of times any nucleotide is repeated as a histogram, then AAGGCATTTT would yield two entries for 1, two entries for 2, zero for 3, and one for 4. What does this distribution look like for the entire human or yeast genome?

As a “null hypothesis”, consider the likelihood of getting $N$ A’s when drawing at random from A, G, C or T. The probability for the first selection to be A is 25%; for the first two draws to be AA the probability is $P(AA) = {1 \over {4^2}} = 0.625$, and for $N$ consecutive draws, $P(A \times N) = 4^{-N}$.

You can easily simulate (“Monto Carlo”) such a situation using a purely random sequence:

(defn randgenome []
  (repeatedly #(rand-nth [:A :G :C :T])))

This function yields a sequence like (:A :A :C :A :T :G :G :T :G :A :C :C ...).

To convert this into repetition lengths, we can first divide the sequence up into repeating elements using partition-by and the identity function:

(partition-by identity (randgenome))
;;=> ((:A :A) (:C) (:A) (:T) (:G :G) (:T) (:G) (:A) (:C :C) ...)

Extracting the lengths is then trivial: just map count over the sequences:

(defn get-lengths [s]
  (->> s
      (partition-by identity)
      (map count)))

(get-lengths (randgenome))
;;=> (2 1 1 1 2 1 1 1 2 ...)

(Note: running these functions unmodified will hang your REPL, since randgenome yields an infinite sequence! Wrap them with take if needed.)

Histogramming the data

The plots in my previous posts were made by the ~~simple~~ easy expedient of copying data into a Numbers spreadsheet on my Mac. We’d like to eventually do some more ambitious plotting, however, so let’s investigate a Clojure-based solution.

Incanter provides a broad set of Clojure-based utilities for data analysis, including matrices and linear algebra operations, statistical distributions, and so on. Built on top of JFreeChart, it implements several different kinds of plots, including histograms, and it should be an obvious candidate for displaying our length distribution histogram.

Unfortunately, because of two issues I discovered, Incanter will not work for our purposes. To make a long story short, it does not handle empty (zero) entries in histograms properly when displaying on a logarithmic scale, and it generates out-of-memory errors when given more than a million or so entries. (Coming from high energy physics, where such histograms are extremely common, these both seem like serious flaws to me, which I hope will be remedied in the next Incanter release.)

I wound up using the JFreeChart API directly, though this was very time consuming, as the API has approximately the same complexity as the entire US space program or the Large Hadron Collider. (In what follows below I elide details about false starts, descriptions of hair pulling, and expletives.)

First, I needed to convert the lengths from get-lengths into a histogram with arbitrarily many entries:

(defn make-hist
  "
  Convert seq of input xs into a histogram of nbins bins, from xmin to
  xmax.  Discard overflows or underflows
  "
  [xmin xmax nbins xs]
  (let [;; "base" histogram (zeros):
        zero-map (into (sorted-map)
                       (map (fn [x] [x 0]) (range nbins)))
        ;; get actual bin values for every input in xs:
        xbins (map #(int (* nbins (/ (- % xmin)
                                     (- xmax xmin))))
                   xs)
        ;; strip out undeflows & overflows:
        no-overflows (->> xbins
                          (remove #(< % 0))
                          (remove #(>= % nbins)))]
    ;; yield histogram as array of [ibin, height] pairs:
    (into [] (reduce #(update-in %1 [%2] inc) zero-map no-overflows))))

Supplying the minimum and maximum value ahead of time simplifies the histogramming code substantially and allows us to choose the same range for multiple plots, as will be shown below.

Armed with this transformation, the generation of the histogram plot is as follows:

(ns jenome.graphs
  (:import [org.jfree.data.xy XYSeriesCollection XYSeries]
           [org.jfree.chart ChartFrame JFreeChart]
           [org.jfree.chart.plot XYPlot]
           [org.jfree.chart.axis NumberAxis]
           [org.jfree.chart.renderer.xy XYBarRenderer StandardXYBarPainter]
           [org.jfree.chart.renderer.category]))

(defn trim-zeros 
  "
  Convert zeros (or negatives) to small positive values to allow for
  graphing on log scale
  "
  [vals]
  (map (fn [[x y]] [x (if (> y 0) y 0.0001)]) vals))

(defn draw-hist
  "
  Draw histogram of bins as generated by make-hist
  "
  [x-label values]
  (let [renderer (XYBarRenderer.)
        painter (StandardXYBarPainter.)
        series (XYSeries. [])
        blue (java.awt.Color. 0x3b 0x6c 0x9d)
        coll (XYSeriesCollection. series)
        y-axis (org.jfree.chart.axis.LogarithmicAxis. "Entries")
        plot (XYPlot. coll (NumberAxis. x-label) y-axis renderer)
        panel (JFreeChart. plot)
        frame (ChartFrame. "Histogram" panel)]
    (doto plot
      (.setBackgroundAlpha 0.0)
      (.setRangeGridlinesVisible false)
      (.setDomainGridlinesVisible false))
    (doto renderer
      (.setBarPainter painter)
      (.setPaint blue)
      (.setDrawBarOutline true)
      (.setOutlinePaint blue)
      (.setOutlineStroke (java.awt.BasicStroke. 1))
      (.setShadowVisible false))
    (doseq [[x y] values]
      (.add series (+ x 0.5) y))
    (.setLowerBound y-axis 0.5)
    (.setVisible (.getLegend panel) false)
    (doto frame
      (.setSize 800 250)
      (.setVisible true))))

I will omit a detailed explanation of how draw-hist works because I’m still not a JFreeChart expert (though if I do many more blog posts on this topic I may be forced to become one, however reluctantly). The principal difference with the Incanter implementation of histograms is that we provide our own set of bin heights and simply plot those. This follows a better separation of concerns anyways: our fairly simple binning function remains separate from the visual presentation of the bin positions and heights (we could, for example, add the counting of overflows and underflows – this is left as an exercise to the reader).

(trim-zeros exists to transform bin values of zero to small positive numbers to avoid taking the logarithm of zero, which is undefined.)

Armed with these tools, we can now make our first distribution:

(->> (randgenome)
     (take 1000000)
     get-lengths
     (make-hist 0.5 60.5 60)
     trim-zeros
     (draw-hist "Repeat Lengths, random hypothesis"))

Nucleotide repetition lengths for the random hypothesis

As expected by our analysis above, this shows the falling “power-law” distribution of randomly-occuring nucleotide repetitions. Compare this with the genome for the yeast S. Cerviciae:

(->> (genome-sequence yeast)
     get-lengths
     (make-hist 0.5 60.5 60)
     trim-zeros
     (draw-hist "Repeat Lengths, S. Cerviciae"))

Nucleotide repetition lengths for the yeast S. Cerviciae

And, for humans (here we did not wait for the result for the entire genome):

(->> (genome-sequence human)
     (take 10000000)
     get-lengths
     (make-hist 0.5 60.5 60)
     trim-zeros
     (draw-hist "Repeat Lengths, human genome"))

Nucleotide repetition lengths for humans

The actual genome data clearly deviate from our null hypothesis of randomness, as one might expect. However, these graphs raise more questions than they answer. In particular, note that there is a sort of bimodal characteristic or extended, secondary bump in the data for humans, with hints of an outlier feature on the tail which may or may not just be a statistical fluctuation.

One complicating factor we neglected is the role of “N-blocks”, which should be eliminated without introducing artificially longer lengths; e.g. ANNNNA with the Ns removed should be considered two 1-blocks rather than a two-block AA group. This simple modification to get-lengths is left as another exercise to the reader (the change does not affect the resulting distributions).

A real biologist could no doubt tell us a lot about these distributions. Meanwhile, the latest code has been pushed to GitHub.

Load balance and high availability patterns using Wishbone

Jelle Smet — Sat, 02 Nov 2013 23:48:00 GMT

In this article I would like to explore the possibilities of creating a TCP based event proxy which balances events to one or more TCP backends. For this we will run through a couple of scenarios in which we highlight different approaches.

Installation

For the below mentioned scenarios we need …

'City of Ashes' Back in Development

Zac Szewczyk — Sat, 02 Nov 2013 16:18:17 GMT

I hesitate to pass judgement just yet, but after the first I can’t say I’m all too hopeful for a sequel. Taking a more adult approach in production will certainly help, but then again the first film didn’t exactly set a high bar.

Permalink.

WeeHouse

Zac Szewczyk — Sat, 02 Nov 2013 10:44:52 GMT

I could certainly spend a winter here in Minnesota, bitterly cold or not.

Permalink.

Captain Phillips

🦉 olshansky 🦁 — Sat, 02 Nov 2013 05:34:44 GMT

Olshansky's review of Captain Phillips

Mental travels

D13V — Sat, 02 Nov 2013 02:00:00 GMT

I haven’t been to too many countries, but I’ve been to a few. I love exploring new places as I never know what I will discover, and how will I feel then. Every new place brings up a completely new kind of advertures. My life is more interesting when I can see historical landmarks such as Chichen Itsa or the Acropolis, or speak to strangers in San Diego or to enjoy a glass of wine on a university square in Rome. My life is also richer when I get home and can bring the new perspective to many previously mundane aspects of my life.

I have perceived reality in different ways once in USA as a resident, once in Italy as a tourist, once in Bulgaria as a resident, once in Bulgaria as a tourist. These are different projections of the reality based on my perspective of perception in the world - both geographical and cultural. Reality is a big fat multidimensional beast and we only get to see small parts of it at a time. If it were an elephant, depending on which side of it you have access to you might deduce that it is soft and round (hobot), soft and flat (ear) or hard and round (tusk). And there are always new and surprising aspects and parts of it.

To me hacking on software projects feels similar to traveling to a territory I’ve never seen before, and exposes me to a new perspective on the ways we process information. Sometimes it is about dealing with a tool that is well standardized and documented and which has plenty of tutorials. In such case there are many opportunities to build something interesting, but it is still up to me to make it fun. Sometimes I’d venture into an area that is not very well explored, or maybe it is not well documented, or maybe is a completely new technology that hasn’t had the time to mature. These are usually really exciting projects as they bring in a lot of uncertainty. Trying to do something that I don’t know whether it is feasible or not, feels to me like an adventure. With both young and mature technologies, I am having a great time because it feels almost like a game, and I might even be learning something useful.

To me, travel for the mind is as exciting as the physical travel. And it is way more affordable in terms of time and often in terms of money as well. I am lucky that as a software engineer my job often makes me travel to a new mind destinations.

2013-11-02

ho.dges.online — Sat, 02 Nov 2013 02:00:00 GMT

Negative Lightning
My first real success with long-exposure photography. I’d seen this tree from the road many times driving by but didn’t get the chance to stop and photgraph it for a long time. It’s not perfect - it ended up a big darker than I wanted and the tree in the bottom right slightly spoils the effect, but this picture gave me the spur to try more long exposures.

The No-Frills Guide to PGP on OS X

Untrod — Fri, 01 Nov 2013 09:09:00 GMT

Want to get started using PGP on your Mac, but confused by the morass of professor-doctor style sites with seemingly out-of-date software and plugins? Have no fear! I'll have you up and running in minutes with this handy guide. You'll learn how to use public key servers and how to …

Only Push/Pull Current GIT Branch

Thomas Hunter II — Fri, 01 Nov 2013 02:00:00 GMT

Moving on

Craig Pardey — Thu, 31 Oct 2013 02:00:00 GMT

Today is my last day at CIBC and that makes me sad. It’s been an honour and a privilege to work with Mike Salvagna and his fantastic development team for the last 18 months. Mike has assembled one of the best development teams in Toronto that, in his words, “can build anything”. I believe he’s right.

Tomorrow I start at Intelliware where I’ll be leading another FX project. I’m looking forward to the challenges that this new position will bring, but I can’t help feeling down about leaving behind such a great team at CIBC.

Array Manipulation in PHP, The Correct Way

KernelCurry — Thu, 31 Oct 2013 02:00:00 GMT

UPDATE: Migrated from a post I wrote when working on leve.rs

More often than not, when PHP developers debug others’ code, the majority of each method is taken up by array manipulations. Spending this much time on array manipulations is a huge hassle when trying to understand any given method.

In order to speed up the debugging process, it’s important to start writing array manipulations the correct way, first. Here are a few examples of code I have either written myself or had to fix in the past. It is time every PHP developer knows how to manipulate arrays properly!

Introduction

KernelCurry — Wed, 30 Oct 2013 02:00:00 GMT

“The plumber always has plumbing problems at home.” … “Carpenters buy their furniture at IKEA.” … “The developers never has a good website”…

For years I did not only “not have a good website”, but I didn’t have a website at all. finally, I decided to make something. It may not be the prettiest thing in the world, but hey… at least it is a website.

This site will be used as a gateway to all of my projects and discoveries over the years. I hope that these posts will educate and inspire.

Mikael Cho: Founder of Ooomf

Sam Solomon — Wed, 30 Oct 2013 02:00:00 GMT

Mikael Cho is the founder of Ooomf, which is an online marketplace that connects awesome projects with world-class designers and developers.

Take You To the Candy Box

The David Brownman Blog — Wed, 30 Oct 2013 02:00:00 GMT

undefined

Read the whole thing.

Apple's Astounding Capital Expenditures

Dan Stroot — Wed, 30 Oct 2013 02:00:00 GMT

Apple’s most recent 10-K filing with the U.S. Securities and Exchange Commission shows the company has budgeted $11 billion in capital expenditures for fiscal 2014. This is more than 5 times Apple's capital expenditure in 2010 and 57 percent more than the $7 billion it spent in 2013. What is Apple planning to do with all that additional money?

This post Apple's Astounding Capital Expenditures first appeared on Dan Stroot's Blog

Embedded Linux Conference Europe 2013 notes

Linux Engineer's random thoughts — Wed, 30 Oct 2013 01:00:00 GMT

So I was in Edinburgh this year, and I took notes as I usually do. These are intended for personal consumption (do no expect LWN-style reports), but as more people were asking me to share them, I thought why not do it in public ?

Embedded Linux timeline

by Chris Simmonds …

On Hiring: Trial Week - Yay or Nay?

Fred Wu (@fredwu) — Tue, 29 Oct 2013 14:09:00 GMT

Ultrasonic 3D scanner fail

Erico Notes — Mon, 28 Oct 2013 04:26:51 GMT

Weeks ago I tried to make a ultrasonic radar like, but things didn't work out very well. I will post everything here soon.

Remove OpenDNS from Linux Mint

Thomas Hunter II — Mon, 28 Oct 2013 02:00:00 GMT

The Zombie iPad 2

Zac Szewczyk — Sun, 27 Oct 2013 22:28:50 GMT

In my last article, The iPad Pro, I promised to write about Apple’s perpetuation of its second-generation tablet. I actually set out to discuss both the iPad 2 and a hypothetical Pro model in that piece, but long-windedness got the better of me and I had to push it off until now. Given that these points have already been made in parts elsewhere, I will keep this brief.

Permalink.

commitease, a tool for grading the readability of git commits

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sun, 27 Oct 2013 20:27:04 GMT

I recently started learning Python. As a simple starting project, I created a tool that grades the readability of git commit messages. I am using the “Flesch reading ease score” to determine how easy a commit message may be understood.

For now, the script only supports walking through git repositories, using git log to obtain a pseuo-YAML output. It should easily be possible to support more revision control systems, but I am most familiar with git.

An orthogonal and equally interesting problem would be to grade the information of a given commit. A slew of commits of the form “update” are certainly less informative than commits of the form “Fixed bug 23 by applying the Foo-bar filter to some data sets”. Maybe I will add this functionality later on.

Example usage:

$ git clone http://github.com/Pseudomanifold/commitease
$ ./commitease.py 
Mean readability value for Bastian Rieck: 96.35095238095242

See the git repository of commitease for more information.

Empowering

D13V — Sun, 27 Oct 2013 03:00:00 GMT

I wanted to think about what the things that I value. The first thought that came into my mind was “learning”. I really like learning new things, whether it would be facts or techniques, or how to use a certain tool. But why do I value learning these things. Well, because it feels to be empowered to do things like edit code faster by knowing and practicing emacs shortcuts or eat healthier by knowing a.little bit aboht how different components of the food get processed by my body. So what I really value is empowering.

But why do I value empowering? For once because it correlates with freedom, as in having the right to do something. The more freedom you have the more empowered you are… kind of. What is the difference between freedom and empowering. It is hard to say right up front but an example is empowering could enable you to achieve something you were allowed to do but couldn’t, like speaking up to a TSA officer without getting harrased or delayed. So empowering can work in situations where freedom is given to do something but the means of how to do that thing were not available, or not affordable.

This is empowering within freedom, but there is also empowering ouside of freedom. Suppose that you are in a country where certain things are forbidden by law, but you believe they are very desirable. Then you could use technology to conspire agains the rulers and organize citizen movement to oppose these laws.

Empowering could also be much more personal. There are many cases of home violence where for example a man would beat his wife or act in an irresponsible way, drinking away all the money and destroying hopes for better life. These make me incredibly sad to hear every time, and it is not because of the pain and violence, even though they are terrible, but because of the helplessness of the victim. They may not have anyone to turn to for help or even if help exist it may be beyond the reach. Empowering in this situation would be to make it easier for the victim to escape.

There is yet another face to empowering and that is empowering into the unknown. there could be some things that dont have freedem defined for them but suddenly become within reach. Robotics research had a great jump in 2011 because of the Microsoft Kinect. The Kinect opened a lot of new 3D sensing possible, affordable and easy. A lot researchers mixed in 3D sensing to enable a whole lot of new twists to their projects.

So, yes, empowering is a value for me. For me it is a way of thinking and judging actions. Would I like to do a certain thing? Is it fun, or empowering in any aspect. For example, I have signed up for an Improv class after few weeks. I am hoping it will empower me to communicate more clearly in an instant, as opposed to waiting for my thoughts to clear up. Watching TV? This usually doesn’t empower me. If I am watching an interesting movie, such as “Inception” or “Gataca” then I might be empowered to think about a parallel universe where certain gray aspects of the current life are presented in black and white - you could say it enables me to project my observations of the surrounding world into a different context where it is easier to judge them.

The iPhone is the holy grail for Pokmon nerds

Zac Szewczyk — Sun, 27 Oct 2013 01:06:12 GMT

“Siri can get confused, of course, as every iPhone owner knows. For example, searching for the Pokmon ‘Charmander’ kept autocorrecting to Mander. But this can be excused. It’s a freaking Pokdex. In your pocket. Just think about how your 10-year-old self would feel about that.”

Back in my day...

Permalink.

Easier strace of scripts with pidof -x

The Technical Blog of James on purpleidea.com — Sat, 26 Oct 2013 19:02:12 GMT

Here’s a one minute read, about a trick which I discovered today:

When running an strace, it’s common to do something like:

strace -p<pid>

Smarter hackers know that they can use some bash magic and do:

strace -p`pidof <process name>`

However, if you’re tracing a script named foo.py, this won’t work because the real process is the script’s interpreter, and pidof python, might return other unrelated python scripts.

strace -p`pidof foo.py` # won't work
[failure]
[user sifting through ps output for real pid]
[computer explodes]

The trick is to use the -x flag of pidof. This will let you pass in your script’s name, and pidof will take care of the rest:

Mill Valley Cabins

Zac Szewczyk — Sat, 26 Oct 2013 18:35:44 GMT

Beautiful.

Permalink.

The iPad Pro

Zac Szewczyk — Sat, 26 Oct 2013 12:47:08 GMT

Shortly after Apple’s keynote earlier this week, Zac Hall made an interesting and thought-provoking quip on Twitter:

Permalink.

Core Values

Zac Szewczyk — Sat, 26 Oct 2013 01:40:22 GMT

“My grandfather lived to be 100 years old. If the Blanc blood running through my veins holds up like my grandfather’s did, then I’ve still got 68 years to go. Do I really want to spend one ounce of energy trying to make random people on the internet like me? Will that matter at all in six decades from now? I’d rather spend that energy strengthening my own core values, dating my wife, building life-long relationships with my sons, serving my friends, and doing the best creative work I can possibly do.”

Permalink.

Podcast App Playback Speeds

Zac Szewczyk — Sat, 26 Oct 2013 01:39:58 GMT

“Overcast will use speed-accurate labels. I’ll take the heat in reviews.”

Excellent. Instacast’s inaccurate, “legacy-style” labels have always annoyed me, especially when trying to decide whether I had enough time to play the latest episode of Roderick on the Line.

Permalink.

SGA bigger than the amount of HugePages configured (Linux – 11.2.0.3)

Tanel Poder Blog — Fri, 25 Oct 2013 16:23:24 GMT

I just learned something new yesterday when demoing large page use on Linux during my AOT seminar.

I had 512 x 2MB hugepages configured in Linux ( 1024 MB ). So I set the USE_LARGE_PAGES = TRUE (it actually is the default anyway in 11.2.0.2+). This allows the use of large pages (it doesn’t force, the ONLY option would force the use of hugepages, otherwise the instance wouldn’t start up). Anyway, the previous behavior with hugepages was, that if Oracle was not able to allocate the entire SGA from the hugepages area, it would silently allocate _the entire SGA _from small pages. It was all or nothing. But to my surprise, when I set my SGA_MAX_SIZE bigger than the amount of allocated hugepages in my testing, the instance started up _and _the hugepages got allocated too!

Iteration II

Sam Hooke — Thu, 24 Oct 2013 00:27:00 GMT

The step-based time-travelling sequel to Iteration: make every move count as you send short-lived clones into the past.

Think in 2+1D (2 spatial + 1 time dimension) as you incrementally re-write the past.

Iteration II takes a very different approach to Iteration. By being step-based (rather than time ticking automatically as in Iteration) it allows for more precise and complex puzzles. To aid you, a timeline is shown at the bottom of the screen with the status of each clone.

Installing the PHP "memcached" Extension

Donat Studios — Wed, 23 Oct 2013 13:42:40 GMT

Please Note

This tutorial only covers the default PHP installation that ships with Mac OS X / macOS. If you have installed a new installation this does not cover you.

For those using brew, you can simply brew install the appropriate brew formula for the extension.

These directions are verified to work with Mac OS X 10.9 Mavericks through macOS 10.14 Mojave.

System Integrity Protection

If you are running OS X El Capitan or newer you will need to disable System Integrity Protection to modify system files and directories.

To disable System Integrity Protection, boot into recovery mode by restarting and then holding ⌘R as you hear the startup chime. Then start the Terminal from the Utilities menu.

Run the following command

$ csrutil disable

Then reboot. You are good to go.

If you wish to turn it back on, follow the instructions above but instead use:

$ csrutil enable

Click here for a full post on the topic.

The first step is to install the latest version of Xcode. On modern versions of MacOS this can be done from the App Store.

After this, install the Xcode developer tools.

$ xcode-select --install

Special note to Mojave users if the following steps fail, you may need to reinstall your Xcode header files. Instructions for that can be found here.

Next we will need to install the required dependencies before we can build the extension. If you are not already using Homebrew you should be.

$ brew install wget autoconf pkg-config libmemcached

You will also want to make sure you have PEAR installed; full instructions can be found here but can be summarized as follows:

$ wget http://pear.php.net/go-pear.phar
$ php go-pear.phar

Then in the /tmp directory we will create a folder we can work in.

$ cd /tmp
$ mkdir memcached-work
$ cd memcached-work

Next we will use pecl, part of pear, to fetch the current version of the extension.

The version of the memcached extension will vary so you will need to update the paths accordingly.

$ pecl download memcached
$ open memcached-{{version}}.tgz
$ cd memcached-{{version}}/memcached-{{version}}
$ phpize
$ ./configure
$ make
$ sudo make install

Finally you will need to add the following line to your php.ini

extension = memcached.so

You can verify your installation with the following:

$ php --info | grep memcached\\.

Depending on your setup now you may want to restart apache.

$ sudo apachectl restart

You should be all set to go!

How to: Disable macOS System Integrity Protection

Donat Studios — Wed, 23 Oct 2013 13:42:40 GMT

If you are running OS X El Capitan or newer you will need to disable System Integrity Protection to modify system files and directories.

To disable System Integrity Protection, boot into recovery mode by restarting and then holding ⌘R as you hear the startup chime. Then start the Terminal from the Utilities menu.

Run the following command

$ csrutil disable

Then reboot. You are good to go.

If you wish to turn it back on, follow the instructions above but instead use:

$ csrutil enable

Wolfram|Alpha's New Data about Pokmon

Zac Szewczyk — Wed, 23 Oct 2013 01:54:10 GMT

I would have loved to have this back when I played Pokmon LeafGreen and Pokmon Saphire. Instead I had Prima Games’ Pokmon Pokedex Collector’s Edition which, although a great book for its time, simply cannot compare to the power Wolfram|Alpha will afford its users. I don’t even play the game any more and I’m still excited.

Permalink.

How to make money with your podcast

Zac Szewczyk — Wed, 23 Oct 2013 01:05:15 GMT

Although ostensibly about monetizing a podcast, Lex Friedman’s article also does an excellent job of setting out some great guidelines for creating exceptional shows, many of which align with the suggestions I outlined in Podcasting State of the Union.

Permalink.

Local .vimrc's

Baptiste Fontaine’s Blog — Tue, 22 Oct 2013 22:53:00 GMT

I discovered a great feature in Vim today. While we generally use the same Vim settings everywhere, we sometimes (have to) contribute to projects with a coding style different of ours, and because nobody wants to edit their .vimrc everytime to switch between configurations, Vim allows you to have per project .vimrc’s.

This feature can be enabled with one line in your .vimrc:

set exrc

When you start Vim, it begins by looking at some predefined locations for a configuration file (the first one is $HOME/.vimrc). The exrc option, disabled by default, tell to Vim to not only load your personal .vimrc, but also to look in the current directory to check if there’s another .vimrc file, which will be loaded after your personal one. You can then use it to override your settings and/or add specific ones for this directory.

Additionally, if you share the local .vimrc with others (e.g. in a Git repository), you may want to set the secure option at the end of your personal .vimrc:

set secure

This disallow shell and write commands in the .vimrc of the local directory. On unix-like OSes, this option is set by default if you’re not the owner of the file.

For more Vim gems, check my .vimrc on GitHub!

Opportunity cost

D13V — Tue, 22 Oct 2013 03:00:00 GMT

I probably wouldn’t have gotten into the Bulgarian National Math team and after that into MIT if I had followed commands. It happened when I was 7th grade and my school was selecting a team to compete in a national mathlete competition. The days the team selection exam was supposed to happen, there was also a literature exam, part of the standard curriculum, which my mother told me to attend to. After a brief argument, I said I will, but proceeded to go to the math team selection instead.

I qualified to one of four spots, out of about twenty students and proceeded to go to my first math competition in a different city called Varna. During the competition we did OK, we weren’t the best, but overall I really liked traveling and bonded with the other kids on the team. I was hooked and decided I wanted to go to more competitions. I did OK, but wasn’t making it towards the top.

After a couple of years I got an advice from a member of the national team. He said “Read 10 math books over the summer vacation, and you might get to the level of the National Team.” I followed his advice, really enjoyed learning hire about geometry, number theory, combinatorics and inequalities, and as a result the next year I made it to first the extended national team of 12 people and then to the national team for the International Math Olympiad - the most prestigious competition.

I never had any idea about all the benefits and the opportunities I would get from potentially getting into the national team when I disobeyed my mom’s order to go to the literature exam. I just did it because I was feeling that math is my strong side and wanted to see if I were any good at it. All I knew at the time of making the decision was that will have to probably retake the exam, but might win a trip to Varna, and that I can test my math skills. I didn’t know that I will become more excited about learning math and that I will find other students who feel the same way and that will push each other to get better. The opportunity cost of not applying for the math team could have been that I end up never discovering math’s beauty and never making it to the national team and MIT.

While missing the literature exam, testing my math skills and winning a trip to Varna were known knowns and know unknowns about my decision, becoming a part of math community, and potentially qualifying for international math olympiads was unknown unknown to me at this time. I majorly undervalued the potential upside of my decision, because I just really had no idea what good might come of it.

Currently, I’m trying to tell myself more that whenever facing a decision that involves exploring something new, the opportunity cost of not doing it is beyond my understanding - I rarely have any intuition about what I might discover when I do the exploration, and while a lot of time it might be nothing, sometimes it is a gem, and every once in while - a treasure.

Superhero Vehicles

Zac Szewczyk — Mon, 21 Oct 2013 11:23:39 GMT

Ever since reading Craig Hockenberry’s article Sonderklasse, an article ostensibly about the iPhone 5S, I have waited for an opportunity to write about something I came across in the process of reading that piece: the Mercedes G63 AMG.

Permalink.

first release of puppet-shorewall

The Technical Blog of James on purpleidea.com — Mon, 21 Oct 2013 03:07:06 GMT

Oh, hi there.

In case you’re interested, I’ve just made a first release of my puppet-shorewall module. This isn’t meant as an exhaustive shorewall module, but it does provide most of the usual functionality that most users need.

In particular, it’s the module dependency that I use for many of my other puppet modules that provide firewalling. This is probably where you’re most likely to consume it.

In general most modules just implement shorewall::rule, so if you really don’t want to use this code, you can implement that signature yourself, or not use automatic firewalling. The shorewall::rule type has two main signatures, so have a look at the source, or a simple example if you want to get more familiar with the specifics. Using this module is highly recommended, specifically with puppet-gluster.

Enable Emoji fonts on Debian / Ubuntu / Mint Linux

Thomas Hunter II — Mon, 21 Oct 2013 03:00:00 GMT

The Slow Fade

Zac Szewczyk — Sun, 20 Oct 2013 23:25:51 GMT

Last week Ben Thompson of Stratechery wrote Open Source Apps, where he explained the “inevitable” shift from paid-up-front to free apps monetized through other means. From his article:

Permalink.

Testing Graphite with MetricFactory revisited

Jelle Smet — Sun, 20 Oct 2013 21:42:00 GMT

In this post we revisit a previously posted article on how we can test and stress test a Graphite setup. This is basically a rewrite of that article since the Wishbone and MetricFactory software have meanwhile changed enough to dedicate a new article to it.

Our end-goal still stands. We …

The Better Figures & Images Pelican plugin now supports Figure Numbering

duncanlock.net — Sun, 20 Oct 2013 08:08:26 GMT

Figure 1. This figure has automatic figure numbering.

I had a feature request for automatic figure numbering, like latex. I was revamping this plugin for Pelican 3.3 anyway - and this didn’t seem too hard - so I decided to add it.

So, the Better Figures & Images plugin now supports automatic figure numbering. To enable this for all posts, just add this to your config file:

FIGURE_NUMBERS = True

If you want to enable this per post, just add this to the metadata at the top of the post:

for restructuredText add this:

:figure_numbers: true

and for Markdown add this:

figure_numbers: true

Caution:

Can you have Figures in Markdown?

I use reStructuredText for this site, and I’m not sure if you can even have Figures in Markdown documents - and I haven’t tested it, so caveat emptor.

It adds this:

<span class="fig_num" id="fig_X">Figure X: </span>

to the start of the figure captions, where X is the current figure number. It only does this to figures that already have captions - it’ll skip figures without. It completely ignores images, even it they have captions - it only affects figures.

The markup it outputs looks something like this:

<div class="figure" style="width: 250px; max-width: 100%; height: auto;">
    <img style="width: 250px; max-width: 100%; height: auto;" alt="" src="/images/image.jpg" />
    <p class="caption">
        <span class="fig_num" id="fig_1">Figure 1: </span>This is the caption of the figure.
    </p>
    <div class="legend">
        Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod
        tempor incididunt ut labore et dolore magna aliqua.
    </div>
</div>

The figure number on it’s own looks something like this:

<span class="fig_num" id="fig_1">Figure 1: </span>

This allows you to style it in CSS using the class and to link to it using the id/#fig_1 anchor.

The results look like this

Here are a few working examples, showing the results of using the plugin. The original rst source for these are available in the plugins /test folder:

Figure 2. This image is wider than the column it’s in - try resizing the browser window. Because of the max-width: 100%, the image is resized to fit the column.

Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.

Figure 3. This image is only 200px wide - smaller that the column it’s in. The max-width: 100% doesn’t stretch the image, because it’s also got a width: 200px - making it shrink to fit.

Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur.

This is the third image caption. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod

tempor incididunt ut labore et dolore magna aliqua. image::{static}/images/posts/better-figures-images-plugin-for-pelican/dummy-250x300.png[map to buried treasure 2]

This is the fourth image caption. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod

tempor incididunt ut labore et dolore magna aliqua. image::{static}/images/posts/better-figures-images-plugin-for-pelican/dummy-250x300.png[map to buried treasure 3]

My wishlist for a Star Wars Galaxies 2

Ben Overmyer's Site — Sun, 20 Oct 2013 03:00:00 GMT

Star Wars Galaxies 2 will most likely never happen, owing to the fact that SOE has publicly stated that it will never work on an MMO based on an external IP again. Whether that's true or not, if somehow this project were to be conceived, here are the changes from the original that I'd personally want to see in a sequel.

Modern Graphics Engine

This is the most obvious one. My personal choice for SWG2's engine would be Unreal Engine 4, owing to its extremely impressive technology. The “Infiltrator” demo video for UE4 shows that it would be perfect for the realistic art style of the Star Wars: Galaxies franchise, as compared to the more stylized art direction of Star Wars: The Old Republic.

A Return to Skill-Based Character Progression

Like most SWG veterans, I lamented the loss of the skill tree progression system when the New Game Experience took over. With SWG2, I'd want to see it return with a vengeance. Particularly, I'd like to see the depth and breadth of trees expand, allowing for greater freedom than even the original. Several aspects of the Star Wars universe were never fully explored in the first game, or were only given light treatment, such as slicing or smuggling.

More Player Races

The selection of available races in the original was good, allowing for most of the popular choices. I would like to see the Togruta, Chiss, and Devaronian races make a core appearance in SWG2. I'd also like to see droids as a player race, though that might be too complicated to balance against other races' gameplay.

Bigger Worlds

The original SWG planets were pretty big, but they frequently felt empty. The expansion worlds had stronger design, but felt smaller. I'd want to see planets in SWG2 be more expansive than the original SWG planets, but have more points of interest throughout each. For example, the planets in the first SWG felt a lot like the same planet given a different skin each time. While I don't want quests to provide a meta plot, I would like to see localized content that gives each world its own character.

Greater Freedom of Movement

Let's face it, movement was pretty horrible in the original SWG. You couldn't jump or fly over obstacles, and it was completely possible to walk straight up a sheer cliff face. While we don't necessarily need the full parkour aspects of EverQuest Next, I do want the ability to jump over things, be prevented from walking up impossible surfaces, and be able to climb, swim, and otherwise move as a person should be able to move.

Atmospheric Vehicles

I know these were added to the original SWG, but it came only in the last few months of the game's life. Given how important they are to the Star Wars universe in general, it would be a crime not to include these from the beginning in SWG2. I want to be able to bullseye womp rats in a T-16, over take a cruise over the highlands of Corellia in my own YT-1300. I also want shuttle transports to actually have real transit time, and not be a wait-and-teleport affair like they were in the original.

Player Factions

While it was great to have Imperial and Rebel affiliations in the original, to really ramp up the sandboxy nature of Star Wars Galaxies, the sequel would need to have player factions. This is particularly important if the game is set in a time period after the fall of the Empire, where a billion new factions would be vying for power. I see player factions being akin to massive alliances of Player Associations, rather than just an enormous PA. They'd also have to be able to influence planetary politics, like how Imperial and Rebel players were able to influence things towards the end of the original SWG.

A Player Exchange

Unlike the auction house format of current MMORPGs, I'd like to see something closer to the original vendor system in SWG. You'd be able to search available items on a local, planetary, or galactic level, as well as purchase them, but you'd need to physically travel to the vendor in order to pick up the item or items. This is important for two reasons: to encourage exploration and travel, and to support the possibility of player deliverymen - “FedEx” quests that actually matter. I want to have to travel to Tosche station to pick up some power converters.

Greater Visual Customization of Crafted Items

I liked that crafters could dye armor in SWG, but a sequel would need to take it to a new level. Item appearance should be further separated from item game mechanics than in the original. There is a vast variety of armor appearances in Star Wars, for example, and that should be reflected in SWG2. I don't want just a dozen different kinds of armor in different colors. I want several dozen, if not more. If World of Warcraft can do it, so can SWG2. Involving the Player Studio could help defray the cost of developing new models and textures for components of items.

Vehicular Combat

If we can fly in the atmosphere, we should be able to fight in it also. I'd want to see hover tanks finally make an appearance, among other things. If PlanetSide 2 can balance heavy armor against infantry, Star Wars Galaxies can do it too. This list could be even longer, but the above are my biggest wishes for a Star Wars Galaxies 2. How about yours? What would you want to see in a sequel?

Hello, World!

Linux Engineer's random thoughts — Sun, 20 Oct 2013 01:00:00 GMT

Update : I updated the information below with the 2020 tech.

So I finally did it. You're reading it right now. My personnal website/blog.

I should be posting here about things that cross my mind as well as various projects I've been working on. And maybe even new projets I …

How I upgraded this website to Pelican 3.3

duncanlock.net — Sat, 19 Oct 2013 03:08:14 GMT

There are quite a few changes in Pelican 3.3 - most of them minor, but a few which might mean making some changes to your site in order to upgrade. This is what I did to move my site from Pelican 3.2 to 3.3.

The change that had the biggest impact and took the most work was around image linking - caused by a combination of things. I think I was doing it wrong before and things changed in a way that meant this no longer worked. I also had to update my Better Figures & Images plugin to take this into account.

Previously, I’d been linking to my images like this, both in my theme:

/* Theme CSS Image Link */
background: #2C71B8 url(/static/images/blueprint-background.png) repeat;

{# Theme HTML/Jinja image link #}
<meta name="twitter:image" content="{{ SITEURL }}/static/images/favicon-128x128.png">

and in my content:

.. image:: /static/images/dunc_smiling_192x192.jpg

.. figure:: /static/images/pages/404-error.png

This is linking to the output location of the final images, in the /output/static/images folder. I don’t think this is the way you’re supposed to do it - and it doesn’t appear to work with Pelican 3.3.

The way you’re supposed to do it, I think, is to use a place-holder for the first bit of the path and, effectively, link to the source location of the file, not the destination. The relevant documentation is here - and the above examples now look like this:

/* Theme CSS Image Link - not processed, so no place-holder */
background: #2C71B8 url(/images/blueprint-background.png) repeat;

{# Theme HTML/Jinja image link - not processed, so no place-holder #}
<meta name="twitter:image" content="{{ SITEURL }}/images/favicon-128x128.png">

.. image:: {static}/images/dunc_smiling_192x192.jpg

.. figure:: {static}/images/pages/404-error.png

Theme Changes

The theme changes were the same: I removed the /static from the start of any image links. Because the theme files aren’t content, they don’t get processed by Pelican, so you don’t use the {static} place-holder here. All the changes looked something like this:

- <meta name="twitter:image" content="{{ SITEURL }}/static/images/test.png">
+ <meta name="twitter:image" content="{{ SITEURL }}/images/test.png">

You can see the Git commit with all the theme changes here, in the Blueprint Theme Repository.

Content Changes

The syntax for linking to source content has been changed in order to ensure compatibility with Markdown and reST extensions. For example, the new syntax for Markdown: [a link relative to content root]({static}/article1.md) The previous |filename|/article1.md syntax will continue to be supported for backwards compatibility. – Pelican Blog

Again, this is the related to image linking - and is the same change as above. This:

.. image:: /static/images/dunc_smiling_192x192.jpg

.. figure:: /static/images/pages/404-error.png
    :target: /static/images/pages/404-error.png

becomes this:

.. image:: {static}/images/dunc_smiling_192x192.jpg

.. figure:: {static}/images/pages/404-error.png
    :target: {static}/images/pages/404-error.png

You need to do this in every post that has images. Fortunately this was simple to search & replace. On some posts I also have an extra piece of metadata called thumbnail, that also needed updating. This isn’t processed by Pelican, so no place-holder here:

-:thumbnail: /static/images/posts/post-name/image.jpg
+:thumbnail: /images/posts/post-name/image.jpg

Configuration Changes

Since the FILES_TO_COPY setting has been deprecated, you should replace it with the STATIC_PATHS and EXTRA_PATH_METADATA settings. The relevant part of my settings file changed like this:

 # static paths will be copied under the same name
-STATIC_PATHS = ["images"]
+STATIC_PATHS = [
+    'images',
+    'extras'
+]

 # A list of extra files to copy from the source to the destination
-FILES_TO_COPY = (
-    ('extras/.htaccess', '.htaccess'),
-    ('extras/robots.txt', 'robots.txt'),
-    ('extras/favicon.ico', 'favicon.ico'),
-)
+EXTRA_PATH_METADATA = {
+    'extras/.htaccess': {'path': '.htaccess'},
+    'extras/robots.txt': {'path': 'robots.txt'},
+    'extras/favicon.ico': {'path': 'favicon.ico'},
+}

You can see the Git commit with all the content & configuration changes here, in the site repository.

Plugin Changes

A special case for me is the {static}/posts/tech/better-figures-and-images-plugin-for-pelican.adoc[Better Figures & Images plugin]. I use this plugin and I also wrote it - and it stopped working.

In order to debug it, I first added in some logging support. I added this at the top with the other imports:

import logging
logger = logging.getLogger(__name__)

and then some of this further down to output the paths that the plugin was seeing:

logger.debug('Better Fig. PATH: %s', instance.settings['PATH'])
logger.debug('Better Fig. img.src: %s', img['src'])

This made it easier to figure out what I needed to change. The path handling code in the plugin was never very good, so I changed it from this mess:

# TODO: Pretty sure this isn't the right way to do this, too hard coded.
# There must be a setting that I should be using?
src = instance.settings['PATH'] + '/images/' + os.path.split(img['src'])[1]

#src = instance.settings['PATH'] + '/images/' + os.path.split(img['src'])[1]

# The method mentioned above is only working if the images are really in the "images" folder.
# It's also not working on subdirectories inside the image folder
# Both issues are fixed:
# Changed the static "/images/" string to the proper path which is extracted from the 'split' tuple
# The first 7 letters are cutted ("/static") to get a valid link.
# Somehow the static folder isn't created in the output folder. It's only on the server after 'make ftp_upload'
src = instance.settings['PATH'] + os.path.split(img['src'])[0][7:] + '/' + os.path.split(img['src'])[1]

to this slightly more robust mess:

logger.debug('Better Fig. PATH: %s', instance.settings['PATH'])
logger.debug('Better Fig. img.src: %s', img['src'])

img_path, img_filename = path.split(img['src'])

logger.debug('Better Fig. img_path: %s', img_path)
logger.debug('Better Fig. img_fname: %s', img_filename)

# Strip off {static}, |filename| or /static
if img_path.startswith(('{static}', '|filename|')):
    img_path = img_path[10:]
elif img_path.startswith('/static'):
    img_path = img_path[7:]
else:
    logger.warning('Better Fig. Error: img_path should start with either {static}, |filename| or /static')

# Build the source image filename
src = instance.settings['PATH'] + img_path + '/' + img_filename

logger.debug('Better Fig. src: %s', src)
if not (path.isfile(src) and access(src, R_OK)):
    logger.error('Better Fig. Error: image not found: {}'.format(src))

This code basically strips the leading {static}, |filename| or /static from the image path, then looks for the original source image inside the current content folder (as set by the PATH setting in your config). This new code also contains lots more logging for debugging and reporting any errors or warnings. You can see the complete Git commit for the plugin changes here and the full article on the plugin here.

First post

Krishna's blog — Sat, 19 Oct 2013 03:00:00 GMT

A personal blog about mundane observations on reading, programming, and gaming, with occasional updates and vain attempts to drive traffic to the blog.

Desktop Notifications for Irssi in Screen through SSH in Gnome Terminal

The Technical Blog of James on purpleidea.com — Fri, 18 Oct 2013 09:00:49 GMT

I’m usually on IRC, but I don’t often notice incoming pings until after the fact. I had to both write, and modify various scripts to get what I wanted, but now it’s all done, and you can benefit from my hacking by following along…

The Setup

Laptop -> Gnome-Terminal -> SSH -> Screen -> Irssi

This way, I’m connected to IRC, even when my laptop isn’t. I run irssi in a screen session on an SSH server that I manage, and I use gnome-terminal on my laptop. If you don’t understand this setup, then you’ll need to get more comfortable with these tools first.

Quick Tips for Setting Up TLS

Pete's Points — Thu, 17 Oct 2013 21:46:14 GMT

Here's a few quick links that I found really helpful setting up an nginx web site to use a TLS certificate.

Server Side TLS on the Mozilla wiki
Qualys SSL Labs SSL Deployment Best Practices
Qualys's SSL Server Test. If you follow the Mozilla guidelines, you should score an "A" on this test.
nginx library has a few useful sample nginx configuration files. It's stale and only has a few posts, but it was a nice idea in theory if not in execution.

Some commands for reference:

generate a new 2048-bit RSA private key, named with hostname and year
- Adding the year will make replacing the certificate when it expires an easy symlink swap operation and avoid confusion. Install the new files then swap the symlinks when ready
openssl genrsa -out example.com-2013.key 2048
lock down its filesystem permissions
chown root:root example.com-2013.key
chmod 400 example.com-2013.key
symlink it for convenience
ln -nsf example.com-2013.key example.com.key
Create a certificate signing request
openssl req -new -sha256 -nodes -key example.com.key -out example.com-2013.csr
paste that into NameCheap or whichever vendor you prefer to have them sign it
when the certificate arrives, unzip it and concatenate it as follows
cat example_com.crt PositiveSSLCA2.crt AddTrustExternalCARoot.crt > example.com-2013.bundle.crt
symlink that for convenience
ln -nsf example.com-2013.bundle.crt example.com.crt
generate a dhparam file
openssl dhparam -out example.com-2013.dhparam.pem 2048
ln -nsf example.com-2013.dhparam.pem example.com.dhparam.pem

For express.js, make sure your session middleware has proxy: true, secure: true, httpOnly: true options set.

Nick Heer's Predictions for Apples October Event

Zac Szewczyk — Thu, 17 Oct 2013 17:05:10 GMT

Shawn Blanc on Nick Heer’s predictions for Apple’s event next week: “From my armchair, I say Nick is probably pretty close to the money here.” I really hope so: I have been holding out for a new MacBook Pro since before Apple unveiled the new Airs; it would be a huge disappointment if I had to continue waiting until January.

On the tablet front, I may also consider purchasing a new iPad along with a MacBook Pro and a new iPhone. Widely rumored to ship with Apple’s new Touch ID functionality, this upgrade in conjunction with the A7X processor Nick expects the iPad 5 to ship with might just be enough to entice me to buy a new one Especially coming from an iPad 3 with the A6X, the speed boost would be a welcome one.

Permalink.

Border Patrol Saga

Thomas Hunter II — Thu, 17 Oct 2013 03:00:00 GMT

Empty Hands

trv.rs — Wed, 16 Oct 2013 03:00:00 GMT

And his disciples answered him, “How can one feed these people with bread here in this desolate place?” And he asked them, “How many loaves do you have?” They said, “Seven.” And he directed the crowd to sit down on the ground. And he took the seven loaves, and having given thanks, he broke them and gave them to his disciples to set before the people; and they set them before the crowd. And they had a few small fish. And having blessed them, he said that these also should be set before them. And they ate and were satisfied. And they took up the broken pieces left over, seven baskets full.

(Mark 8:4-8 ESV, emphasis mine)

Thank you that you are the great provider. Thank you for reminding me in this story, that the options that show themselves to me are not all the options you hold. I may only have seven loaves, an impossibly small amount to fix the problems I'm faced with, but you are the infinite Bread of Life. May I look at my hands, realize that they are empty and powerless, and immediately look to your arms for provision and strength. I am nothing, you are everything. Teach me your way today, allow me to fear you and worship nothing or no one else.

Image: Fall by evantravers

What the Hell is a Python?

The David Brownman Blog — Wed, 16 Oct 2013 03:00:00 GMT

undefined

Read the whole thing.

Adding tail-call optimization to Python

Tom Forbes — Tue, 15 Oct 2013 22:04:05 GMT

Tail-call optimization is a trick many languages and compilers use to avoid creating excess stack frames when dealing with recursive code like this:...

GNOME Montreal Summit

The Technical Blog of James on purpleidea.com — Tue, 15 Oct 2013 19:52:29 GMT

This October 12th to 14th Montreal hosted the GNOME ~~boston~~ summit. Many thanks to Canonical for sponsoring breakfast, Savoir Faire Linux for hosting a great 6 à 10 with fancy snacks, and RedHat for sponsoring a pool night. What follows is some technical commentary about stuff that went on.

JHBuild

JHBuild is a tool to make it easy to download/clone (from git) and compile all the GNOME modules and applications. It was easy to get going. I (mostly) followed the steps listed on the JHBuild HowDoI wiki page. I kept my .jhbuildrc in my home directory instead of ~/.config/. On my Fedora 19 machine, I found certain unlisted dependencies were missing to build everything. You can figure these out yourself when your builds fail, or just run the following command to install them beforehand:

FSR Reviews Homeland

Zac Szewczyk — Tue, 15 Oct 2013 16:32:33 GMT

Film School Rejects’ Inkoo Kang has been posting fantastic reviews of each new Homeland episode shortly after their premiere. Now at three articles, one whole review for each of the three episodes out to date, I have been thoroughly enjoying her examination of the plot lines, undertones, direction, and parallels present in this show almost as much as I enjoy watching each episode.

Permalink.

Run while you have to, stop when you can

Zac Szewczyk — Tue, 15 Oct 2013 16:00:59 GMT

“Ive come to a point in my life where I can afford nice computers, good scotch and a great view of the leaves changing colors across the hills and bluffs of Southeastern Minnesota. My wife and I can afford to take good care of our pets, and I can afford to take better care of myself. I honestly never would have guessed Id get to this point.”

This article by Brett Terpstra has already made its rounds on many of the popular blogs, and for good reason, but I just couldn’t resist linking it as well.

Someday I hope to reach a similar place as Brett. Maybe without the life-threatening experiences along the way, but it is those that make us the people we are today.

Permalink.

Hillside cabin in Italy

Zac Szewczyk — Tue, 15 Oct 2013 15:58:49 GMT

What a beautiful mountain range.

Permalink.

Thanks NSA for your great help. No, seriously!

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 15 Oct 2013 12:24:00 GMT

Sometimes support comes in the most unexpected ways. Today the NSA, the super-secret spy agency that intercepts countless digital communications worldwide, greatly helped me, by providing evidence that a little project of mine is a really great idea that is sorely needed NOW.

Cozy Cloud and percloud: a comparison

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 15 Oct 2013 09:19:17 GMT

Shortly after launching my proposal for a personal, p2p replacement of Facebook, Gmail and similar services I was contacted by the developers of Cozy Cloud. We had a very interesting discussion, which ended with their proposal to write a post for their blog, to explain what similarities, differences and possible synergies I see between the two projects. Here I am, looking forward to your feedback!

Mac Terminal WiFi Commands

MattCrampton.com — Tue, 15 Oct 2013 08:00:00 GMT

Mac Terminal WIFI Commands I'm seeing over a thousand people a day show up here looking for the mac terminal WiFi commands. The OSX terminal has several command line tools that allow you to manage your WiFi settings. Connecting, disconnecting and scanning for available WiFi networks is easy once you know which command does what. Hopefully this list of command line wifi tools is helpful... #1. Turn off wifi on your macbook from the Mac OSX terminal command line: > networksetup -setairportpower en0 off #2. Turn on wifi on your macbook from the Mac OSX terminal command line: > networksetup -setairportpower en0 on #3. List available wifi networks from the Mac OSX terminal command line: > /System/Library/PrivateFrameworks/Apple80211.framework/Versions/A/Resources/airport scan #4. Join a wifi network from the Mac OSX terminal command line: > networksetup -setairportnetwork en0 WIFI_SSID_I_WANT_TO_JOIN WIFI_PASSWORD #5. Find your network interface name: > networksetup -lista...

Intrinsic Bias

Dan Stroot — Tue, 15 Oct 2013 03:00:00 GMT

As a CIO in a large, publicly owned financial services company I held the responsibility of keeping our clients (and our corporate) data safe and secure. As the economics of cloud services became compelling the largest hurdle to adoption was "potential security risks", by a large measure.

This post Intrinsic Bias first appeared on Dan Stroot's Blog

Sherlocking Everyone Else

Zac Szewczyk — Mon, 14 Oct 2013 19:43:16 GMT

The last few years have seen a great proliferation of linkblogs, by far and away the most popular topic of which is technology and, specifically, Apple. Nevertheless the likes of John Gruber — who did not, despite many erroneous beliefs, invent either the format or topic — and Shawn Blanc have made their mark as entrants to a space established long before their arrival. This not only happens in the blogging space, but the podcasting industry as well where interview shows like Daniel Jalkut’s Bitsplitting came in and sherlocked — ugh — the existing space, which already had plenty of interview programs, with a really great show.

Permalink.

Ben Thompson Leaves The Cubed Podcast

Zac Szewczyk — Mon, 14 Oct 2013 19:00:31 GMT

This is how one should leave a podcast, respectful of both his listeners and co-hosts alike. Not that I’m pointing any fingers.

“This isn’t the end of the road for me on the podcasting front; I’ll still appear as a guest on various shows, and have ideas on what might make sense for stratechery in both the near and short term. In the meantime, though, I’ll simply be a listener and a learner of Cubed, not a host.

“My thanks to both Ben Bajarin and Benedict Evans for the opportunity.”

Permalink.

5 Things I Do Not Miss about San Francisco

huphtur — Mon, 14 Oct 2013 03:00:00 GMT

Tooling for Simple but Informative Emails

CRAIG KERSTIENS — Sun, 13 Oct 2013 23:55:56 GMT

Emails are one of my favorite methods of communicating with users. Its works as a quick test for product validation. It works well at one->some->many-> all. Its still highly effective even as much noise as we receive in our inboxes. Over the years I’ve tried a lot of email tools from custom built solutions, to newer entrants that help around drip actions (intercom.io and customer.io), to more “enterprise” tools such as Marketo. While I have varying opinions on all of those, I still find myself coming back to a simple one off script setup to deliver clear concise emails.

Getting the Data

The first step of any email is deciding what you want to do, but hopefully you know that already. The part that is usually a bit more effort is actually getting the list to send it to and formatting it appropriately. I usually opt for SQL. While the specifics of the query of course always vary it common follows a general structure:

WITH initial_data AS (
SELECT
email,
app_name,
information_about_app
FROM
users,
apps
WHERE users.id = apps.user_id
AND some_filter_to_limit_data
),
candidates_for_email AS ... --- likely to have additional CTEs
--- Finally I build up the list
SELECT email,
array_to_string(array_agg(data_for_email), '
') --- an important note is to add a newline or not here depending on how you wish to format it
FROM candidates_for_email
GROUP BY email;

The query structure you’ll want is first column email, second column whatever data you want to include in your email.

From here I usually create a dataclip of it. This makes it easy to allow my data to change over time. If I’m testing an email for data over the last 7 days I just come back in 7 days and I have new data. It also lets me easily share and iterate on the data. The nice part is there’s an easy way to click a button and get the data as a CSV which is what you want for sending.

Once you download the CSV you’ll want to remove the header line as its not needed for the script.

Sending the Mail

To actually send the email you’ll need this script, which is largely credited to @leinweber:

require 'mail'
require 'csv'
FILE = ARGV[0]
Mail.defaults do
delivery_method :smtp, {
address: 'smtp address',
port: 587,
domain: 'gmail.com',
user_name: 'craig.kerstiens@gmail.com',
password: ENV.fetch('EMAIL_PASSWORD'),
authentication: :plain,
enable_starttls_auto: true
}
end
def send_email(address, app)
mail = Mail.new do
to address
from 'Craig Kerstiens <craig.kerstiens@gmail.com>'
subject "Your email subject in here"
body generate_body(app)
end
end
def generate_body(app)
%Q(
Hi,
Your list of apps:
#{app}
Various email content in here...
)
end
CSV.parse(File.read(FILE)).each do |line|
address = line[0]
app = line[1]
m = send_email(address, app)
puts m.to_s
p m.deliver!
puts
puts
end

You’ll want to make sure to export the PW of your email provider with EXPORT EMAIL_PASSWORD=pw_here

You can easily download this script from off of Github’s Gist. I’d recommend using an email service provider other than Gmail in sending your emails such as mailgun as they’re built to handle sending a large amount of emails. Finally send your emails:

ruby email.rb nameofyourfile.csv

The Ultimate Plot Intensifier

Zac Szewczyk — Sun, 13 Oct 2013 21:21:57 GMT

The question of whether Clark Kent as Superman should or should not kill is an extremely interesting one, and one I have spent quite a bit of time thinking about since seeing Man of Steel a few weeks ago. For the uninitiated, the controversy sprang up when Superman killed General Zod to save a family after destroying the whole of Metropolis throughout the course of their battle.

Permalink.

First foray into Unity

Liza Shulyayeva — Sun, 13 Oct 2013 03:11:14 GMT

I haven’t posted here in a while because I’ve been lazy and there hasn’t really been enough happening to warrant a full post. A quick recap.

True Awe

trv.rs — Sun, 13 Oct 2013 03:00:00 GMT

Holy, holy, holy, holy is the Lord God Almighty, who was, who is, and who is to come.

Forgive us Lord, for I fear we have lost the awe due the Lord of tempests, fjords, canyons, and quasars. Too often we allow our devotion to be constrained by the glorified conference rooms in which we worship. As the PowerPoint clicks to the next slide in the popular worship song we forget that the God we address from our comfortable office chair holds the world in His hands and propels the wind and sea with His voice.

We forget that ancient man, confronted with your infinite nature and with your immense creation devoted his life and the life of his children's children to the building of cathedrals, temples, pagodas, and palaces dedicated to bloodthirsty false gods and demons. Yet we sit, smugly sipping our Starbucks, and wishing that the collection fund would go to better upholstery.

Forgive us. Forgive me.

I have forgotten that the night sky above my head is illumined by ten million nuclear explosions that you have named and carefully placed to speak your majesty until the day the universe ends. I do not call to mind the vast wastes of rock and tree that you have placed in perfect compositions to create landscapes of beauty that can only be captured and never reimagined by man. I overlook the wonder that is my own existence, that the simplest cells within my body are more perfectly engineered and crafted than the most extravagant robotic marvel of mankind.

In this democratic age, we remember what it is to serve a God of love and mercy, but we have forgotten what it is to fall down before the God of majesty and awe.

So capture our hearts. Let us peek behind the curtain and spy with shaking and terrified eyes the vast Crystal Sea, to hear the booming praise of the twenty four elders resonate in the murmuring throng of ten thousand redeemed souls from every tribe and tongue, worshipping ceaselessly as they honor The Lamb.

How can we sit in indolent and sleepy silence when our entire eternity is shaped by this one fact: that the Most High God reigns, and that He actually cares for and loves us.

Let the truth of your majesty pierce and take root in my heart. May my worship be deepened by my knowledge of how absolutely incomprehensible it is that one as great as you take notice of me and my needs. Glory be to your name.

All photos from my photostream, here.

Protip: Unsync the "Index" Folder of Sublime Text 3 from Dropbox

Fred Wu (@fredwu) — Sat, 12 Oct 2013 07:26:30 GMT

My Uni's timetable system sucks, so I built a better one.

Tom Forbes — Sat, 12 Oct 2013 02:05:09 GMT

tl;dr The timetable system sucks, so I made one that works Getting your timetable sorted at Uni has never been fun. In years 1 and 2 of my study the department posted a timetable for each year showing all modules and students were expected to remove the classes they did not take, which while not the...

Objective-C

Dan Palmer — Sat, 12 Oct 2013 02:00:00 GMT

If I mentioned that I like C, C++ or Python to other students on my course, or colleagues, there would be no reaction. There are things you can criticise about each one, but they are all very safe bets. When I tell people that I enjoy writing Objective-C however, they are confused and often quite hostile towards the language.

I am by no means an Objective-C expert, but I’ve been thinking through the reasons why I like it, so this is a random collection of reasons why I enjoy using the language.

"New Game!!!": Great email exchange from my flatshare

Databases & Life — Fri, 11 Oct 2013 03:00:00 GMT

I am writing this blog post in October 2012; this will get published automatically in one year, like government secrets published 50 years after the event. But this just cannot not be shared.

One of my flatmates has just written an email to all:

Subject: New Game!!!

It’s time for a little Game called… … … “Clean your dishes and live in peace” !!

Few assertions:

Human being has to live in an hygenic place

Everyone is respectful

Time to: putting your plates, glasses, cutleries in the dishwasher + clean by yourself pan, saucepan(Yes, because as you know hot water is expensive and Earth ask us to do not waste it) = takes no more than 5 minutes

A clean kitchen is an area where everyone can go and enjoy it (because currently it’s not really welcoming)

Live in a sharing flat is also comply with basics rules

If anyone is not interested about this “game” we are all enough mature to talk about it.

Show current git branch in PS1 when branch is not master

The Technical Blog of James on purpleidea.com — Fri, 11 Oct 2013 01:16:28 GMT

Short post, long command…

I’ve decided to start showing the current git branch in my PS1. However, since I don’t want to know when I’m on master, I had to write a new PS1 that I haven’t yet seen anywhere. Add the following to your .bashrc:

PS1='${debian_chroot:+($debian_chroot)}\u@\h:\w\$ '
if [ -e /usr/share/git-core/contrib/completion/git-prompt.sh ]; then
    . /usr/share/git-core/contrib/completion/git-prompt.sh
    PS1='${debian_chroot:+($debian_chroot)}\u@\h:\w$([ "$(__git_ps1 %s)" != "" -a "$(__git_ps1 %s)" != "master" ] && (echo -e " (\[33[32m\]"$(__git_ps1 "%s")"\[33[0m\])") || echo "")\$ '
fi

An Ode to Sachin Tendulkar

Honest Musings — Thu, 10 Oct 2013 16:40:19 GMT

The slight tickle off the face, The fierce knock in subtle grace, The quickest rumble in the race, The enemies did, bow and brace. The wildest tornado in the calmest sea, The orbs of fire in a gentle spree, The lord of wind in the mountain’s lee, The knights did, scrum yet flee. The Demon … Continue reading

Percloud crowdfunding, Albanian Translation

Welcome to Marco Fioretti's website! on Stop at Zona-M — Thu, 10 Oct 2013 10:44:38 GMT

(this is a translation in Albanian of my percloud crowdfunding call, kindly provided by Gagi Berani. An Italian translation is here. Thanks in advance to whoever may provide translations in other languages)

Permbledhje e shkurte

Unë jam një autor freelance, hulumtues, dhe aktivist që punon në çeshtjet e të drejtave digjitale dhe të Softuerit të lirë. Mund të lexoni lidhur më punën dhe background-in tim këtu.

PHP: The slums of the Programming World?

Jurgens du Toit — Thu, 10 Oct 2013 03:00:00 GMT

I presented this at Tech4Africa 2013. The slides can be found here.

Quick History of PHP

PHP was initially created by Rasmus Lerdorf when he got irritated by repetitive coding of CGI calls. He consolidated a number of functions into a C library and created a parser which would call these functions out of HTML. And so PHP was born! Versions 2 and 3 were formalizations and extensions of the libraries, still using Rasmus’ parser.

The Zend Engine replaced Rasmus’ parser for version 4, introducing OOP capabilities, and in Version 5 Zend Engine 2 was introduced. Recent versions of PHP saw even more improvements, most notable namespaces in 5.3 and a built in web server and traits in 5.4

There’s no ideology or design philosophy, except that it should be a simple tool to solve problems.

“I’ve never thought of PHP as more than a simple tool to solve problems”

Rasmus Lerdorf 2010

Lies, Damned Lies and …

Despite a worsening reputation, the language hasn’t decreased in popularity.

Less searches are being done for PHP.

If you look at the JavaScript vs JQuery trends, JavaScript is also decreasing, but JQuery is increasing. It seems like the programming community is realising that frameworks are a good idea.

So if you look at PHP frameworks, searches on them are also increasing, especially after 2013 when Zend 2 and Symfony 2 were released.

No shortage of hosts offering PHP.

Who uses it?

User facing portion of Facebook through HipHop PHP (which generates C++)
Wordpress - Application turned framework
Yahoo (for now). They are replacing it with Node.
Wikipedia / Mediawiki

Embrace the Cactus

It’s easy to create insecure / buggy code in PHP:

    mysql_query("SELECT * FROM `users` WHERE `username` = $_GET['username']");

PHP accounts for only 18% of applications covered by the CVE, but accounts for almost 29% of the vulnerabilities

It’s developed a bad reputation in the programming community:

Bringing a knife to a gun fight is like bringing PHP to a modern web stack.

@iamdevloper

Settings such as register_globals and magic_quotes that defaulted to on opened up a lot of security holes

No unified community. In general, the community is great. In the rare cases where the PHP documentation (or even the language) is insufficient, you can usually find something of value in the comments. Yet, there is a lot of conflict in both the official (like PHP internals) and the unofficial (like PHP-FIG) communities.

If you look at the debate on what to use for indentation, tabs vs spaces, the community is in total disarray.

Inconsistencies in naming functions:

strrev     // String Function
str_repeat // String Function
explode    // String Function
// At least somewhat consistent
strpos($haystack, $needle)
array_key_exists($needle, $haystack)

Object Oriented, or just Object Capable? - Michael Kimsal

So you can do Object Oriented Programming as well as Procedural and Functional Programming in PHP (especially PHP 5.3 and later).

See you on the flip side…

PHP 5.3

PHP 5.3 is for me a watershed version on PHP’s history - It introduced a number of features / capabilities that made it possible for some of the other factors I’ll mention to come into existence. The most notable feature is namespaces, making it easier to name classes in a sane way. A lot of people welcomed the introduction of lambda functions and closures.

I think the PHP developers and community realized that PHP was becoming outdated and had a lot of valid issues that needed to be addressed. For me 5.3 was a definite step in the right direction. It introduced (amongst other things):

Namespaces
Closures and Lambda functions

PHP-FIG

Although it seems to generate a lot of conflict, the PHP-FIG has managed to at least get the different frameworks talking. It’s an unofficial (as in not sponsored by PHP) group formed by various frameworks and projects whose aim it is to get the projects talking and to find ways to work together. It’s not always plain sailing, but it seems to get to valuable decisions. Eventually.

PSR-0 has enabled the creation of packaging software such as composer / packagist
PSR-1 and PSR-2 generated a lot of conflict, but at least all of the participating frameworks partially agreed on coding standards
PSR-3 and PSR-4 aren’t momentous decisions, but they at least pave the way forward for increased collaboration

Packagist / Composer

Composer is a tool to manage dependencies for a project, and manages and installs dependencies on a per project basis. Very much on par with node’s npm and ruby’s bundler. Packagist is a repository for composer packages and makes it dead simple to find a package / library that will address your specific need. Before this, we had PEAR, but that was usually a headache to set up and version properly locally, not to mention on a shared host. Now it’s as simple as doing

    composer require "vendor/library"

To a certain extent the improvements in PHP 5.3 and some of the work from PHP-FIG made this possible, although composer could have existed without them.

Modern Frameworks

The combination of PHP 5.3 (specifically namespaces and proper OO support), the work of the PHP-GIH and the development of Composer made it possible to not only create frameworks such as Symfony2, Zend2 and Laravel, but also to reuse components from these frameworks in other projects. Drupal 8 uses a lot of Symfony2’s components. PPI is a framework built using both Zend2 and Symfony2 components. You can now easily choose and combine libraries without having to manage class names or dependencies. This has at least two direct advantages for project developers:

Instant access to a whole range of precoded, quality, libraries.
No more wasting time on managing dependencies and name clashes.

So, Slum or Diamond in the Rough?

Good systems cater for users’ mistakes, great systems also cater for developers’ mistakes…

Jrgns

My opinion is, there is no right answer. To a certain extent, PHP can be described as a horrible language that makes it very easy to introduce bugs and security issues. It doesn’t give you guidance on how to do anything, and can’t seem to decide if it’s procedural or object oriented. In the same breath, it gives you a lot of freedom to code according to your style, and makes a lot of common coding tasks very easy to do. Successful business have been built and are still running on PHP.

If you’ve never coded anything but PHP and have no formal programming education (including good programming books), you’re probably coding crappy PHP. Probably. I’d suggest you start reading up on good programming practices, start reading code that’s of a high quality, and start learning other programming languages, especially stricter ones like Java, or start using frameworks such as Symfony2 and Laravel that at least guides you in the right direction. Speaking multiple natural languages keeps your brain sharp and young. Coding in multiple languages makes you a better coder.

If you know what you’re doing and you perhaps have some extra experience in a more structured language such as Java or Ruby, you’re probably coding quality PHP. It’s un-opinionated, so, as long as you know what you’re doing, it can be a great tool. Don’t discount the language just because it’s lost it’s coolness factor. You can write quality code in PHP.

If you can pull it off, you’re badass as hell, but most of the time you’re only going to end up stabbing yourself.

ohpalmer

Belgian egg house

Zac Szewczyk — Thu, 10 Oct 2013 00:38:21 GMT

While it seems the photographer did his best to portray the house as much larger than it actually is, this Belgian “egg house” is nevertheless a very impressive and interesting alternative structure.

Permalink.

The Samsung Galaxy Curve: The Greatest Thing since Sliced PVC

Zac Szewczyk — Wed, 09 Oct 2013 23:19:30 GMT

A few days ago I watched a strange article from The Verge titled LG starts producing curved displays to cure dull phone design scroll by in my RSS reader, but paid it little attention. Then, last night, another item caught my eye: Is this Samsung’s curved smartphone? Although still unconvinced as to the form factor’s upsides, I nevertheless opened the article. Shortly thereafter, to my delight, the last piece confirmed the rumor: Samsung announces the Galaxy Round, a smartphone with a curved OLED display. From Sam Byford’s article:

Permalink.

Here is how the percloud would work, in practice

Welcome to Marco Fioretti's website! on Stop at Zona-M — Wed, 09 Oct 2013 11:55:36 GMT

I just got an email by somebody asking how the Free Software alternative to corporate social networks that I call percloud would work. I answered that…

A Sober Cannibal (From Moby Dick)

ho.dges.online — Wed, 09 Oct 2013 03:00:00 GMT

Better sleep with a sober cannibal than a drunken Christian.

Herman Melville, Moby Dick

Habbo You Tell Me How to Act

The David Brownman Blog — Wed, 09 Oct 2013 03:00:00 GMT

undefined

Read the whole thing.

Podcasting State of the Union

Zac Szewczyk — Tue, 08 Oct 2013 22:26:10 GMT

As a huge fan of the medium myself, over the last two weeks I have followed a burgeoning discussion on the podcasting industry with great interest. Across the board, the discourse has remained almost universally positive: Stephen Hacket, Chris Gonzales, Federico Viticci, and Myke Hurley have all expressed considerable enthusiasm for the changes iOS 7 in particular signals for this space, and great hope for its future. Unsurprisingly, not all share these positive sentiments.

Permalink.

The real problem that the percloud wants to solve, and why it's still necessary

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 08 Oct 2013 00:59:16 GMT

Believe it or not, I only discovered arKos last Friday, through this Slashdot announcement: a project (apparently) very similar to the percloud, which is my own proposal for a Free Software alternative to Facebook, Gmail &C.

Why doesn’t ALTER SYSTEM SET EVENTS set the events or tracing immediately?

Tanel Poder Blog — Mon, 07 Oct 2013 18:23:22 GMT

I received a question about ALTER SYSTEM in the comments section of another blog post recently.

The question was that while ALTER SESSION SET EVENTS ‘10046 … ‘ enabled the SQL Trace for the current session immediately, ALTER SYSTEM on the other hand didn’t seem to do anything at all for other sessions in the instance.

There’s an important difference in the behavior of ALTER SYSTEM when changing paramters vs. setting events.

For example, ALTER SYSTEM SET optimizer_mode = CHOOSE would change the value of this parameter immediately, for:

Your own session
All new sessions that will log in will pick up the new parameter value
All other existing sessions

However, when you issue an ALTER SYSTEM SET EVENTS ‘10046 TRACE NAME CONTEXT FOREVER, LEVEL 12’, the event changes in only #1 and #2 will happen:

Your own session
All new sessions that will log in will pick up the new event settings

This means that the existing, already logged in sessions, will not pick up any of the events set via ALTER SYSTEM!

Update 1: Note that since Oracle 11g there’s a parameteter “_evt_system_event_propagation” (default TRUE) and it makes Oracle to propagate the “ALTER SYSTEM” events into existing sessions too. So this problem described above applies only up to Oracle 10.2.

Update 2: Oracle 12.2 seems to have a bug that prevents some events (at least one ALTER SYSTEM SET sql_trace example with a SQL_ID qualifier) from being propagated correctly to other database sessions (link)

Update 3: Apparently in Oracle 18.3 the abovementioned bug is fixed.

This hopefully explains why sometimes the debug events don’t seem to work. But more importantly, this also means that when you disable an event (by setting it to “OFF” or to level 0) with ALTER SYSTEM, it does not affect the existing sessions who have this event enabled! So, you think you’re turning the tracing off for all sessions and go home, but really some sessions keep on tracing – until the filesystem is full (and you’ll get a phone call at 3am).

Marie in France pt. 4

The Walkabout Blog — Mon, 07 Oct 2013 11:03:04 GMT

Strasbourg, September 17

I should be studying right now, but I’m compelled to add some more notes to my journal, especially since it’s so easy to forget one’s activities after a few days.

Friday I showed up for the last class of the week, according to the guide pedagogique emploi du temps, and found two others of our little quartet waiting for the instructor of Seminaire Pratiques d’ecriture[MS1] : traductions adaptations, Lea and Julie, both francaises. Fifteen minutes later, I was not at all surprised that she still hadn’t appeared. So off we went again to HQ, slowly traversing the corridor, checking all the panneaux for some sort of communication as to why the class did not take place. After some time we found a message stating that the class was in session for three hours for each of four days (12 hours total). But the days were not indicated. This was supposedly a “trasversaux” or “sem-transversaux” class involving other disciplines. Lea, the most self-assertive of our little group, considered it scandaleux that evidently the other disciplines were notified of the days but ours was not. We both sent an email to the instructress at the generic email address, with copies to each other. I politely, but pointedly, asked her what in blazes was going on. Lea’s message was a little more pointed. As of today I have not had a reply, I will have to ask Lea if she replied to her email. The following Monday we were assembled for our afternoon class with our director, who hadn’t a clue as to the schedule of Mme-la-prof. Fortunately one of the second year students, obviously more in touch with the faculty, had the dates. It turns out all my Fridays are free until November 8.

I suspect this is more for the benefit of the instructors than the students.

Saturday morning I checked out a place which the beauteous Audrey had set up for me. It was depressing. Enough said. This was followed by a trip to Place Kleber for books and supplies. Returning to the Rue du bon Pasteur, I exercised for the first time since leaving San Francisco, running in the Parc de l’Orangerie which is quite nearby. Sunday, with the help of my Mme. Cazenave, Airbnb hostess I checked out apartment rentals, saw one, not bad but which would not work, no kitchen equipee (stove, oven, sink, etc). But I did get an appointment for Monday evening for an apartment very nearby, which would be perfect.

Monday my first class was an elective, Arabic, writing and speaking. I’ve always wanted to study Arabic, and I think I can do OK with the speaking, but the writing? Wow. Regardless, I picked up the text at Place Kleber.

The transportation system in Strasbourg is very interesting. When boarding the trams you buy a ticket at the individual stations, then you validate them at a machine nearby. Or, if you start on a bus, you can buy the ticket (1.60 euros one way or double that for a round trip), and you validate the ticket on the bus. You can make a connection between bus/tram or vice versa, but it has to be within an hour. At every place you board you have to validate your ticket. I was told the system was strictly regulated, a fact I found hard to understand since it seemed that you could board a tram with ease without paying, there was nothing to stop you. Regardless, being a law-abiding individual, I followed the rules. On the return from Place Kleber I learned differently. For the first time I saw a ticket agent, who I guess boards the trams at random times. He checked everyone’s ticket, including mine, which of course was perfectly validated. Don’t know what would have happened had I not had a valid ticket, maybe I would be writing this journal from my jail cell.

Monday afternoon my class was “Theatralites”. The subject matter is as vague as the title, and cynic that I am, I suspect that it’s an invention of the faculty to plump up the program. But it’s going to be an important part of the program, so I better get with it.

Headed for 22 Rue de Johann Sebastian Bach to see the apartment. Yes it’s perfect, but I was semi-candid in advising the bailleur (landlord) how long I was going to stay, definitely a point not in my favor. He had a couple of other people who were interested, and I will know tomorrow. Today I sent him an email offering some little incentives which hopefully will put me in a better light.

Tuesday morning there was a presentation on Cervantes, in Spanish, by a Spanish professor and author, Senor Galicio, very interesting, even though I probably understood only about 70%. In the afternoon I had my Spanish lit class – plays of the Siglo de Oro – more theater. But I did find out that my copy of Don Juan was probably not going to work optimally, and that there was a third bookstore at Place Kleber at the Aubette, a sort of upscale galleria, where I would probably find a more informative edition – this from a student, as it seems a universal law that no faculty member is a source of any practical information.

Mme. Cazenave, my Airbnb hostess is working on a certificate in speech therapy. She was married to a physicist who worked not only at the University, but also in China, England, the US and elsewhere, and she is fairly knowledgeable about the university system in France. She tells me that on dit (they say) that the professors of non-scientific studies are much less serious than the professors of scientific studies. I don’t doubt it.

Our group at Rue du Bon Pasteur has expanded to four, with the arrival of Sabrina, a charming flamande, who is in Strasbourg on some sort of teaching internship. Laure (francaise) is studying biology at a 2 year vocational institution, which sounds pretty rigorous from what she tells me. The two of them are probably similar in age. My hostess, a mature, experienced mother and grandmother, is still young enough to be my daughter. Regardless, I hope we will become good friends.

The nice M. Schneider has sent my helpful hostess an email with the name and contact of another agent immobilier. If the apartment I’m interested in does not work out I will give her a call.

So much for studying. Tomorrow is another day.

Marie in Strasbourg part 2

The Walkabout Blog — Mon, 07 Oct 2013 10:54:26 GMT

Strasbourg, Tuesday, September 10, 2013

Sunday morning was a rush getting my bags packed, having breakfast, checking out of the hotel and supervising my luggage into a taxi waiting for me per prearrangement. There were now three pieces, plus the backpack, the third being a huge one weighing over 20 kilos (over 45 pounds) which had been fed-exed the week before. My hostess greeted me warmly on my arrival, we managed all the luggage into her very spacious unit (I think it’s the French equivalent of a co-op), and then I immediately crashed for a couple of hours.

My room is spacious, I have a huge deck right outside, private shower and sink, toilet off of the hallway. Everything is modern, nicely tiled floor. Mme. Was also kind enough to allow me the use of a huge glass table just outside my room on which I promptly installed my PC and various documents relating to banking, school and finding my way around Strasbourg.

Sunday everything was closed, except for some restaurants, so I went exploring in search of dinner armed with a large map of Strasbourg. After about half a mile I found a place that seemed marginally serviceable (hamburgers). On entering I saw an open bottle of Black Label on the bar. Johnny Walker Black is not my scotch of choice, but there being no Dewars I ordered a glass. The Black Label had much less of a bite than the Black Label I have tasted in the US, but I drank it regardless, ate the hamburger (the fries were good), and returned chez moi with a headache. Highly unlikely that I will order another Scotch for a while, even if I can find an establishment which sells it.

Mme. had no problem signing the address verification, so armed with her attestation, my passport and some traveler’s checks I presented myself at the Société Générale Monday moring, fully confident of having a checking account following a few formalities. Monsieur there was very courteous, and after going over the documents presented told me that all that was needed was an attestation from the taxing authority of my city or state validating the fact that I had paid my taxes for 2012. Seeing my blank stare he suggested that I might write to this organization, explain the situation, and request the attestation. He wasn’t certain that a copy of my tax return, which was in any case locked up in San Francisco, would be sufficient. I thought Oh sure, Dear IRS, I am a student in Strasbourg unable to open a bank account without proof that I have paid last year’s taxes, so could you please send same ASAP. Needless to say I still don’t have a checking account -- but I haven’t given up.

On to the Orange store to upgrade my cell service, then to the Apple store where I waited for a hour before seeing a very nice tech who found nothing wrong with my Iphone, finally showed up for my 3:00 class. Madame-l’instructrice was late (no surprise), but instead of going into the course on Théatralités she spent the time explaining the very complicated curriculum for the next two years (I only want to understand the first semester) and fielding questions from my group. There are four of us in this group, une francaise, a young woman from Colombia, an Italian signorina (I think) and myself. A lot of explanation results in a small increase in my understanding of what’s going on, so I continue to ask questions of whomever and whenever I can.

Tuesday morning the Secretariat was finally open again, so I got there early to pay my deposit of 250 euros. Wrong place. I was sent to another building where a cashier took my money, so I was finally “administrativement inscrite.” I was astonished to learn that this is all I’m going to be charged for the entire year. This explains much of what I have observed in the last few days. The school budget has its limits, different disciplines may be combined if the subject permits, the Secretariat personnel are probably paid for only three days a week (hence the Friday and Monday closures). The restrooms are for both men and women, there are plenty of stalls, they are clean (this is Strasbourg after all), but – there are no toilet seats.

I took the bus back (buses were running despite a 24 hour greve, ie. Strike). On entering I asked the driver in French if he was going to the Rue d’Ypres. His reply was “Bonjour, Madame.” I asked the question again, and his reply again was “Bonjour, Madame.”

Lightbulb moment – I said “Bonjour, Monsieur, est-ce que vous allez a la Rue d’Ypres?”

“Eh bien, oui, Madame.”

Another lesson learned in France. Greet the bus driver. In fact greet anyone you interact with. Everybody does.

Like Monday, Tuesday is pretty light, I had a one-hour course at 4pm again with la Mme-l’instructrice. This is Spanish lit (15^th-18^th century) and because her background is theater we are studying Spanish drama, beginning with Don Juan, el Burlador (libertine, seducer) de Sevilla by Tirso de Molina (17^th Century) – should be interesting. The class is conducted in both French and Spanish, Mme. Switches back and forth between the two. I understand the French more than the Spanish, regardless I understand neither 100%. There is no central bookstore on campus. I will have to go to the International Bookstore at Place Kleber (home of the Orange ad Apple stores) to buy the texts.

The streets in the center of town are small, and shared by cars, pedestrians and bicyclists. The cars are very careful, the pedestrians politely try to stay out of their way, it is the bicyclists who think they own the road. Outside of the center the streets are wide enough to allow cars their own space, the sidewalks are divided into a marked bicycle section, and an unmarked pedestrian section. Neither the bicyclists nor the pedestrians make it a point to stay in their own section. Sometimes cars are parked on the sidewalk, which results in a catch as catch can situation. But I am staying is a fairly upscale section, and everyone is pretty polite.

Guest post from Marie abroad in Strasbourg

The Walkabout Blog — Mon, 07 Oct 2013 10:52:39 GMT

I'm very pleased and proud to be putting up this guest post on behalf of my mother, Marie. Ever since our visit together in France in 2008 (described towards the beginning of this blog) we've been planning to get her set up in France to study abroad here. You see, she's 70 years old, and happily very fit and also just retired. And get this,when she was in undergrad in the 1960's, she *majored* in French, and so despite having excelled in this language, she's only ever visited a couple times since and at most just for a few weeks! So with a bit of help, she applied (and got into!) a program in University of Strasbourg called "monde roman et neohellinique parcours d'etudes iberiques et latino-americaine", which while roughly translating to "Roman and Neo-Hellenic World- Program of Iberian and Latin-American Studies" actually has her studying languages including Arabic and Spanish (though she's already fluent in Spanish), along with (I believe) cultural and history courses. With course paths for professional translators and for researchers, she's taking the researcher route. It's a two year program, and she's there for at least a year of it maintaining option to stick around for a second year if she wants to.

And wonderfully she's gone ahead and been writing up her own journal and taking her own iPhone photos and emailing them over, and so with her permission here it is for the internet :)

Strasbourg, Saturday, September 7, 2013

It’s 2:00 in the afternoon, the first time I’ve had some downtime and not been tired since I left San Francisco. I spent a couple of days with Teddy in Boston. Monday we walked (and walked and walked) from Brookline to the North End where we had dinner. Tuesday I had lunch with Celina Valadao, who used to be a rep for Continental, and is now a fundraiser for the Huntington Theater near Berklee. Hopefully we will stay in contact.

I arrived at Logan around 6:30 pm Tuesday for my 9:00 flight on Aer Lingus. Turns out they were overbooked and offered me $650 to give up my seat. I declined saying I had to be in Paris the next morning. So then they asked if I could go on Air France, which left at 10:30 pm but arrived in Paris an hour earlier (no changing planes in Dublin). This was acceptable, the exchange was made, I bought a suspense paperback to read on the plane and waited til boarding at ten. The flight was very comfortable, I had an aisle seat in a middle row with two empty seats next to me and was served champagne with dinner (no extra charge). I finally slept for a couple of hours, and when I woke up we were about to land at CDG.

After passport control I taxied from CDG to the Gare de l”Est, and it was there, as expected, that I encountered my first issue with the luggage. Pulling the medium sized roller, the small roller, and the backpack heavy with electronics, I had to go up 5 steps to get to the station. Seeing my struggles, a Frenchman pulled them up for me. After that I managed reasonably well, but was always grateful for offers of assistance. These came from people other than the French. A couple of nice African girls helped me download the bags from the train at Strasbourg, and a Tunisian young man helped me tour around the station looking for the taxi stand (on exiting I had made a left instead of a right).

Made it to the hotel. The room is tiny, but adequate, with plenty of outlets for electronics. After setting up the machines I realized my mouse wasn’t working which was embêtant. In French bête means stupid, and embêtant means pain in the neck. But I can’t think of an English translation using one single word, so I like this word and you will see me using it a lot. Bottom line is I had to use the touchpad. Got settled, had dinner, fell asleep at midnight and woke up at 4 am Thursday morning wide awake. During the previous 39 hours I had had a total of 6 hours of sleep.

My orientation meeting was at 10 am in Salle 4307 at the Patio (pronounced pash-she-o). The campus wasn’t hard to get to, about a 12 minute walk from the hotel. Finding the room was something else altogether. As I eventually found out, the number means building 4, third floor, room 7. Fortunately I had left the hotel early, so I had plenty of time to wander from pillar to post asking questions. Got to the meeting in time, met my director, and after spending the two full hours there, determined that I should really be at the meeting the next day. Saw my director later on that afternoon with more questions, answers to which I did not fully understand.

As I have said several times, the program I am registered in is entitled Roman and Neo-Hellenic World Survey of Iberian and Latin-America Studies. Within this program are divisions, sub-divisions, and sub sub-divisions, with names like formation, parcours, specialites, and composantes. I have yet to find out what these words really mean. For example Carole Egger is my Directeur de Parcours, and another lady is my Directeur de Specialités, but Carole is the one I will be most in contact with. The Thursday meeting was for people who want to teach, and since I don’t want to teach I should be in EMOS (Etudes Mediterraneennes Orientales et Slaves) which I think stands for Mediterranean Eastern and Slavic Languages. That orientation meeting was on Friday morning so I was there Friday as well.

The “curriculum” for two years is printed on three 8-1/2” x 11” papers, folded in half, to resemble a small booklet with a colored cover entitled “Guide Pedagogique”, etc. It could have been printed by one of the faculty members, although I doubt it, since they all seem more interested in their vacations than tending to business. Half of the classes for M1 S1 (first year, first semester) have names like Théatralités, Documents Iconographiques, and Methodologie de la Recherche, and one can only wonder how much Spanish is involved. The departments seem enclaves unto themselves, with very little connection with, or even understanding of who is actually running, the university.

I still don’t know how much this is going to cost. Rick did some preliminary checking for me and the information he got was 760 euros or thereabouts, which seems incredible. I have to go to the Secretariat and pay my 249.10 euros entrance fee. At that time I can get some more administrative information, find out how to get on the school internet, and hopefully determine what the cost will be for the semester. The Secretariat is closed on Mondays and Fridays. I guess by now you must be getting some idea of how they do things (or not) at the University of Strasbourg.

Classes start Monday afternoon. I will be asking more questions and hopefully get a little more understanding of what I’m supposed to be doing. At the meeting on Friday the word “obligatoire” was used several times. There is an EMOS website, which we were all exhorted to telecharger (download). I guess that’s a start.

The rest of Thursday and Friday was spent doing laundry and trying to open a bank account. I say trying because It is not easy. You can’t just walk into a bank and say you want to open up an account, you have to make an appointment first. I finally had an appointment with BNP Paribas, one of the largest banks in France. I spent quite a lot of time with Mlle. Michel, going over my documentation and the various options available to verify my address. One cannot open an account without this verification, so I was prepared to wait a few days for this last requirement to be completed. After some 45 minutes and having selected one of the address verification options, Mlle. Walked off with a handful of papers only to return a few minutes later informing me she was desolee, but I could not open an account with BNP Paribas because I had no regular income. I was stunned.

Mlle. Referred me to a bank across the street whose requirements I guess are less stringent. I have an appointment with them Monday morning. I am to arrive with a document they gave me, signed by Mme Marques (the lady I am staying with for two weeks) stating that she has the honour to “heberger Mlle. Marie Sheridan” at such and such an address, that she will advise whoever when this arrangement changes, and that if the contents of this attestation are inexact, she is liable for punishment of up to a year in prison and a fine of 15,000 euros.

This morning was spent on electronics. First I went to the “Orange” store to get a cell phone number. After a contentious encounter with some burly tech behind a counter who refused to talk to me, kept waving his arms in the air and saying “no English, no English” (I wasn’t about to speak to him in French, he was so brutally rude), one of the customers told me in English I had to register first. Which I did. Ten minutes later I was sitting down with one of the more civilized techs who set up a cell phone number for me for one month. I have to recharge it every month. I cannot get a subscription for more than one month. Impossible. I don’t have a bank account.

Next I went to FNAC, sort of a Best Buy. My first inquiry had to do with my wireless mouse which no longer worked. After hearing my story and thinking about it for a few minutes, this nice young man took the battery out and replaced it, removed the pin from the USB port in my PC and reinserted it, and showed me how to turn off the mouse to save battery life. The mouse works fine now. This is one of the nicer things that have happened to me in the last few days.

Then I bought a transformateur. All the communication devices have dual voltage, so all you need is an adapter to plug into the wall. But my electric toothbrush (or hair dryer, water-pik, or some other personal care device) has only 110, so if you just plugged it into the wall with an adapter it would fry. The transformer, which is also an adapter, takes in the 220 volts in France, and outputs 110 volts for my non dual voltage device.

I have spoken to Mme Cazenave, and tomorrow at 11:00 I arrive at her doorstep via taxi with all my luggage. The next stage begins and I have to start seriously looking for an apartment.

My French gets better every day. I understand everything I read in the newspapers, and even if there is a word or two that I’m not familiar with, I can figure out what it means from the context. Then when I try and verify it in my 50 year old Larousse, it may or may not be there. I had thought that everyone in Strasbourg who serves the tourists spoke some English, but this is not the case. Consequently I am speaking in French with). the bankers, the techs at Orange and FNAC, and people on the street from whom I ask directions. If the conversation gets too technical I ask them to slow down and explain a word to me in French. I also speak French to the faculty at the University. But I’m not yet ready to ask them to slow down and explain a particular word to me, so I just have to wing it. Thus I’m getting more and more comfortable with the language. This was my goal, and I am content.

There is a Mass at the Cathedral is about 20 minutes, and I will be going there. It is abour 50 meters away, facing my hotel. The Cathedral is as I remember it, truly awesome (and I use that word in its original meaning) The sound and light show is over for the season, too bad.

Marie in France - pt 3

The Walkabout Blog — Mon, 07 Oct 2013 10:04:57 GMT

Strasbourg, September 12, 2013

Before I start the next set of events, I want to mention once incident which took place the same day I had the encounter with the bus driver (Tuesday September 10). I did some food shopping at a good-sized market in the neighborhood, and on my list was some cheese. I am very partial to Bel Paese (Italian) but the lady at the cheese counter had never heard of it. Another shopper overheard our conversation and remarked that she also liked the Bel Paese, but the French cheeses were even better, and she recommended such and such cheese. So I said to the attendant, "Bon, Mme. has recommended this cheese and I will take it". Well, I didn’t like it. The next day I returned to the market and this time I asked for Emmenthaler, which was promoted on most of the menus I had seen in the last few days. The same girl asked me how I liked the other cheese, I replied “Pas trop” (not so much). And she said Hein (hah) and Mme. Thinks she can make a good recommendation. This particular scenario made me feel like I was beginning to be a part of the community. The focal point was not that I was an American who needed help, but that Mme. What’s-her-name overstepped her expertise in cheese recommendations.

Yesterday I had a double class with my director. French/Spanish translation is in one building, Spanish/French translation is in another. You only have to take one or the other, but you have the option to take both, which I am. But I think I will only take the exam in one. In the first class the door was locked, there were a number of us waiting, and then the instructor showed up with the key. Somehow there were already others in the classroom. This is where the EMOS students (of which I am one) take the same class as the students who want to be teachers, and there are both M1 and M2 (first year and second year) students.

When the French/Spanish portion was over I followed the crowd to the sous-sol (basement) batiment 4 for the Spanish/French portion. There were about 30 of us waiting outside another locked door, but I didn’t see the instructor. We waited about 20 minutes before she finally showed up. She had been looking (who knows where) for a key to open the door.

My airbnb hostess had referred me to a friend of hers, an agent immobilier (real estate agent) who did not do rentals but who referred me to his colleague Audrey, a beautiful blonde francaise, very nice girl. At this point I realized if I wanted a furnished unit, it would most likely be a studio, and anything larger would be unfurnished. So I began thinking in terms of unfurnished apartments and furniture rentals. I showed up at their office at 2:30, Audrey and I talked about various options. Quickly enough we realized that because I did not have a bank account I could not rent an apartment in France, clearly I could not do anything in France without a bank account. Audrey made a few phone calls to banks without success, the agent and another colleague got into the act, and for the next half hour the three of them were making telephone calls and checking the Internet, all the while the agent was telling me “We will find a solution.” Bottom line is the agent made an appointment for me the next day with a bank near where I’m staying, and this banker, based on the information he received from the agent (whom he did not know) agreed that he could open an account for me. Although not convinced that this would happen, I was hopeful and left their office thanking them profusely.

Meanwhile Audrey had given me an option (once I got the bank account) of a hotel/apartment rental in Petite France, a lovely section of Strasbourg. But the units themselves were small and sort of non-descript. Audrey had told me that apartment owners would only rent for two or three years, so I presumed this was my only option (I have since learned differently).

My first class this morning (8:00 am) was a seminaire transversal (combination of students in other disciplines) on Renaissance myths and the medieval Mediterannean. I hope this class will turn out to be as interesting as it sounds. I say will, because the instructors never showed up. There were four of us waiting, finally after fifteen minutes, one of the second year students took the lead and suggested we go back to Monde Roman headquarters (in another building of course) and find out what the problem was. So off we trekked to Batiment 4, troisieme etage, and slowly made our way down the hall looking for signs of human life. I spied a female functionary in one of the rooms and asked her where this new instructor was. She said he wasn’t here this week, and he had posted a message on the panneau (glass panel) down the hall. We must have checked about a dozen panels full of postings, and finally found an 8-1/2 x 11 piece of paper informing one and all that this instructor was out of town this week. Not too far away was a similar message regarding yet another instructor, the other half of this invisible team. So with a sigh, further discussion on the various programs, and an exchange of emails, we all went off to whatever else we had to do.

My "else" was a 9:00 meeting with a retail banker (about 25) at the Banque Populaire d’Alsace. He had had some concern that I did not speak much French, but seemed gratified that we were able to conduct our business in French. He spent some 45 minutes with me, explaining everything slowly and clearly, about 90% of which I understood. Long story short, I walked out with a bank account, transferred some money on line from San Francisco, and returned in the afternoon to conclude the transactions and sign the papers. I now have a stack of documents in French which I have no intention of reading, but I am assured that everything is in place for me to negotiate an apartment rental (carte bancaire, assurance, etc.) sans souci.

Back to the apartment. My airbnb hostess explained to me that even if one rented an apartment for two or three years, the renter had the right to terminate the agreement with three months’ notice. My bank representative confirmed this, although there are of course certain procedures which have to be observed. I will need more explanation on this, but in any case tomorrow I will check out the units at the Petite Marie, a really lovely part of Strasbourg. I also have to go to the Place Kleber (Orange, Apple, International bookstore) and pick up a copy of Don Juan by Tirso de Molina, and Robert’s French/Spanish dictionary (I have Larousse French/English and Cassell’s Spanish/English which I will undoubtedly have to refer to).

My only class tomorrow is 2-5, entitled Seminaire Pratiques d’Ecriture: Traductions Adaptation (the French really seem to like long titles). I hope this instructor shows up. On time. With a key.

Purchasing a £30,000 numberplate for the price of a bus ticket

Tom Forbes — Mon, 07 Oct 2013 04:40:33 GMT

Regtransfers.co.uk is a website that allows you to purchase customized numberplates for your car or motorbike. They boast a large number of famous clients and short numberplates are often on sale for upwards of £20,000 (the plate ABC 4 is up for £30,000). While playing with their site I discovered a...

How to fly… like a boss

Josh Thompson — Mon, 07 Oct 2013 03:00:00 GMT

I am in a quest to level up my life. Free flights is a big part of this. I’ve not gotten too many of those yet, but the next best thing is free seat upgrades. I’m not talking about first class - that’s beyond me, at the moment. I’m talking about getting stuck in the back of the plane, jammed against someone else, with zero space. There’s plenty of room for improvement. more

Short of being moved to first class and getting a personal waiter to attend to every creature comfort, you’re best option is getting bumped up to an exit row. After seven hours of your knees bumping into the seat in front of you, an extra six inches of leg room would be better than a four course meal.

When you buy your ticket, you can usually choose what seat you want. Except exit row seats. Those cost extra. No one wants to shell out an extra $40 or $100 for that, so you accept the back-seat-middle option, and head to the airport.

Here’s how I’ve managed to upgrade, for free to the exit row (with it’s extra leg room, and often no one sitting beside you) on six of the last seven flights I’ve taken.

Step 1: Inquire at the ticket counter, if there is one. (The ticket counter will be near your gate, but is the kiosk sitting beside the gate.)

Be polite. Put yourself in their shoes. Then act like a decent human being. It’s not hard.

Here’s the script:

You: “Hello - is this the right place to ask about a seat upgrade?”

Them: “Yes.”

You: “Awesome. I was wondering if there are any exit row seats available on 1107 to Dallas.”

Them: “Let me check”… typing… “Yes, there are. You may upgrade for $40 dollars.”

You: “OK - thanks for checking. I’m trying to spend as little as possible on this flight, so I’ll pass on the upgrade right now, but thanks again for checking.”

OK - no luck at the ticket counter. This isn’t a surprise, because the ticket counter is sort of like upgrading via the website - if they’d charge you on the website, they’ll charge you at the ticket counter.

Step 2: Inquire at the gate-side kiosk. Again, be friendly. Even if the answer is no, you should have still brightened their day a bit.

There are three options here:

No seats available. Walk away. The seats are all full, so no dice today.
Seats available, but you have to pay. Walk away - there’s still hope.
Seats available, but the agent has to either let everyone else board, or needs to finalize the roster before giving you the upgrade. Let them know you’re interested, give them your ticket if needed, and wait until they call you back up or everyone has boarded.

This last option has been the most common for me. I have to wait a few minutes, or let everyone board, and the ticket agent hands me a new ticket for the exit row. Success!

Step 3: Make the switch once you’re on the plane. By this point, you should know for sure if there is an exit row seat, and if you asked, you’ll know which one. (If it’s the middle seat between two people, and you’re assigned an isle seat elsewhere on the plane, it may not be worth making the switch.

But if it’s a desirable seat, here’s what you do…

Take your assigned seat, and wait for everyone to get on the plane. As soon as flight attendants start shutting the overhead compartments, locate one and say “I noticed an open exit row seat. Would you mind if I swapped into that one real quick?”

They will say “go for it.”

Success! Sitting in an exit row seat, possibly with no one besides you. I’m writing this right now in an exit row seat with an empty seat beside me. It’s great, and quite worth while.

Why Bother?

There are two reasons why this is something worth doing:

First, flying is uncomfortable. Any extra room for comfort increases the quality of the hours you’ll spend sitting there. This upgrade hurts no one, so why not try for it?

Second, you will start learning to ask for things in a polite but reasonable manner. I have suspicions that a of things can be had by just asking kindly, so why not start learning to do so?

Please give this a shot next time you take a flight. Let me know how it goes!

2013-10-06

ho.dges.online — Sun, 06 Oct 2013 03:00:00 GMT

Taken lying flat on the ground under Central Station in Glasgow. I was so focussed on getting the shot lined up that it wasn’t until I sat up that I noticed that I’d been joined on the ground by a drunk who seemed to have assumed that I was settling down for the evening!

And Then Steve Said, 'Let There Be an iPhone'

Zac Szewczyk — Fri, 04 Oct 2013 19:40:58 GMT

As a rule I try not to link an article unless I have something meaningful to add to the surrounding conversation, and especially in cases where all the popular tech sites have already picked up said article. Occasionally, in exceptional circumstances I break that rule however, as I couldn’t help but link Fred Vogelstein’s New York Times piece chronicling the advent of the first iPhone. An exceptional read, to put it lightly.

Permalink.

[10.4.13] 3D-PRINT-ARM: SCARA 3D Printer UPGRADE

transistor-man.com — Fri, 04 Oct 2013 11:38:38 GMT

Detailed Upgrades of Scara 3D Printer Robot

Writing deterministic tests

Craig Pardey — Fri, 04 Oct 2013 03:00:00 GMT

Non-deterministic unit tests are like kryptonite for an automated build. They cause intermittent build failures and the development team becomes accustomed to ignoring a failing build. This is a Bad Thing.

Thread.sleep(x) in a unit test is a recipe for non-deterministic behaviour. Think about what happens when this test is run on a slow machine. How big does X need to be?

I often see this anti-pattern in multi-threaded code where the test case is waiting for some asynchronous task to complete, and the test case has to guess at how long the task will take, and then asserts on some condition that the task was supposed to change.

Work Like Hell

Dan Stroot — Fri, 04 Oct 2013 03:00:00 GMT

If other people are putting in 40-hour workweeks, and you're putting in 100-hour workweeks, then, even if you're doing the same thing, you will achieve in four months what it takes them a year to achieve.

This post Work Like Hell first appeared on Dan Stroot's Blog

Fulfilling the Dream

Zac Szewczyk — Fri, 04 Oct 2013 00:51:10 GMT

Exactly a week ago today Chris Gonzales of Unretrofied wrote an article called iOS 7 and the State of Podcast Apps, a rather presumptuous title given the article’s actual contents, that I initially did not plan on linking to or writing anything about. At the very bottom of his article though, Chris tacked on a bracket-thetical that gave me pause:

Permalink.

Cabin Porn Roundup

Zac Szewczyk — Thu, 03 Oct 2013 21:59:39 GMT

Over the last few weeks, as I scrolled through my RSS reader and came across a particularly interesting or attractive cabin, I would send the page to Instapaper. Unfortunately, most of those cabins got lost in translation, so to speak, and never made it to this site for one reason or another. I’m not here to assign blame though, but instead to show off some really great cabins.

Permalink.

Evolution 2013 presentation, notes and slides

Jonathan Chang — Thu, 03 Oct 2013 07:53:03 GMT

Our pilot study worked! Over a dozen Mechanical Turk workers helped to digitize our pilot study sample of fishes. For more details and results, check out the slides I presented at Evolution.

This was my first year attending Evolution, and it was exciting showing my work with the Encyclopedia of Life to an amazing group of scientists. I got lots of great feedback from people interested in my idea and methods. Based on this feedback, the next larger experiment is going to incorporate a semi-landmark approach, where workers will outline a shape, such as the curve of the dorsal fin that then gets subsampled down into a series of points. Additionally, the study will include a much larger number of landmarks, particularly those that more closely correspond to functional and performance aspects of fish anatomy. These are steps that I plan to take after discussions with several people, including Matt McGee and Thomas Claverie of the Wainwright lab, and Bruno Frederich, a visiting scholar in the Alfaro lab from the University of Liege.

I’m currently working hard on writing the code and protocols for the next study. As always, all of the study materials are freely available online at GitHub

Decoding NASA's NOAA weather satellite signals with RTL-SDR

Shyam Jos — Thu, 03 Oct 2013 03:00:00 GMT

NOAA satellite is a series of weather satellites launched by NASA. It carries a suite of instruments that provides data for weather and climate predictions, everyday multiple NOAA weather satellites pass above us. Each NOAA weather satellite broadcasts an Automatic Picture Transmission (APT) signal (137MHZ), which contains a live weather image of our area. RTL-SDR dongle combined with a good antenna and programs like GQRX, sdrsharp and WXtoImg we can decode this signals.

If you are not familiar with RTL-SDR, RTL-SDR is a very cheap software defined radio that uses a DVB-T TV tuner dongle based on the realtek RTL2832U chipset. Basically , this means that a cheap $20 TV tuner USB dongle with the RTL2832U chipset can be used as a computer controlled radio scanner.

After a long trial and error process with different antennas finally I am surprised with APT signal reception from my simple ground plane antenna which is made from coat hanger.I don’t no more technical stuff about antennas, My GP antenna have 22 inch long radials ( slant down at an angle of 45 degrees) close up photo of antenna.

The 4 radials are connected to metal base plate and the center radial is wrapped in an insulation tape (no contact with metal plate or other 4 radials ) I used a 75 ohm coax cable for the feed line and it is less than 5 meter long, center copper wire of coax is connected to the center radial and silver wires to the metal base plate.

Software setup #

Software used is sdrsharp (RF gain 100% ,40~42khz bandwidth,90% AF gain,Sample Rate: 1,024 MSPS,audio sample rate: 48000) and the audio is piped to WXtoImg via Virtual Audio Cable (48000 sample rate output).

Decoded Images #

NOAA 18 #

NOAA 19 #

NOAA 15 #

NOAA 15 - Sea surface temperature #

discussion on reddit .

Why BlackBerry failed

Jason Eckert's Website and Blog — Thu, 03 Oct 2013 03:00:00 GMT

To be honest, I really didn’t want to do another BlackBerry-related post. It just doesn’t feel like something that interests me anymore. But today I decided to do one anyways for several reasons:

I’ve been a long-time BlackBerry user and author of their academic textbooks - as a result, I know their technology inside-out, and have worked closely with the organization.
I have lived and taught computer science in the K-W region for the past 15 years, so many of my friends and past students have worked for (or still work for) RIM.

Nice to have: YoutubeCenter

zufallsheld — Wed, 02 Oct 2013 18:14:00 GMT

Via Allan McRae I found out about YoutubeCenter, a userscript and/or add-on for Firefox and Chrome.

This script come with many handy features that make the Youtube experience way nicer!

Some really nice features I used are:

Remove ads
Resize the player
Buffer the video even when paused
Provides …

Who will make the percloud happen? Traditional FOSS advocates, or everybody else?

Welcome to Marco Fioretti's website! on Stop at Zona-M — Wed, 02 Oct 2013 10:33:35 GMT

A reader of my critique to the “Linux owns the Internet” slogan just made the comment integrally copied here:

Simulations, Simulated

The David Brownman Blog — Wed, 02 Oct 2013 03:00:00 GMT

undefined

Read the whole thing.

Many Changes

trv.rs — Tue, 01 Oct 2013 03:00:00 GMT

So many things have changed very quickly, I barely have time to catch up, or write a blog post.

I have left my position at Luckie, and after a brief stay at another advertising agency, I have parted ways with established business (for the time being) and have been freelancing for about a month now. It's been scary, exhilirating, and an amazing opportunity to trust the Lord with what happens next, because I have no idea what is going to happen next week.

But that's ok.

I'm open to suggestions for now. Barring a great position opening that grabs ahold of me, I'm going to continue working from home and freelancing where I can. If you know of a position, contract, or job that you think my very particular set of skills would be a great fit, hire me.

Whatever happens, I'm just going to be grateful for the journey, and leave the destination up to God. I covet your prayers for wisdom and peace. If you see me lounging around town in some coffee shop, come over and say hello. I'd love to share what I'm learning in development and otherwise.

RaspberryPi shutdown button

GeekWare - Daniel Pecos Martínez — Mon, 30 Sep 2013 17:57:55 GMT

Last Friday I got some spare time (finally!) and, with the help and tools of my friend Alfredo, we placed a button in the RaspberryPi case so, when I push it, a custom command its executed on the RaspberryPi, like for example, a clean system shutdown.

First lets start with some pictures of the final result:

And now the schematics (pins used in the schematics are 3.3v, GND and GPIO):

We mainly followed this post, but used a different GPIO port, we soldered the components (once we tested the schematics on a protyping board) and modified the code to launch a custom command. This is the resulting code we used to do a system shutdown (I removed some comments from the original code of the post):

import os
import time
import RPi.GPIO as GPIO
GPIO.setmode(GPIO.BCM)
GPIO.setup(4,GPIO.IN)

prev_input = 0
while True:
  input = GPIO.input(4)
  if ((not prev_input) and input):
    os.system("sudo halt")
  prev_input = input
  #slight pause to debounce
  time.sleep(0.05)

The line highlighted is the one you should modify to set your custom command. To test it, you have to execute it as root:

$ sudo python gpio_button.py

and press the button. Finally, to launch this code in the startup process, just add it to /etc/rc.local (just before the exit 0):

$ sudo vi /etc/rc.local

Easy peasy!

Next steps: modify the program to detect single click, double-click and long click.

"How Linux owns the Internet" is SO wrong. And bad. But luckily...

Welcome to Marco Fioretti's website! on Stop at Zona-M — Mon, 30 Sep 2013 14:52:40 GMT

Have you seen that article titled “How Linux owns the Internet”?

Python Backup Script with rsync

zufallsheld — Sun, 29 Sep 2013 21:13:00 GMT

UPDATE: I rewrote the whole script. You can find it here!

I wanted to get into Python recently and to have a reason to actually learn the language, I thought to myself, why not replace the bash-scripts I use on my private computer. I started with my backup script, that …

[9.28.13] Motorola S305 Bluetooth headphone revival Jig

transistor-man.com — Sat, 28 Sep 2013 11:38:38 GMT

Quick guide for repairing Motorola S305 Bluetooth headphones

Finite state machines in puppet

The Technical Blog of James on purpleidea.com — Sat, 28 Sep 2013 09:09:08 GMT

In my attempt to push puppet to its limits, (for no particular reason), to develop more powerful puppet modules, to build in a distributed lock manager, and to be more dynamic, I’m now attempting to build a Finite State Machine (FSM) in puppet.

Installing Oracle Java 7 SDK on the Raspberry Pi

Tafkas Blog — Sat, 28 Sep 2013 03:00:00 GMT

Two days ago the official hard-float Oracle Java 7 JDK has been announced on the official Raspberry Pi blog. Prior to this there was only the OpenJDK implementation which was lacking performance. Furterhmore the Raspberry Pi Foundation announced that future Raspbian images would ship with. Oracle Java by default. If you want to give it a spin you can install the JDK with: $ sudo apt-get update && sudo apt-get install oracle-java7-jdk

33 Of The Most Hilariously Terrible First Sentences In Literature History

Zac Szewczyk — Fri, 27 Sep 2013 13:13:02 GMT

Number ten, Tonya Lavel’s, and the eleventh, David Pepper’s, were reasonably good. With those two exceptions though, these were almost universally both terrible and utterly hilarious.

Permalink.

Turning 30

Justin Garrison's Homepage — Fri, 27 Sep 2013 03:00:00 GMT

I just turned 30. I wanted to share 30 things I’ve learned in the past 30 years. Or at least the things I

No Ads!

The Technical Blog of James on purpleidea.com — Fri, 27 Sep 2013 02:18:34 GMT

I just shelled out to wordpress.com to buy the No Ads upgrade. I think they’re good people. I hope you all appreciate it. Let me know if you do.

Happy hacking,

James

You can hire James and his team at m9rx corporation.
You can follow James on Mastodon for more frequent updates and other random thoughts.
You can follow James on Twitter for more frequent updates and other random thoughts.
You can support James on GitHub if you'd like to help sustain this kind of content.
You can support James on Patreon if you'd like to help sustain this kind of content.

Why We're Shutting Off Our Comments

Zac Szewczyk — Thu, 26 Sep 2013 15:52:33 GMT

An excerpt from the Popular Science article in which they laid out their reasoning behind turning comments off. As John Gruber said, it’s hard to believe it took them this long.

“A politically motivated, decades-long war on expertise has eroded the popular consensus on a wide variety of scientifically validated topics. Everything, from evolution to the origins of climate change, is mistakenly up for grabs again. Scientific certainty is just another thing for two people to ‘debate’ on television. And because comments sections tend to be a grotesque reflection of the media culture surrounding them, the cynical work of undermining bedrock scientific doctrine is now being done beneath our own stories, within a website devoted to championing science.”

This is the point where I pick up my weary banner and resume railing against faux-feminists, for I see a strong resemblance in the difficulty Popular Science faces in maintaining intelligent discourse and the apparent inability for the vast majority of those wanting to challenge misogynistic behavior to do so either appropriately or intelligently, much less both. Popular Science faces a highly politicized discussion in a field that should, ideally, operate without such ponderous constraints, much like the discussions around misogyny has devolved into an unproductive, highly-emotional flame war. Popular Science could turn off its comments and at the very least curb this behavior in their small corner of the internet; unfortunately, we have no such remedy for the writings of faux-feminists.

Permalink.

Installing missing GNOME games

The Technical Blog of James on purpleidea.com — Thu, 26 Sep 2013 03:43:50 GMT

I just realized that my Fedora 19 installation didn’t have any of the GNOME games installed by default any more. I guess there’s no love for nibbles. Here’s a quick one-liner to get them all back:

$ sudo yum search game | grep gnome | awk '{print $1}' | xargs sudo yum install -y
Loaded plugins: etckeeper, langpacks, refresh-packagekit
Package gnome-nibbles-3.8.0-2.fc19.x86_64 already installed and latest version
Resolving Dependencies
--> Running transaction check
---> Package gnome-chess.x86_64 0:3.8.3-2.fc19 will be installed
--> Processing Dependency: gnuchess for package: gnome-chess-3.8.3-2.fc19.x86_64
---> Package gnome-hearts.x86_64 0:0.3-12.fc19 will be installed
---> Package gnome-klotski.x86_64 0:3.8.2-2.fc19 will be installed
---> Package gnome-mahjongg.x86_64 0:3.8.0-3.fc19 will be installed
---> Package gnome-mines.x86_64 0:3.8.1-3.fc19 will be installed
---> Package gnome-robots.x86_64 0:3.8.1-3.fc19 will be installed
---> Package gnome-sudoku.noarch 1:3.8.1-3.fc19 will be installed
---> Package gnome-tetravex.x86_64 0:3.8.1-2.fc19 will be installed
--> Running transaction check
---> Package gnuchess.x86_64 0:6.0.3-1.fc19 will be installed
--> Finished Dependency Resolution

Dependencies Resolved

================================================================================
 Package               Arch          Version                Repository     Size
================================================================================
Installing:
 gnome-chess           x86_64        3.8.3-2.fc19           fedora        2.6 M
 gnome-hearts          x86_64        0.3-12.fc19            fedora        365 k
 gnome-klotski         x86_64        3.8.2-2.fc19           fedora        1.2 M
 gnome-mahjongg        x86_64        3.8.0-3.fc19           fedora        3.8 M
 gnome-mines           x86_64        3.8.1-3.fc19           fedora        2.7 M
 gnome-robots          x86_64        3.8.1-3.fc19           fedora        1.4 M
 gnome-sudoku          noarch        1:3.8.1-3.fc19         fedora        2.5 M
 gnome-tetravex        x86_64        3.8.1-2.fc19           fedora        1.7 M
Installing for dependencies:
 gnuchess              x86_64        6.0.3-1.fc19           fedora        2.6 M

Transaction Summary
================================================================================
Install  8 Packages (+1 Dependent package)

Total download size: 19 M
Installed size: 54 M
Downloading packages:
(1/9): gnome-chess-3.8.3-2.fc19.x86_64.rpm                 | 2.6 MB   00:04     
(2/9): gnome-mines-3.8.1-3.fc19.x86_64.rpm                 | 2.7 MB   00:05     
(3/9): gnome-klotski-3.8.2-2.fc19.x86_64.rpm               | 1.2 MB   00:05     
(4/9): gnome-robots-3.8.1-3.fc19.x86_64.rpm                | 1.4 MB   00:01     
(5/9): gnome-tetravex-3.8.1-2.fc19.x86_64.rpm                                                                                          | 1.7 MB  00:00:03     
(6/9): gnome-hearts-0.3-12.fc19.x86_64.rpm                                                                                             | 365 kB  00:00:10     
(7/9): gnuchess-6.0.3-1.fc19.x86_64.rpm                                                                                                | 2.6 MB  00:00:04     
(8/9): gnome-mahjongg-3.8.0-3.fc19.x86_64.rpm                                                                                          | 3.8 MB  00:00:11     
(9/9): gnome-sudoku-3.8.1-3.fc19.noarch.rpm                                                                                            | 2.5 MB  00:00:06     
--------------------------------------------------------------------------------------------------------------------------------------------------------------
Total                                                                                                                         1.5 MB/s |  19 MB     00:12     
Running transaction check
Running transaction test
Transaction test succeeded
Running transaction
etckeeper: pre transaction commit
  Installing : gnuchess-6.0.3-1.fc19.x86_64                                                                                                               1/9 
  Installing : gnome-chess-3.8.3-2.fc19.x86_64                                                                                                            2/9 
  Installing : gnome-klotski-3.8.2-2.fc19.x86_64                                                                                                          3/9 
  Installing : gnome-tetravex-3.8.1-2.fc19.x86_64                                                                                                         4/9 
  Installing : gnome-mines-3.8.1-3.fc19.x86_64                                                                                                            5/9 
  Installing : 1:gnome-sudoku-3.8.1-3.fc19.noarch                                                                                                         6/9 
  Installing : gnome-hearts-0.3-12.fc19.x86_64                                                                                                            7/9 
  Installing : gnome-mahjongg-3.8.0-3.fc19.x86_64                                                                                                         8/9 
  Installing : gnome-robots-3.8.1-3.fc19.x86_64                                                                                                           9/9 
etckeeper: post transaction commit
  Verifying  : gnome-chess-3.8.3-2.fc19.x86_64                                                                                                            1/9 
  Verifying  : gnuchess-6.0.3-1.fc19.x86_64                                                                                                               2/9 
  Verifying  : gnome-robots-3.8.1-3.fc19.x86_64                                                                                                           3/9 
  Verifying  : gnome-mahjongg-3.8.0-3.fc19.x86_64                                                                                                         4/9 
  Verifying  : gnome-hearts-0.3-12.fc19.x86_64                                                                                                            5/9 
  Verifying  : 1:gnome-sudoku-3.8.1-3.fc19.noarch                                                                                                         6/9 
  Verifying  : gnome-mines-3.8.1-3.fc19.x86_64                                                                                                            7/9 
  Verifying  : gnome-tetravex-3.8.1-2.fc19.x86_64                                                                                                         8/9 
  Verifying  : gnome-klotski-3.8.2-2.fc19.x86_64                                                                                                          9/9 

Installed:
  gnome-chess.x86_64 0:3.8.3-2.fc19    gnome-hearts.x86_64 0:0.3-12.fc19     gnome-klotski.x86_64 0:3.8.2-2.fc19    gnome-mahjongg.x86_64 0:3.8.0-3.fc19   
  gnome-mines.x86_64 0:3.8.1-3.fc19    gnome-robots.x86_64 0:3.8.1-3.fc19    gnome-sudoku.noarch 1:3.8.1-3.fc19     gnome-tetravex.x86_64 0:3.8.1-2.fc19   

Dependency Installed:
  gnuchess.x86_64 0:6.0.3-1.fc19                                                                                                                              

Complete!
$

This isn’t a master hack, but it’s good to think about using command line magic to do your day-to-day tasks.

A DIY Dynamic DNS service using Cloudflare

Jurgens du Toit — Thu, 26 Sep 2013 03:00:00 GMT

DynDNS was always the dynamic IP service of choice, but I could never get it to work properly, and I was always stuck with their lame domain names as I’m too cheap to pay for their serivces.

Luckily services of all kinds, including DNS Providers, have caught on to the fact that people want API’s. If there’s an API to do DNS updates, I can script a solution.

Some of my domains run off of Cloudflare which needs to overwrite your DNS. And, hey presto, they have an API. So here it is:

1
2
3
4
5
6
7
8
9
10
11
12 #!/bin/bash
curl https://www.cloudflare.com/api_json.html \
    -d 'a=rec_edit' \
    -d 'tkn=1234512345qweqwe1234512345' \
    -d 'id=12345' \
    -d 'email=jrgns@jrgns.net' \
    -d 'z=jrgns.net' \
    -d 'type=A' \
    -d 'name=home' \
    -d "content=$1" \
    -d 'service_mode=0' \
    -d 'ttl=3600'

Quick and dirty. This updates a domain (home.jrgns.net) with id 12345 with the IP address that’s passed as the first argument to the script. There’s a bunch of ways to get your external IP, my favourite is curl http://api.externalip.net/ip, but I just run this script as the postscript of my ddclient (which updates another service)

1
2
3
4
5
6
7
8
9
10 # /etc/ddclient.conf

protocol=dyndns2
use=web, web=myip.dnsomatic.com
ssl=yes
server=updates.someservice.com
login=mylogin@gmail.com
password='123456'
daemon=3600
postscript=/home/jrgns/bin/cloudflare_dynamic_dns.sh

I’m sure the same can be done with outer services such as Route 53? Has anyone tried something like this?

Breaking out of secured Python environments

Tom Forbes — Wed, 25 Sep 2013 23:02:33 GMT

A week or so ago I was browsing /r/Python and I saw a link to a website called rise4fun.com , which is a Microsoft Research project that contains a lot of cool demos and tools that you can run in your browser. The demo I was linked to was a restricted Python shell that could be used to experiment wi...

Naming Overcast

Zac Szewczyk — Wed, 25 Sep 2013 21:56:35 GMT

In a similar vein, Marco tells the story of how he came up with the name “Overcast”. I love stories like this.

Permalink.

Overcast

Zac Szewczyk — Wed, 25 Sep 2013 21:22:43 GMT

I absolutely love podcasts. Much to my girlfriend’s confusion, I might add. After Marco Arment sold Instapaper in April, after Yahoo! bought Tumblr.¹ in May, and after he sold The Magazine shortly thereafter, only in my wildest dreams did I hope his elusive next venture would lead Marco to create a podcast client. Then, last Sunday at XOXO, my dream came true.

Perhaps that’s putting it slightly melodramatically, but to say that I — and the collective internet as well — am extremely excited for Overcast would be an understatement of gargantuan proportions. I can’t wait for Overcast to come out; I plan on purchasing it on day one, as I’m sure many others will as well. Despite Marco’s modest expectations for Overcast, I would be surprised if it didn’t take the podcast client market by storm: the same design sensibilities that made Instapaper and The Magazine so popular — one need only look to the announcement Marco posted for an idea as to those proven ideals — will almost undoubtedly make Overcast similarly popular and, hopefully, a smashing success.

Good luck to you, Marco; we await Overcast’s release in eager anticipation.

↩ I can’t help but think of Ben Brooks’ article Yahoo! + Tumblr. = !! on the topic every time I think about this acquisition.

Permalink.

What Clayton Christensen Got Wrong in his Theory of Low-End Disruption

Zac Szewczyk — Wed, 25 Sep 2013 20:30:11 GMT

Another great article by Ben Thompson, this time on Clay Christensen’s interesting disruption theories and Apple’s approach in making products that both defy them and motivate people to purchase en masse. Come for the insights into Apple, and stay for his dissection of Christensen’s widely-regarded theory; this article is well worth the read.

Permalink.

InstaRank v1.0

Zac Szewczyk — Wed, 25 Sep 2013 20:19:47 GMT

I realize in my last two articles, Instapaper 5 — in which I made a number of proposals for Instapaper 5 — and Betaworks Releases Instapaper 5 — in which I conveyed my mostly positive feelings on the new release — I likely appeared very critical of Betaworks and their continued work on Instapaper. This is not the case: while I do feel a better launch strategy entailing a service-wide design overhaul and one in which they added a larger set of new features to Instapaper would have greatly helped the platform, I am not of the opinion that Betaworks did not improve the app in Instapaper 5; the impressive new InstaRank feature is a prime example of this.

That said though, I cannot help but feel that this feature, too, would have benefited from some additional development time. I may — and the blog post linked earlier confirms this suspicion — be an outlier in that I prefer to keep my Instapaper queue small, in the four to eight article range, and read in chronological order. This is a roundabout way to say that I will find little use in Instapaper’s new Popularity sorting algorithm, but not that I could not at some point in the future: a section similar to The Feature — available under “Browse” on the iPhone — populated with articles ranked using the InstaRank algorithm through which I could find and save articles to my queue for consumption at a later date would be very useful indeed.

Permalink.

The $550 iPhone 5C makes perfect sense

Zac Szewczyk — Wed, 25 Sep 2013 19:40:15 GMT

“Looking again at that chart, and with the realities of these three markets in mind, it’s not so much that the iPhone has saturated the American-style and European-style markets, and ought to focus on the Asian-style one; rather, the iPhone has saturated the high end in all three markets the high end just varies in accessibility ($200 for American-style, $650 for Asian-style). And, if you accept that the iPhone is in roughly the same competitive position in all three markets that the difference in market share is due to inherent structure of the market then it’s not at all obvious Apple should focus on the SE Asia-style market. In fact, it’s obvious they shouldn’t.”

A characteristically fascinating article by Ben Thompson explaining the logic behind Apple’s refusal to enter the low-end market as many predicted it would with a C model, and why Apple chose to position the 5C where it did in the iPhone line. His work is quickly becoming some of my favorite writing to read, alongside that of Horace Dediu and Benedict Evans.

Permalink.

In Defense of Entangled Bank

Zac Szewczyk — Wed, 25 Sep 2013 15:52:40 GMT

By now I realize this issue has largely fallen to the wayside, as its various permutations invariably do seemingly momentarily after gaining any significant traction, despite the condemnation many so readily metered out. Regardless of its fall from the collective’s fickle favor though, the event and ensuing discussions nevertheless merit some examination.

Permalink.

Yes, the percloud is "just" another Gnu/Linux distro. That's why it's a good idea

Welcome to Marco Fioretti's website! on Stop at Zona-M — Wed, 25 Sep 2013 14:30:38 GMT

The percloud is my proposal for an easy to use personal cloud, that is for a feasible alternative for the masses to Facebook, Gmail, and all similar centralized Web services and their privacy and data ownership issues. Last week I put online a 10 slides summary of how the percloud should work. This post answers a specific question that I’ve been asked many times by readers of those slides

Secrets of Closing the Sale

june.kim — Wed, 25 Sep 2013 03:00:00 GMT

Romain Dardour: Founder of Hull

Sam Solomon — Wed, 25 Sep 2013 03:00:00 GMT

Romain Dardour is the Founder and CEO of Hull, an open platform for social applications.

Get Into the Flow

The David Brownman Blog — Wed, 25 Sep 2013 03:00:00 GMT

undefined

Read the whole thing.

The correct way to use and advocate OO.o and the real reason to do it

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 24 Sep 2013 12:57:08 GMT

(this is something I wrote in 2007. Everywhere you read “OO.o” you can (and should) replace it with “Apache OpenOffice or Libre Office”. See the bottom of the page for the origin and history of the text)

Many people, schools and small businesses use OO.o only because

The actual advantages of OpenDocument

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 24 Sep 2013 12:55:32 GMT

(this is only the final part of something I wrote in 2007. Please do read the first part to understand where the text below comes from!)

A highly structured, metadata rich, application independent XML file format like OpenDocument can finally offer two huge advantages

Heidelberg Laureate Forum 2013: `Codebreaker`

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Mon, 23 Sep 2013 23:02:16 GMT

Edit: As a sort of belated Christmas present, I was made aware (thanks, Lutz!) that Alan Turing has finally been pardoned. See this article on the Universal Machine blog.

I had tremendous fun being the local expert for the movie Codebreaker that was shown as a part of the 1st Heidelberg Laureate Forum. The folks at the Klaus-Tschira Foundation set up a film festival at Heidelberg’s Karlstorkino. The idea was to show a film and get an expert to answer audience questions later on. This Tuesday, I was the expert. At first, I felt slightly out of my depth–the things I don’t know about cryptography fill multiple volumes. Still, I was able to engage the audience in a very nice discussion.

The discussion was too short to cover all the material I wanted to talk about. I thus decided to write down my thoughts. This post is more a "stream of consciousness" than a stringent account of things. My apologies.

The film

As far as I could tell, the film gave a very accurate portrait of the life of Alan Turing. The directors found the ideal balance between drama and information. The mathematical aspects were covered correctly (insofar as they were any). There was one glaring mistake, though: The movie depicted a “Turing machine” that was unable to write data. But being able to write and read data is the whole point of the machine!

Furthermore, the film mentioned an official apology of the British government concerning Turing’s treatment in the 1950s. I thought that this was still an ongoing effort, so I searched for some reports:

Also, the film slightly misrepresented how the Enigma was deciphered. It was not solely Turing’s genius, but a team effort of Polish scientists that ultimately led to the machine’s downfall. I guess the film tried to convey that Turing’s work was superb and without equal, so it makes sense to present the audience the one codebreaker. Don’t be fooled, though–even Turing collaborated with other scientists.

A last grievance of the film is the portrayal of the scientific community as such. The film used descriptions such as “a bunch of eccentric mathematicians” and talked about some Turing’s eccentric behaviour (wearing a Gas mask because of his hay fever, hiding silver etc.). This narrative device is a nice way of getting a chuckle out of the audience, a sort of comic relief maybe. But it is also very, very trite. These sorts of descriptions seem to strike a nerve with me. If people (whatever their profession) are characterized as brilliant, outstanding, and so on, there seems to be the tendency to ascribe them negative traits such as eccentric, insane, and so on. Is this a crude way of trying to balance the scales somehow? Something like “Turing was brilliant, but his genius came with a large price! (insert dramatic sound here)”. Here’s my protip for all directors: If you stop painting characters larger-than-life, you won’t have to resort to these cheap tricks.

To be fair, the movie does not do this a lot, so I am definitely overreacting here. Still, if you, dear reader, watched that movie without knowing many mathematicians or computer scientists, please don’t believe this simple characterization. As Neal Stephenson put it: We are all geeks now

Would you like to know more?

This is where the homework starts. I can recommend several books on Turing and cryptography. They are covered in no particular order:

Neal Stephenson: Cryptonomicon

This is by far my favorite book and in the past 10 years, I have read it numerous times. I even borrowed the Tolkien characterization of people. But I am getting ahead of myself. Without too many spoilers, Cryptonomicon takes you on a joyride through time and space. There are at least three different stories, all connected by pivotal events in the book. The main theme is about cryptography and mathematics. In the dawn of World War II, some mathematicians (including Turing, of course), talk about the future of mathematics. A young man decides to join the marines. War erupts and in general, all hell breaks loose. Fast forward 50 years. Two high-tech entrepreneurs want to install high-speed submarine communications cable in the Philippines.

It does not sound remotely believable, but Neal Stephenson manages to mash these stories into a consistent narrative: Characters you can relate to, science, technology, history, …

A fair warning: Neal Stephenson likes to digress. A lot. You think you know digressions (maybe from reading this blog?), but compared to Neal Stephenson, everything else I have every read so far pales. So go buy the book already!

George Dyson: Turing’s Cathedral

This book covers the historical perspective quite well. It’s a heavy read if you are unfamiliar with the material, but it’s well worth it in my opinion. The book does not solely focus on Turing, but more on the history of computers in general. Contrary to the title, the main “character” is “John von Neumann”.

Charles Petzold: Code

By far the most readable and accessible explanation of how computers actually work. This book is really hands-on. Charles Petzold has the remarkable talent of explaining the basic concepts of computers to anyone. I am not a hardware guy myself and even I was tempted to build my own mechanical computer afterwards. This is the book I am forcing people in my family to read so that they can understand that there is nothing magical about computers after all (for balance, I am reading car manuals in order to understand that there is nothing magical about cars).

Simon Singh: The Code Book

This book focuses on cryptography. Simon Singh does a very good job of covering the history of this science, starting from simple substitution ciphers, and ending with quantum computing. There is also a good explanation of the “RSA algorithm”.

Taking it to the next level

If you are really, really serious about doing cryptography, nothing beats the two bibles written by Bruce Schneier: Applied cryptography and Practical cryptography. However, these books require a solid understanding of imperative programming languages, preferably C or C++. Nothing for the faint of heart. A more accessible introduction to cryptographic algorithms is the CipherSaber project. Here, your goal is to create your own implementation of the RC4 algorithm. Give it a try!

Shameless self-promotion

If you can read German, why not take a look at my slides about cryptography. The target audience for this talk did not have any in-depth mathematical knowledge, so I tried to keep everything very accessible.

I will probably update this post if I remember anything else that might be of interest. Thanks for bearing with me!

Bittorent sync for repository mirroring

The Technical Blog of James on purpleidea.com — Mon, 23 Sep 2013 05:06:28 GMT

Theron Conrey writes about using:

BitTorrent Sync as Geo-Replication for Storage

We got a chance to talk about this idea at Linuxcon. I'm not entirely convinced there aren't some problem edge cases with this solution, but I think it will be hard to tell as long as the BitTorrent sync library is proprietary. I did come up with a special case of Theron's idea that I believe could work well.

The special case uses the optimization that the synchronization (or file transferring) is unidirectional. This avoids any coherency complications involved if both sides were to write to the same file. Combined with the BitTorrent protocol, this does what normal torrent usage does, except with BitTorrent sync, we’re looking at a folder full of files.

Creativity: Taj Mahals and Ant-Hills

Honest Musings — Sat, 21 Sep 2013 05:51:05 GMT

An Ant Hill is a masterpiece of nature. Hidden from the human eye it grows intricate, complex and deep. It’s a beautiful structure crafted by one of the most humble creatures. But in the world of Colosseum’s and Eiffel’s tower it is generally overlooked. How do we define creativity in such a context? Is creativity … Continue reading

Aboard the Nautilus

Nemo's Home — Sat, 21 Sep 2013 03:00:00 GMT

I’d done a post on this a long time back (2009), detailing what all softwares I use on a daily basis. This is an update to that post.

Since the last post, I’ve moved on to using Linux, using Elementary OS as my primary OS. Over the time period this post was written, I’ve shifted from using Cinnamon to Openbox and finally to elementaryOS’s pantheon as my Desktop Manager. I’m thinking of switching to Arch Linux, just to get a faster experience. I use Synapse as my application launcher, because its much faster than anything else out there.

For most of my web browsing needs, I rely on Google Chrome Stable and a daily build of Chromium (v31 as of now) for most of my work. I switch between them all the time. I use Firefox (stable) only to test out my projects from time to time.

The current editor I use is Sublime Text. It is everything you need, and much more. I’m still to get started using its build system, and its plethora of packages; but its still an excellent choice for a daily use editor. On the command line, I use Vim, git (with SCM Breeze), fasd and tig, which is an excellent git interface on the command line.

I listen to music on my own browser-based music player, called Muzi, YouTube and GrooveShark.

For my terminal needs, I use Gnome-Terminal. I use Byobu to manage my session, and often connect to it from other computers as well. Its an excellent multiplexer that fits in my workflow really well.

I use Imo.im on both the Desktop and my tablet to chat. I occasionally use ReText for editing markdown files. I use RedShift on my laptop and f.lux on my iPad to help me sleep better. I recommend it to everyone who is suffering from eye-strain or wants to sleep better.

On the browser, my most visited sites would be Hacker News (via hckrnews.com), WorkFlowy for managing my to-do list and GitHub on a daily basis for most of my projects.

Hardware

I own a old Nokia X3-02, and will be upgrading to a Firefox OS Phone soon enough. I use a Dell Inspiron 1545 as my personal machine. I also use an iPad 2 (with 3G) on a daily basis (mostly for reading). I also own a Dayan Zhanchi 3x3 and a 5x5 shengshou speed cube.

iPad Apps

The must have iPad apps for me are Chrome, imo, and iBooks. I have installed Mailbox alongside GMail, and haven’t used GMail since I installed it. I sometimes write stuff using Plaintext, and sketch using Paper. I read my RSS feeds using Newsify and Feedly.

Extensions

Chrome Extensions that I use on a daily basis include Chime for wonderful notifications (highly recommended), Ghostery for getting a tracker-free internet , HTTPS Everywhere to keep me secure, LastPass to manage passwords and Stylish for customizing the looks of various websites.

Dream Setup

My dream setup would consist of a lightweight Ubuntu Laptop that I can carry around that still has lots of processing power and battery life. I’ll prety much be satisfied by any high-end Android phone as long as it has a decent battery life.

Simplifying the blob downloader

TOGoS's Project Log — Fri, 20 Sep 2013 21:13:37 GMT

Gluster Community Day, Thursday

The Technical Blog of James on purpleidea.com — Fri, 20 Sep 2013 19:23:12 GMT

I’m here in New Orleans hacking up a storm and getting to meet fellow gluster users IRL. John Mark Walker started off with a great “State of the GlusterFS union” style talk.

Today Louis (semiosis) gave a great talk about running glusterfs on amazon. It was highly pragmatic and he explained how he chose the number of bricks per host. The talk will be posted online shortly.

Marco Ceppi from Canonical gave a talk about juju and gluster. I haven’t had much time to look at juju, so it was good exposure. Marco’s gluster charm suffers from a lack of high availability peering, but I’m sure that is easily solved, and it isn’t a big issue. I had the same issue when working on puppet-gluster. I’ve written an article about how I solved this problem. I think it’s the most elegant solution, but if anyone has a better idea, please let me know. The solutions I used for puppet, can be applied to juju too. Marco and I talked about porting puppet-gluster to ubuntu. We also talked about using puppet inside of juju, with a puppetmaster, but we’re not sure how useful that would be beyond pure hack value.

What is Pulp, Candlepin, Foreman, and Katello

Justin Garrison's Homepage — Fri, 20 Sep 2013 03:00:00 GMT

I have been working with some of the above products at work for the past couple of weeks and I just cam

A look back at the dotcom bubble

Jason Eckert's Website and Blog — Fri, 20 Sep 2013 03:00:00 GMT

Just over a decade ago, the dotcom bubble burst, and for the next 3-4 years, the IT industry (and IT job market) was in a slump.

During the last presentation I did for Game On 2.0 on August 29th, one of the audience members asked me what the dotcom bubble actually was. I supplied the standard Web answer of “overspending in the IT market” and “mismanagement of IT resources” (or something like that).

GoDaddy Purchased the Domain Name Market Today

Kevin Ohashi — Fri, 20 Sep 2013 02:07:18 GMT

Today is an interesting and perhaps historic day in the domain industry. GoDaddy has acquired Afternic and SmartName from Name Media. Name Media is probably best known for the BuyDomains brand. They own one of the largest portfolios of domain names in the world at nearly 1 million domains.

GoDaddy is the largest player on the consumer side of the domain market by a wide margin. However, they aren't the biggest player and/or have serious competition in a lot of the secondary and domainer markets.

Domainer / Secondary Markets

Market	Large Players
Domain Registration	GoDaddy
Selling Domains (Secondary/After Market)	Sedo, Afternic, BuyDomains, GoDaddy, DomainNameSales
Expired Domains	NameJet, SnapNames, Pool, GoDaddy
Domain Parking/Monetization	InternetTraffic, Google, Yahoo, Sedo, (many more)
Domain name Conglomerates	Demand Media, Marchex, GoDaddy, Name Media, Oversee

Why Most Of These Markets Don't Matter Anymore

The expired domain names market is drying up as companies switch to pre-release agreements. With pre-release, the registrar where the domain is kept automatically sells off the domain and there is no competition. As GoDaddy grows bigger, they will capture more of the this market automatically in the long run.

Domain Parking and monetization has seen a pretty steady decline since about 2007-2008. Consolidation is happening, the market is shrinking. The vested interests are large portfolio holders, which GoDaddy doesn't have like all of the other conglomerates.

The Conglomerates with the exception of GoDaddy all have their own domain name portfolios. They are focused around monetizing their assets rather than customers. Almost all the conglomerates have failed to see major growth (Demand Media just turned its first profit in 2012).

What Does Matter?

With GoDaddy's acquisitions from Name Media today they have taken a serious foothold in the secondary market. Afternic is one of the largest markets and GoDaddy is probably on equal ground in terms of selling domain names from Premium Listings (pre-acquisition), although they don't publish any numbers that I could find. If we were to assume Sedo, Afternic and GoDaddy were similar in size, GoDaddy just became the dominant player by 2:1.

Why does it matter?

GoDaddy's strategy has long been economies of scale and cross-promotion/cross-selling products/services. They dominate the consumer side of the market and have the audience to sell products to. Now they own the market for secondary sales as well. They already charge a minimum 32% commission to sell a domain name with them. My intuition tells me they've struggled with getting the best inventory and streamlining the process to their liking. This isn't the first time we've seen them partner up to sell secondary market domain names, they tried it once before with Domain Distribution Network but there hasn't been much talk about the results. There was even a short termination between the companies over the deal. This deal expired on June 7, 2013 according to DNN. I could find no evidence of it being renewed.

Meanwhile, Afternic has solved this problem. AfternicDLS has a deals with many of the biggest registrars: Network Solutions, Register.com, Enom, Moniker, Name.com, and more. This solves the listing and selling problem. Their current Premium Listings only work for domain names at GoDaddy. A lot of domainers don't use GoDaddy and don't want to put their domain names there. Acquiring Afternic solves the technical and business problems that may have blocked GoDaddy in previous attempts to gain more of the secondary market.

What About SmartName?

I am not as sure about the SmartName play for GoDaddy. They could be trying to make a more serious run into the domain monetization space with a parking platform. They could be looking to upgrade their auction platform. Both of these could improve their bottom line, and it makes them more attractive as a larger one-stop shop for domain services.

Conclusion

GoDaddy is now the biggest player in the domain name sales channels both for new registrations and selling in the secondary market. With the upcoming release of new gTLDs, they couldn't be better positioned to sell more domain names and make more money. It doesn't hurt that they offer fairly comprehensive offerings for business owners such as web hosting, email, marketing and more. Economies of scale are real and GoDaddy is taking advantage of them more than anyone else in the business.

Consumers may actually be the big winner here. If this gets executed well, the customers who use GoDaddy will get access to a larger inventory of domain names listed on the secondary market and purchasing them may become as easy as registering a new domain name.

Update

(9/20/2013) I made a mistake with saying the auction platform was Smart Names, it's actually Afternic. Also, someone linked me Godaddy's auction stats. They don't give dollar values, only sales volume. So it's still apples to oranges to pears with Sedo/Afternic/GoDaddy.

I have also received a lot of criticism because of the company in question comes off in a positive light. My startup tracks GoDaddy's reviews and it's overwhelmingly negative. I understand a lot of people don't like them for a multitude of reasons. That being said, the point of this article was to acknowledge a very prudent business move by them. I went into this open minded and came out surprised. I think this is a win for consumers in the short to medium term because it's reducing the friction and pain involved with buying domains in the secondary market. It makes it far more accessible and easy than it ever was before with a brand consumers recognize. Consolidation of the secondary domain market also puts a downward pressure on domain prices if it stays integrated as an option versus buying new registrations. The consumer who is thinking about spending $10 is far less likely to spend $100,000 instead. But $100, $500, $1,000 may be more reasonable and likely to induce a sale on the secondary market.

Coronado High

Zac Szewczyk — Thu, 19 Sep 2013 18:24:16 GMT

Every so often I like to take a break from the whole technology gamut and read something else. Preferably, something exceptional like Coronado High from The Atavist. Telling the fascinating origin story of what grew from a few California kids running drugs to a multi-million dollar narcotics empire, Coronado High is much more than a fantastically-written, gripping tale of a bygone era. I wouldn’t dream of spoiling it for you though: this is one of those articles you just can’t afford to miss.

Permalink.

You must not worry about Santa

Zac Szewczyk — Thu, 19 Sep 2013 17:26:19 GMT

Every once in a while, Letters of Note posts something great, a letter I just have to share. This is one such letter. For me, the last one was a speech William Safire wrote for President Nixon in preparation for a disaster during the moon landing; perhaps the best speech I have ever read.

Permalink.

Betaworks Releases Instapaper 5

Zac Szewczyk — Thu, 19 Sep 2013 17:01:13 GMT

Last week I acquired access to the Instapaper beta prior to its launch alongside iOS 7. I chronicled that story in I Finally Understand Bias. Since then, I have put off writing about the beta for a number of reasons: as a beta, the onus would have been on me to explain every single aspect of the new design or include numerous screenshots. Unlike the Federico Viticcis of the world, I did not find that prospect particularly appealing. More importantly though, I did not — do not — consider the app ready for widespread use, and at the very least not worthy of a version increment. iOS 7 or not, I am of the opinion that Betaworks should have forgone releasing Instapaper 5 quite so soon.

Permalink.

Inspecting .NET applications with ILSpy

Tom Forbes — Thu, 19 Sep 2013 15:40:40 GMT

Every once in a while I come across an application that is so comically insecure that I feel the urge to blog about it. The application in question is a .NET application to manage care homes and provide a Medical Administration Record for residents. Staff login to the app using a username and passwo...

I Finally Understand Bias

Zac Szewczyk — Thu, 19 Sep 2013 09:02:39 GMT

Last week, amidst the frenzy preluding Apple’s impending iPhone event, I posted an article titled Instapaper 5. I did not have early access to a beta or any insight as to the direction Betaworks planned on taking the service; instead, I merely wished to put forth a possible launch strategy for the upcoming update and outline a number of improvements I had been considering. I posted the article with minor expectations, thinking it would attract the usual eight to twelve pageviews; what came next took me completely by surprise.

Permalink.

An Amalgamation of Reviews

Zac Szewczyk — Thu, 19 Sep 2013 08:57:48 GMT

Yesterday, Apple lifted the press embargo on both iPhone and iOS 7 reviews in conjunction with the operating system’s release to the general public. Like most of the internet, I got little to no work done once the reviews and new apps started rolling out. I did, however, succeed in pulling together this list and brief overview of the best reviews I came across throughout the day, for your reading pleasure.

Permalink.

Linuxcon day three, Wednesday

The Technical Blog of James on purpleidea.com — Thu, 19 Sep 2013 02:59:28 GMT

After hacking away on Monday and Tuesday and meeting fellow nerds IRL, I’ve landed even more changes to puppet-gluster. My git master branch now sits at 47 commits.

$ git clone https://github.com/purpleidea/puppet-gluster.git
Cloning into 'puppet-gluster'...
remote: Counting objects: 317, done.
remote: Compressing objects: 100% (144/144), done.
remote: Total 317 (delta 187), reused 275 (delta 148)
Receiving objects: 100% (317/317), 82.17 KiB | 12.00 KiB/s, done.
Resolving deltas: 100% (187/187), done.
$ cd puppet-gluster/
$ git log | grep '^commit' | wc -l
47
$ git log | head
commit <a href="https://github.com/purpleidea/puppet-gluster/commit/fa3fd2eb4bab499031274e0918a40e7a99fe0086">fa3fd2eb4bab499031274e0918a40e7a99fe0086</a>
Author: James Shubin <<em>hidden</em>>
Date:   Wed Sep 18 17:53:13 2013 -0400

    Added fancy volume creation.
    
    This moves the command into a separate file. This also adds temporary
    saving of stdout and stderr to /tmp for easy debugging of command
    output.

As you can see above, volume creation is now “fancier” and more robust. In case things go wrong, it’s easy to get fast access to gluster command line output (saved in /tmp/), and the volume creation commands are individually stored in your puppet-gluster working directory. Usually this is /var/lib/puppet/tmp/gluster/, and each volume creation command is in the volume subdirectory.

The Feminist who Cried Wolf

Zac Szewczyk — Thu, 19 Sep 2013 02:14:02 GMT

Early yesterday evening I saw co-editors Alexia Tsotsis and Eric Eldon post an apology for an alleged inappropriate presentation made at TechCrunch Disrupt. Dismissing the short article as a response to yet another activist blowing an innocuous joke way out of proportion though, I paid it little attention until coming across Gawker’s coverage of the event later that evening. Like an article taken directly from The Onion’s homepage, I read about and subsequently watched two incredibly inappropriate presentations with varying degrees of disbelief throughout. More than the actual presentations though, because God only knows enough will be written about them in the coming days, I would like to focus on my original sentiment when I came across TechCrunch’s apology for failing to screen the exhibitions.

Permalink.

Linuxcon day two, Tuesday

The Technical Blog of James on purpleidea.com — Thu, 19 Sep 2013 02:05:05 GMT

Continuing on from yesterday, I’ve met even more interesting people. I chatted with Dianne Mueller about some interesting ideas for gluster+openshift. More to come on that front soon. Hung out with Jono Bacon and talked a bit about puppet-gluster on Ubuntu. If there is interest in the community for this, please let me know. Thanks to John Mark Walker and RedHat for sponsoring me and introducing me to many of these folks. Hello to all the others that I didn’t mention.

Linuxcon day one, Monday

The Technical Blog of James on purpleidea.com — Thu, 19 Sep 2013 01:32:16 GMT

I’m here in New Orleans at Linux Con, hacking on puppet-gluster and talking to lots of interesting folks. I’ve met gluster hacker Theron Conrey, and my host John Mark Walker, Fedora and Raspberry Pi experts Spot and Ruth Suehle, and many others too.

The hotel is very nice. The bathroom sink has two taps of course, but both of them are hot. The New Orleans heat is probably the cause of this.

I’m hacking at full speed to get some new features and testing in before my talk on Thursday. I’ve been reworking the simple firewall support in my puppet module. For those that want automated and correct firewall configuration, expect some improvements soon.

That line between being cocky and humble

Zac Szewczyk — Wed, 18 Sep 2013 16:16:49 GMT

My introduction to this article, and the piece I personally found more interesting, was the response Casey Liss wrote. As I read both articles, I thought of something Patrick McKenzie said quite some time ago in Don’t Call Yourself a Programmer, and Other Career Advice: “You radically overestimate the average skill of the competition because of the crowd you hang around with.” While Patrick said that in reference to the perception of one’s own skill set, it is just as applicable here.

Permalink.

Staying Afraid

Zac Szewczyk — Wed, 18 Sep 2013 15:12:51 GMT

When Matt Gemmell publishes his novel, I will buy it regardless of the genre. With talent like this, how could I afford to miss it?

Permalink.

Protip: Faster Ruby Tests with DatabaseCleaner and DatabaseRewinder

Fred Wu (@fredwu) — Wed, 18 Sep 2013 09:50:00 GMT

Persistence

Josh Thompson — Wed, 18 Sep 2013 03:00:00 GMT

Persistence. It’s worth far more than any finite sum of money. Actually, it’s worth more than an unlimited amount of money, because an unlimited amount of money would complicate my life (and probably yours) far more than we can possibly imagine. Persistence. I keep trying to think some people are born with it, and others (me) didn’t. Or I prefer to think that it can be had only if it were shaped properly by my parents from a young age. If that didn’t work, it’s sure not through lack of trying. (Thanks for not disowning me at 17, mom and dad!).

I can easily start fifteen different projects. Statistically, thirteen of them are crap. Two of them may have weight. I’ll make motions to work on both for a little while, and then I give up. I just drop it. I’ve done it a lot of times. It’s not going to stop until I make it stop.

I’ve spent at least a few hours learning over a dozen different things in the last few months, but have not stuck with many of them. This may be good or it may be bad. I certainly can’t tell which of my fifteen ideas are crap, and it would behoove me to drop the bad ones, or I could be demonstrating a lack of persistence and stick-to-it-iveness.

It’s refreshing to not be required to all this sorted out. I thought once I graduated college I’d not be wrestling with this stuff.

Hah.

Sonderklasse

Zac Szewczyk — Wed, 18 Sep 2013 00:48:47 GMT

Craig Hockenberry making a very apropos comparison between the Mercedes-Benz S-Class line and Apple’s iPhone 5S. Perhaps just as interesting as his thoughts on the iPhone, however, were his thoughts on this particular vehicular product line, however brief.

I always find a writer traditionally steeped in technology taking a step in to the world of cars disproportionately fascinating. That meticulous nature, attention to detail, and, most important of all, the ability to take in to account the intangibles — aspects of a car that don’t appear on a feature checklist — make for an invariably interesting read.

Permalink.

Setting a default order for Doctrine 2 / Symfony 2

Jurgens du Toit — Tue, 17 Sep 2013 03:00:00 GMT

Usually when you’re working with data you expect some kind of default ordering. It might be the primary key, or, more commonly, the data set will be ordered by a timestamp field or the data’s most important property. In Doctrine you can create custom repository classes to tweak queries to your liking:

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18 <?php
// src/Acme/StoreBundle/Entity/ProductRepository.php
namespace Acme\StoreBundle\Entity;

use Doctrine\ORM\EntityRepository;

class ProductRepository extends EntityRepository
{
    public function findAllOrderedByName()
    {
        return $this->getEntityManager()
            ->createQuery(
                'SELECT p FROM AcmeStoreBundle:Product p ORDER BY p.name ASC'
            )
            ->getResult();
    }
}
?>

This is all fine and dandy, but do you really want to repeat yourself everytime you write a query for a model that will almost always be ordered by the same field? Or get caught out by calls to default repository methods that don’t use the ordering you like? No, you don’t. Enter this piece of code:

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21 <?php
// src/Acme/StoreBundle/Entity/ProductRepository.php
namespace Acme\StoreBundle\Entity;

use Doctrine\ORM\EntityRepository;

class ProductRepository extends EntityRepository
{
    public function findBy(array $criteria, array $orderBy = null, $limit = null, $offset = null)
    {
        // Default Ordering
        $orderBy = $orderBy === null ? array('added' => 'desc') : $orderBy;

        // Default Filtering
        if (array_key_exists('active', $criteria) === false) {
            $criteria['active'] = 1;
        }
        return parent::findBy($criteria, $orderBy, $limit, $offset);
    }
}
?>

The findBy method of the EntityRepository class is the method used by most (if not all) of the the repository methods that fetch data. This includes findBy methods where you can specify an arbitrary column and value:

1
2
3
4 <?php
// find a group of products based on an arbitrary column value
$products = $repository->findByPrice(19.99);
?>

So to ensure a default ordering, we override this method and check if an orderBy clause has been set. If not, set it to our default ordering — in this case by the added field, descending. For good measure we also add default filtering — the active field needs to equal 1. Once that’s done, call the parent method with the default values set.

Easy as π

The iPhone is Apple Doubling-Down On What It Does Best

Zac Szewczyk — Mon, 16 Sep 2013 19:54:00 GMT

Just before the iPhone event last week, I linked to an excellent piece by Ben Thompson titled Thinking About iPhone Pricing. A day after the event, he posted another article, Two Minutes, Fifty-Six Seconds, this time explaining Apple’s reasoning behind pricing the 5C at $549. I really enjoyed both articles; Ben Thompson’s intelligence, insight, and storytelling ability is only rivaled by a few.

Permalink.

Introducing SingleBugs the Bug Tracker for Single Developers

Ben E. C. Boyter — Mon, 16 Sep 2013 04:50:08 GMT

Introducing the first beta release of SingleBugs, the bug tracker aimed at single/solo developers. Are you a solo developer? Do you find setting up Mantis/Fogbugs/Bugs.net/et.al too complex and a waste of your time? Do you want a single solution that easily syncs and backs up between your machines? Try SingleBugs.

Guaranteed to save you time and money setting up a bug tracker. Guaranteed to be the fastest bug tracker you have ever used.

List.clear() throws UnsupportedOperationException

Craig Pardey — Mon, 16 Sep 2013 03:00:00 GMT

Consider the following code

String[] s = new String[]{""};  
List<String> list = Arrays.asList(s);  
list.clear();

All looks good, right? When you run it you get:

java.lang.UnsupportedOperationException  
	at java.util.AbstractList.remove(AbstractList.java:144)  
	at java.util.AbstractList$Itr.remove(AbstractList.java:360)  
	at java.util.AbstractList.removeRange(AbstractList.java:559)  
	at java.util.AbstractList.clear(AbstractList.java:217)

This is because Arrays.asList(array) returns a fixed-size list backed by the specified array. Fixed-size being the operative word.

Thoughts and Observations on Today's iPhone 5C and 5S Introduction

Zac Szewczyk — Sun, 15 Sep 2013 18:15:09 GMT

I’m a little late to the party, I admit, but John Gruber’s thoughts and observations concerning the iPhone event last week are just as interesting now as they would have been Tuesday afternoon.

The interesting trend, I think, as I work through my Instapaper queue from last week reading various writers’ opinions, is everyone recognizing Apple’s strategy with the 5C as exactly what it is: a marketing gimmick designed to give them cause to market both this year’s top model and last year’s hardware.

Permalink.

Horace Dediu on the Alphabet

Zac Szewczyk — Sun, 15 Sep 2013 15:56:44 GMT

In the first in a wonderful series of articles, C is for Cognitive Illusion, Horace discussed the positioning of the iPhone 5C, how it differed from past years’ portrayal of the “n-1” product, and what this means for the iPhone line:

Permalink.

700 Million Devices

Zac Szewczyk — Sun, 15 Sep 2013 13:09:38 GMT

Far be it from me to step on Horace Dedeiu or Benedict Evan’s toes in my “analysis”, if you could call it that, of this graph Horace posted yesterday, but I do believe it tells us something interesting about how successful Apple believes the iPhone 5C will be.

In previous quarters, as Horace’s trend shows, the iPhone grew at an increasing rate with each successive launch. That is, Apple’s device sales did not increase linearly with each new phone, but increased in growth rate upon each release giving a nice, curved ramp in cumulative devices sold. At the far right of this trend we have Tim Cook’s claim that iPhone shipments will reach 700 million by October, indicating a sharp uptake in iPhone sales from the norm.

The interesting question here is why he expects this jump. Every other year when Apple introduced revolutionary phones, the company forecasted no such spike. So given this, we cannot attribute such a jump to the 5S no matter how great a device. The credit, instead, must go to the 5C, which marked a distinct change in Apple’s product marketing; no other significant change occurred to which we can attribute this increase.

It’s interesting to see the level of faith Tim Cook has in this new device line. Whether that faith will bbe justified, however, remains to be seen.

Permalink.

Obrigado Deny!

duncanlock.net — Sat, 14 Sep 2013 01:32:56 GMT

I’ve recently been corresponding with Denny Dias, from Brazil, who’s converted his blog over to Pelican - and we’ve been helping each other out a bit with building themes and whatnot.

He’s written up his conversion & theme building process - and was generous enough to credit me after he borrowed some of my theme’s logic, from this blog’s GitHub repo.

As he’s such a nice guy - and as I’ve just borrowed his tagsort jinja filter for my blog’s tag page, I though I’d return the favour - cheers Deny! :)

Embedding Freetype for iOS projects

Whacky Labs — Fri, 13 Sep 2013 20:58:54 GMT

Freetype is a font library written in C. From OpenGL’s point of view, it creates alpha texture on the fly for any font size for any string.

Step 1: Embedding the original freetype source to the code is some real pain in the ass. Fortunate for us, one guy has done that task and released the code on github. https://github.com/cdave1/freetype2-ios. So, step 1 is to check out that code.

Step 2: Create your new project and add the project downloaded from step 1 to your project.

Check that the Xcode must have created two schemes for you.

Step 3: Go to the your Project Settings, select your target and click on ‘Build Phases’. Under ‘Target Dependencies’ add the static library from the freetype2 project.

This is going to build the static library for you, without you having to explicitly build it.

Step 4: Go to ‘Link Binary with Libraries’ and add the static library.

This will build the libFreetype2.a and put it inside the products directory.

Step 5: Next, we need to add the freetype header files in the products directory. Why? Because, the Xcode projects are configured to look for header files inside the products directory automatically, without us having to specify the search path. Also, if in future we make some changes to the freetype project header files (very unlikely) the changes will be automatically updated in our products directory.

Now, open the freetype2 Project settings and go to ‘Build Phases’. Click ‘Add Build Phase’ and ‘Add Copy Files’

Step 6: Change the ‘Destination’ to ‘Products Directory’. Now, this is the part where Xcode sucks, we need to copy our header files from the freetype2 project, but doing so flattens the copied directory structure.

One way to fix this is to remove the include files from the freetype2 project and add them again as ‘Folder reference’

Step 7: Drag the include folder from freetype2 project to the ‘Copy Files’ phase.

If you’ve followed everything correct to this point, you project should just build fine. It should compile the freetype target, copy the header files and then compile and link your project.

The products directory should look something like

For final testing, try adding the following lines of code to your main.m file and compile the code:

#import <UIKit/UIKit.h>
#import "AppDelegate.h"
#import <ft2build.h>
#import <freetype/freetype.h>
#import <assert.h>
 
void test_freetype() {
    FT_Library library;
    FT_Error error = FT_Init_FreeType(&library);
    assert(!error);
    FT_Done_FreeType(library);
}
 
int main(int argc, char *argv[])
{
    test_freetype();
 
    @autoreleasepool {
        return UIApplicationMain(argc, argv, nil, NSStringFromClass([AppDelegate class]));
    }
}

Troy

🦉 olshansky 🦁 — Fri, 13 Sep 2013 20:02:42 GMT

Olshansky's review of Troy

World War Z

🦉 olshansky 🦁 — Fri, 13 Sep 2013 16:53:13 GMT

Olshansky's review of World War Z

The New Kid on the Block

Zac Szewczyk — Fri, 13 Sep 2013 10:50:21 GMT

Since its debut yesterday virtually everyone has lauded Apple for introducing the iPhone 5C. (I refuse to acknowledge Apple’s ridiculous naming convention; 5c? Please. If I wanted to look like a five year old I could forget to proofread my articles on my own. And I’m not the only one miffed at Apple’s new standard: Lex Friedman, in a tweet yesterday: “If Apple is lowercasing the S and C..., I’m going to start capitalizing the ”i“: IPhone 5s. That’s better.”) Hailed as the elusive midrange offering from a traditionally high-end company, Apple received great praise over a move many see as a way to increase device sales by capturing the low end. I have a number of issues with that sentiment.

Permalink.

Goodbye Dropbox

Zac Szewczyk — Fri, 13 Sep 2013 10:48:44 GMT

“You hold the encryption keys, which means the NSA holds the keys too. I don’t care for that. Thanks for all the great service along the way.”

I really enjoy Ben Brooks’ writing — Tumblr. + Yahoo! == !! is probably one of my favorite articles ever — but I can’t help but feel he’s gone off the deep end with this one.

Permalink.

Disabling muting while typing in Google hangouts

CRAIG KERSTIENS — Thu, 12 Sep 2013 23:55:56 GMT

Google hangouts is awesome, its my preferred method for most audio/video calls these days. When running a group call I often dial into a separate phone if I have a better phone available for the group. It also got around the annoyance that when you are typing google automatically mutes you. This for most people is pretty subpar. While dialing in to the hangout can still be nice, you don’t have to do so to get rid of the annoying muting while typing. To fix such simply open up your terminal and run:

 defaults write com.google.googletalkplugind exps -string [\"-tm\"]

This clever hack discovered courtesy of @timtyrrell passed along to me by @mattmanning and @blakegentry

Form Over Function & The New iPhone

Untrod — Thu, 12 Sep 2013 15:57:00 GMT

I probably found this more profound than it really is, but Matt Buchanan said it well in the New Yorker, regarding the latest iPhone announcements:

Fundamental technology, like manufacturing processes for processors and imaging sensors and displays, have evolved to the point that the basic shape and sense of a …

North West Triathlon 2013

Caius Theory — Thu, 12 Sep 2013 13:00:00 GMT

“Fun” triathlon (super sprint distance) done in Nantwich. First ever Triathlon, 7 months after starting training properly.

200m swim: 00:04:08

Despite feeling like I was going super slow. Brine pool was fairly nice.

20km bike: 00:52:31

Pretty happy with that, strongest discipline for me anyway.

2.5km run: 00:21:08

Walked 2/3s of it at a guess. Really hate running, so happyish with this. Need to work on running over the winter.

Total: 1h 17m 47s

BOOYA. Enjoyable. Pretty damn happy with that (had a vague plan of being under 1h30m. So yay.)

Advanced Oracle Troubleshooting Guide – Part 11: Complex Wait Chain Signature Analysis with ash_wait_chains.sql

Tanel Poder Blog — Thu, 12 Sep 2013 04:23:35 GMT

Here’s a treat for the hard-core Oracle performance geeks out there – I’m releasing a cool, but still experimental script for ASH (or poor-man’s ASH)-based wait event analysis, which should add a whole new dimension into ASH based performance analysis. It doesn’t replace any of the existing ASH analysis techniques, but should bring the relationships between Oracle sessions in complex wait chains out to bright daylight much easier than before.

You all are familiar with the AWR/Statspack timed event summary below:

Similar breakdown can be gotten by just aggregating ASH samples by the wait event:

SQL> @ash/dashtop session_state,event 1=1 "TIMESTAMP'2013-09-09 21:00:00'" "TIMESTAMP'2013-09-09 22:00:00'"

%This  SESSION EVENT                                                            TotalSeconds        CPU   User I/O Application Concurrency     Commit Configuration    Cluster       Idle    Network System I/O  Scheduler Administrative   Queueing      Other MIN(SAMPLE_TIME)                                                            MAX(SAMPLE_TIME)
------ ------- ---------------------------------------------------------------- ------------ ---------- ---------- ----------- ----------- ---------- ------------- ---------- ---------- ---------- ---------- ---------- -------------- ---------- ---------- --------------------------------------------------------------------------- ---------------------------------------------------------------------------
  68%  ON CPU                                                                          25610      25610          0           0           0          0             0          0          0          0          0          0              0          0          0 09-SEP-13 09.00.01.468 PM                                                   09-SEP-13 09.59.58.059 PM
  14%  WAITING SQL*Net more data from client                                            5380          0          0           0           0          0             0          0          0       5380          0          0              0          0          0 09-SEP-13 09.00.01.468 PM                                                   09-SEP-13 09.59.58.059 PM
   6%  WAITING enq: HW - contention                                                     2260          0          0           0           0          0          2260          0          0          0          0          0              0          0          0 09-SEP-13 09.04.41.893 PM                                                   09-SEP-13 09.56.07.626 PM
   3%  WAITING log file parallel write                                                  1090          0          0           0           0          0             0          0          0          0       1090          0              0          0          0 09-SEP-13 09.00.11.478 PM                                                   09-SEP-13 09.59.58.059 PM
   2%  WAITING db file parallel write                                                    730          0          0           0           0          0             0          0          0          0        730          0              0          0          0 09-SEP-13 09.01.11.568 PM                                                   09-SEP-13 09.59.48.049 PM
   2%  WAITING enq: TX - contention                                                      600          0          0           0           0          0             0          0          0          0          0          0              0          0        600 09-SEP-13 09.04.41.893 PM                                                   09-SEP-13 09.48.16.695 PM
   1%  WAITING buffer busy waits                                                         560          0          0           0         560          0             0          0          0          0          0          0              0          0          0 09-SEP-13 09.10.02.492 PM                                                   09-SEP-13 09.56.07.626 PM
   1%  WAITING log file switch completion                                                420          0          0           0           0          0           420          0          0          0          0          0              0          0          0 09-SEP-13 09.47.16.562 PM                                                   09-SEP-13 09.47.16.562 PM
   1%  WAITING latch: redo allocation                                                    330          0          0           0           0          0             0          0          0          0          0          0              0          0        330 09-SEP-13 09.04.41.893 PM                                                   09-SEP-13 09.53.27.307 PM
...

The abovementioned output has one shortcoming in a multiuser (database) system – not all wait events are simple, where a session waits for OS to complete some self-contained operation (like an IO request). Often a session waits for another session (who holds some lock) or some background process who needs to complete some task before our session can continue. That other session may wait for a yet another session due to some other lock. The other session itself waits for a yet another one, thanks to some buffer pin (buffer busy wait). The session who holds the buffer pin, may itself be waiting for LGWR, who may in turn wait for DBWR etc… You get the point – sometimes we have a bunch of sessions, waiting for each other in a chain.

The V$WAIT_CHAINS view introduced in Oracle 11g is capable of showing such chains of waiting sessions – however it is designed to diagnose relatively long-lasting hangs, not performance problems and short (but non-trivial) contention. Usually the DIAG process, who’s responsible for walking through the chains and populating V$WAIT_CHAINS, doesn’t kick in after a few seconds of ongoing session waits and the V$WAIT_CHAINS view may be mostly empty – so we need something different for performance analysis.

Git - When to Merge

Daniel Little Dev — Thu, 12 Sep 2013 04:00:00 GMT

Many people use git pull and merge frequently in an effort to keep a branch up to date while working a feature. However it's actually…

Diving into Postgres JSON operators and functions

CRAIG KERSTIENS — Wed, 11 Sep 2013 23:55:56 GMT

Just as PostgreSQL 9.3 was coming out I had a need to take advantage of the JSON datatype and some of the operators and functions within it. The use case was pretty simple, run a query across a variety of databases, then take the results and store them. We explored doing something more elaborate with the columns/values, but in the end just opted to save the entire result set as JSON then I could use the operators to explore it as desired.

Here’s the general idea in code (using sequel):

result = r.connection { |c| c.fetch(self.query).all }
mymodel.results = result.to_json

As the entire dataset was stored as some compressed JSON I needed to do a bit of manipulation to get it back into a form that was workable. Fortunately all the steps were fairly straightforward.

First you want to unnest each result from the json array, in my case this looked like:

SELECT json_array_elements(result)

The above will unnest all of the array elements so I have an individual result as JSON. A real world example would look something similar to:

SELECT json_array_elements(result)
FROM query_results
LIMIT 2;
json_array_elements

{“column_name”:“data_in_here”} {“column_name_2”:“other_data_in_here”} (2 rows)

From here based on the query I would want to get some specific value. In this case I’m going to search for the text key column_name_2:

SELECT json_array_elements(result)->'column_name_2'
FROM query_results
LIMIT 1;
json_array_elements
-----------------------
"other_data_in_here"
(1 rows)

One gotcha I encountered was when I wanted to search for some value or exclude some value… Expecting I could just compare the result of the above in a where statement I was sadly mistaken because the equals operator didn’t translate. My first attempt at fixing this was to cast in this form:

SELECT json_array_elements(result)->'column_name_2'::text

The sad part is because of the operator the cast doesn’t get applied as I’d expect. Instead you’ll want to do:

SELECT (json_array_elements(result)->'column_name_2')::text

Of course theres plenty more you can do with the JSON operators in the new Postgres 9.3. If you’ve already got JSON in your application give them a look today. And while slightly worse, if you’ve got JSON stored in a text field simply cast it with ::json to begin using the operators.

Will the iPhone's newest sensor change the world again?

Zac Szewczyk — Wed, 11 Sep 2013 00:07:30 GMT

In an excellent article posted to The Verge earlier this afternoon Casey Newton made the point I intended to discuss this evening almost as an aside near the end of his article:

“Apple could also let users log in to other apps and services using a fingerprints, providing secure authentication into apps and websites with a couple of taps. If biometric solutions become widely adopted, the tech industry could begin to phase out — or at least augment — the flawed, familiar password.”

With the advent of Passbook in iOS 6, Apple began handling important personal information such as credit card numbers, boarding passes, and gift cards. A few months ago in June, when the company announced iCloud Keychain, it expanded that domain to include passwords, but only on the Mac platform. Before too long — hopefully prior to iOS 8 — I foresee Apple marrying these two technologies with Touch ID on iOS to give users the ability to not only unlock their phone with a fingerprint, but login to websites and apps with that same technology.

Touch ID in its current form is a technology in its infancy; it will take time before we see the full potential of the groundbreaking feature, and perhaps even longer before we realize it.

Permalink.

The wrong tool

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Tue, 10 Sep 2013 23:07:09 GMT

A young scribe worked day and night on his scrolls. Some of his scrolls required many changes, and he laboriously copied the content of each scroll onto a new scroll whenever even the tiniest bit had to be changed.

Once, at supper, the scribe professed how exhausted he was by keeping track of all versions of a single document. Upon hearing this, the abbot told him to use one of the sacred version control systems used by the monastery.

With a strained voice, the scribe responded “I do not have time to learn even one of these systems. I have so many scrolls to copy.” The abbot did not respond, but elected to wait.

The two monks had the same conversation repeatedly. Each time, the young scribe exclaimed that he had no time to learn. Finally, one day, the abbot sent for Master Darcs.

Master Darcs invited the scribe to eat supper with him. They both filled their bowls with nourishing and clear soup. Master Darcs sat down, selected a fork, and began to eat his soup. The young scribe sat and ate in silence. Long after the scribe had finished his soup, the master was still eating his.

Finally, the young scribe dared to ask a question. “Forgive me, master,” spoke the scribe, “but why do you not use a spoon? Even a small one would surely be better than this.”

“I do not have time to learn even one of these instruments,” responded Master Darcs calmly.

Hearing this, the scribe was enlightened.

iPhone Pricing

Zac Szewczyk — Tue, 10 Sep 2013 09:29:14 GMT

With just hours left until the iPhone event today it’s a little late to speculate on pricing, but I just couldn’t resist.

Permalink.

PS Vita TV

Zac Szewczyk — Tue, 10 Sep 2013 09:22:24 GMT

Where there is smoke, there is fire. Apple, then Google, and now Sony all make set-top boxes of varying sizes and functionality. Will Apple, as the leader in this trend, be the first to take the next step in the television space?

Permalink.

Train Hard

Josh Thompson — Tue, 10 Sep 2013 03:00:00 GMT

When’s the last time you participated in a sporting event? (Football, Ultimate Frisbee, rock climbing, running biking, wrestling, whatever) When’s the last time you trained for that activity?

Finally:

When is the last time you trained for that activity with someone else? more

There are a few levels of engaging in an activity. You can observe, you can participate, and you can make investments to improve in that pursuit. (Think watching YouTube videos of sky diving, paying to skydive, but doing it tandem, and finally pursuing your skydiving license.)

I am learning Krav Maga right now. Every week we cover a new topic, and every few months, you have the opportunity to take a test to advance to the next level, or belt. I am right now in level one (watch out, world…) and am looking forward to the test at the end of the month.

I’ve been getting bored in the classes of late, because I felt like the material was not pushing me from a technical perspective, and I just wasn’t working as hard as I wanted to be during the class. I’m a big fan of pushing myself hard and trying hard, but I was often working with partners who did not inspire me to really push myself.

I recently had the chance to train with another level one student who pushed me very, very hard. Inspired by how hard he was making me train, I made him train just as hard. We both acknowledged at the end of class (after I managed to not throw up) that the perceived quality of the class dramatically improved when being paired with a dedicated training partner.

He and I will not always be able to train together, but I have been reminded of the power of being the guy that pushes you to train hard. He pushed me hard, and I had an opportunity to get a lot out of that hour because of it.

This makes me think of training for climbing - I’ve climbed with a lot of people, and the instances where we have decided to spend the session training hard always feels vastly more productive than a relaxed climbing session. Sometimes I’ve been the guy that surprised my partner by pushing them way harder than they expected, sometimes my partner forced me to dig deep and train harder than I thought I could.

The take away, however, is this: don’t settle for simple participation . Drive improvement and change. Most of that improvement and change comes from wanting it. If you are hungry for improvement, that will rub off on your training partner. If it doesn’t wear off, get another partner.

Be the guy (or girl) that inspires others to train hard.

Forcing a media refresh on Android with adb

Carey Metcalfe — Tue, 10 Sep 2013 01:52:00 GMT

Android will automatically perform a media refresh when an SD card is mounted.

Using adb, we can fake that event by manually sending a MEDIA_MOUNTED intent.

For example, if you wanted to run a media refresh of the entire SD card:

adb -d shell "am broadcast -a android.intent.action.MEDIA_MOUNTED -d file:///sdcard"

To refresh different directory, just change "/sdcard" to the absolute path of the directory you want to refresh.

For more fine-grained control, use the MEDIA_SCANNER_SCAN_FILE intent, which triggers a rescan of a single file.

Installing Fehlstart - A simple, quick application launcher

Carey Metcalfe — Tue, 10 Sep 2013 01:51:00 GMT

Fehlstart is an application launcher, much like Launchy, Quicksilver, or GNOME Do. However, where other launchers focus on adding features, Fehlstart is as basic as they come. If you want to search for files or control your media player, look elsewhere. Felhstart launches applications. Period.

Fehlstart isn't in any major repositories so it has to be compiled from source.

Install dependencies
- git, gcc, make, libgtk2.0-dev, libkeybinder-dev
- On most systems these packages will be available through your package manager
Get the code
- git clone https://gitlab.com/fehlstart/fehlstart.git
Compile and install
- Navigate into the folder containing the code
- Run make
- Run make install (with the needed permissions)
Add fehlstart to your window manager's autostart list
Log out and back in to launch Fehlstart.
Press the key combination <Super> + <Space> to bring up the launcher
Type to search through the installed applications, then press <Enter> to launch.

Frameless Geodesic Dome

Zac Szewczyk — Tue, 10 Sep 2013 00:29:22 GMT

It’s not a cabin, but I’m sure this neat little structure will appear on Cabin Porn before too long. The advent and increase in popularity of minimal living structures such as this one is very interesting to me; perhaps one day I will build one of my own. Until then, though, I can always dream.

Permalink.

Instapaper 5

Zac Szewczyk — Mon, 09 Sep 2013 15:38:26 GMT

I could write an entire article proposing improvements to the new website alone, let alone the aging app. But this article isn’t just about Instapaper’s website, nor is it just about the app; this article is about Instapaper the read it later service and what Betaworks can do to revolutionize this beloved platform upon its next milestone release.

Permalink.

Chained Destiny

Zac Szewczyk — Sun, 08 Sep 2013 17:05:47 GMT

Wednesday evening, news broke that Apple had removed The Omni Group’s iOS app OmniKeyMaster for facilitating upgrade pricing, a feature Apple has refused to build in to the App Store since its launch. Amidst the vocal calls for change in Apple’s long-standing policies, I remembered something Marco Arment said on an episode of Build & Analyze.

Permalink.

New puppet-gluster features before Linuxcon

The Technical Blog of James on purpleidea.com — Sun, 08 Sep 2013 07:51:14 GMT

Hey there,

I’ve done a bit of puppet-gluster hacking lately to try to squeeze some extra features and testing in before Linuxcon. Here’s a short list:

SELinux fixes to keep Dan Walsh happy :)
Ping and status checks before volume creation. Now puppet-gluster will be less noisy about failures or missing executions that are due to the necessary incremental nature of puppet-gluster runs. You'll need multiple puppet runs to get a complete setup, so don't let puppet complain part way through. This is due to the design of puppet.
Simple filesystem paths for bricks. This is very useful for prototyping with virtual machines.
Automatic UUID assignment for hosts. This requires exported resources.
Updated examples
And more...

If there are features or bugs that you'd like to see added or removed (respectively) please let me know ASAP so that I can try to get something ready for you before my Linuxcon talk. I also don't have any hardware RAID or physical hardware to test external storage partitions (bricks) on. If you have any that you can donate or let me hack on for a while, there are some features I'd like to test. Contact me!

I’ve got a few more things queued up too, but you’ll have to wait and see. Until then,

We Are All Remote Workers

Nicola Iarocci — Sat, 07 Sep 2013 03:00:00 GMT

A little more than a year ago we closed our offices to become a fully distributed company. This story, which is still unfolding, has been the subject of my We Are All Remote Workers talk at RomagnaCamp 2013.

Shelves: TC Disrupt '13

Avy Faingezicht — Sat, 07 Sep 2013 03:00:00 GMT

During my summer internship in 2013, I had the opportunity to participate in TechCrunch Disrupt. I had very low expectations for the hackathon, since my coding abilities back then were very basic. Nevertheless, I teamed up with Coders Clan's' founder and CEO, Dror Cohen and we built a simple book sharing application. You can check out a video of our presentation, heavily influenced by the beginnings of the now ubiquitous "sharing economy" here.

Series que ver (primera parte)

Patrick D'appollonio — Fri, 06 Sep 2013 23:45:19 GMT

Recomendaciones de parte de un seriéfilo (si es que eso existe...)

Una de las cosas que hago en mi tiempo libre es ver series. Son aquellas cosas que me desestresan, mantienen la mente fuera de contexto por un rato, te hacen gritar, o incluso, te dejan preocupado por lo que pasará. Aquí, la recopilación de series que deberías ver (sin un orden de preferencia) y un pequeño resumen de cada una… Arrow es una de esas series que llama la atención. Aunque a más de alguno no le puede terminar de gustar el fork que sucedió luego de Smallville — y la presencia de Green Arrow en ésta —, la nueva serie sí que es toda una creación.

iOS 7: Apple's Windows Vista

Zac Szewczyk — Fri, 06 Sep 2013 18:58:51 GMT

After nearly six years of Windows XP, the tenth major version of Microsoft’s computer operating system released to much hype and high expectations. With an overhauled visual aesthetic and a host of other headlining features, the Windows world heralded this release as the platform atop which the next generation of computers would build itself. An ambitious claim for sure, Microsoft’s promise to not only overhaul the user interface but its very underpinnings as well seemed almost too good to be true. After XP’s phenomenal success though, the claim seemed a believable one. Like a joke straight out of Family Guy, Vista exited the gate and promptly fell flat on its face.

Permalink.

Protip: Ruby Devs, Please Tweak Your GC Settings for Tests!

Fred Wu (@fredwu) — Fri, 06 Sep 2013 14:13:37 GMT

The Fizzbuzz Bug Tracker A Bug Tracker for Single Developers

Ben E. C. Boyter — Fri, 06 Sep 2013 08:22:26 GMT

This serves as the announcement of my new bug tracker product I am working on.

My needs are pretty specific and none of the existing bug trackers I have tried have meet the following goals.

Speed. Searching, adding projects/issues/comments should be instant. Any time waiting on the bug tracker is wasted time.
Outlook style view of projects/issues/comments. This should allow me to get an overview of how I am tracking.
Not require me to spin up a full web-server. I don’t want to have to install a full stack web-server just to track bugs.
Sync across all devices. I want it to just appear on every device I own without me having to worry about backups or keeping things in sync.
Be single user. I don’t want to have to login or perform user management.
Support multiple projects. I also want to be able to have multiple issues per project.

With that in mind let me introduce the Fizzbuzz Bug Tracker. Fizzbuzz is a single executable that works on Windows, Linux and OSX (once I have a machine to compile it on). A suggested workflow is to copy it onto your Dropbox folder (or equivalent) where it will be synced across all devices. Fizzbuzz has a strong emphasis on speed. Adding projects or issues, searching across projects and issues, drilling into projects or issues is near instant.

Oracle Performance & Troubleshooting Online Seminars in 2013

Tanel Poder Blog — Thu, 05 Sep 2013 16:45:07 GMT

In case you haven’t noticed, I will be delivering my Advanced Oracle Troubleshooting and Advanced Oracle Exadata Performance: Troubleshooting and Optimization classes again in Oct/Nov 2013 (AOT) and December 2013 (Exadata).

I have streteched the Exadata class to 5-half days as 4 half-days wasn’t nearly enough to deliver the amount of details in the material (and I think it’s still going to be a pretty intensive pace).

And that’s all for this year (I will write about conferences and other public appearances in a separate post).

Cheating at Cookie Clicker

Thomas Hunter II — Thu, 05 Sep 2013 03:00:00 GMT

One of My First Tweets

huphtur — Thu, 05 Sep 2013 03:00:00 GMT

Nutella on sale: 2 for 2.50!
— M. Appelman (@huphtur) March 25, 2007

Thanks Topsy for making me realize my life is still much pretty the same as it ever was…

Don't Ask What I'm Writing

Zac Szewczyk — Thu, 05 Sep 2013 00:18:12 GMT

Excellent piece from the New York Times on the less technical challenges of the writing process. I completely agree with Harry Marks — I, too, hate explaining any written work, and especially my own — and the article’s author herself: she made a number of observations that hit very close to home for me.

Permalink.

Obama's Bluff

Zac Szewczyk — Wed, 04 Sep 2013 22:18:19 GMT

“That’s the danger of bluffing in anything — you better be 100% certain you aren’t called, or willing to take the risk you are. I think it is clear this was a bluff on Obama’s part. Right or wrong Obama has now been called. There is very little choice for the United States now — because either hard line statements from our President no longer carry weight, or we go to war (of some scale).”

I looked forward to hearing Ben Brooks’ thoughts on this topic all throughout the process of writing Syrian Waves; he didn’t disappoint.

Permalink.

TechEd Australia 2013

Daniel Little Dev — Wed, 04 Sep 2013 04:00:00 GMT

The first day at TechEd offered two main sessions the developer kick off and the Keynote. The developer kick off touched on a new Visual…

My interview on being a MongoDB Master

Nicola Iarocci — Wed, 04 Sep 2013 03:00:00 GMT

So I’ve been interviewed by Laura Czajkowski on my experience and role as a MongoDB Master. The interview actually covers more angles than that and I guess that, if you really don’t have anything better to do, you might even want to check it out.

How did you get involved in open source?

I’ve been an avid developer delivering desktop applications in the .NET/MSSQL closed source ecosystem for so many years that open source wasn’t even on my radar.

My conky setup

zufallsheld — Tue, 03 Sep 2013 19:22:00 GMT

I’ve been a longtime fan of conky setups and watched many threads where users post their configurations, but I couldn’t bother writing my own configuration.

But now that I got a second screen at home I thought that I could use the extra space it gives me with …

Microsoft Surface vs iPad + Linode

Yield Thought — Tue, 03 Sep 2013 18:02:00 GMT

“I never thought I’d write a blog post in Microsoft Word, but here I am doing just that,” begins my first blog post on the Surface. Written lying on a rabbit-shaped bench overlooking the sea, with a gentle breeze cooling the heat of the sun on my skin, all is well. A week later when I come to edit and upload it, I discover that Word has lost it[1].

Act One: All good things come to an end

This story begins back in January. I’d been curious about trying a Surface + Linode combination instead of my 2 year-old iPad + Linode setup. The allure of a full-fat browser that can run Gmail and iPython Notebooks, combined with a keyboard-centric OS has long tempted me. I hadn’t switched, though. Somehow, I had been waiting. At the end of that fateful January amidst the snow and the cold, everything changed.

I was promoted into a management role.

Overnight I find my entire interface to the rest of the company changes. What used to be IM and Mercurial is now emails with attached Word and Powerpoint documents. Within a fortnight the iPad + Linode setup collapses; neither iOS nor Linux nor Google Docs offer credible alternatives for reviewing, editing and returning Office documents and I grit my teeth, install Windows 8 and Office on my laptop and get to work.

Fast forward to April, and I’m wandering through a cherry-blossom filled Washington, exasperated by two months of being tied to a laptop, with all the power, size, screen, weight and fragility restrictions that go along with one. I’ve mostly stopped working in cafes and outdoors, but I miss it. As I walk I weigh up the alternatives. A 13" Air would be a massive step back towards the freedoms I’ve grown used to, but the fanless, robust silence of a tablet continues to attract me, and I don’t want to go back to managing local storage any more than I can help.

Reaching a decision, I drive to a cathedral-like mall and walk out again a few minutes later with a Surface RT and type cover. The time to try a Surface has come. If anything can let me work as flexibly and freely as my iPad in this new corporate world, the Surface can.

Act Two: Flashback

In the following glorious three months of summer and sunshine at my new home by the sea, I get to know the Surface, its glory and its shame. It works, I use it every day. Yet something is missing, something isn’t right. I just can’t fall in love with the Surface.

Back in primary school, my class made Christmas cards for our parents one year. My artistically-gifted friend, who knew the difference between a B and HB pencil, drew out a simple, bold cracker design with a simple twist - you can pull apart the cracker to see the message. No more, no less, but somehow he managed to spend the whole hour working on it.

I thought the pop-up idea was great. My card had a cracker too, and when you opened it there was a fireplace and tree inside and there were extra tabs to pull to make the fire go out and Father Christmas come down and you could open one of the presents under the tree to see my name and I’d fitted most of the words in without squashing them and when I showed the resultant sticky, thumb-printed mess to our teacher he asked me what on earth that was and told me to throw it away and make another.

I didn’t make another, but I did take a long, hard look at my friend’s card. Mine did more; why wasn’t it better? In that moment, I first learned about the relationship between elegance, simplicity and beauty, and my card with all its features and messy edges had none of these things.

Using the Surface gives me the same feeling. I can do more with the Surface, but it is not beautiful, nor do I enjoy using it - or being seen using it. It’s so obviously a business device that putting it on the table in a cafe feels… awkward. Like an imposition, doing office work in a leisure place.

The experience is often disjinting. Rotating the device results in a weird “pop” animation that often leaves desktop windows or even the start screen itself distorted and out of place. It persists in referring to itself as my “PC”. The keyboard doesn’t auto-appear when text fields have the focus in desktop applications. Metro IE sometimes decides to reload all the old open tabs when clicking a link in a mail switches to it, stealing the focus from the new page I just tried to visit. The kickstand is at just the wrong angle for everything and the keyboard, while fine on a table, is spongy and occasionally misses keypresses when used on a lap. Word doesn’t save your work unless you click on a 3.5" disk icon regularly. There are a hundred small things that make the whole experience feel fragile, confused and unsatisfying.

No, I cannot love the Surface. But neither do I discard it. Despite its failings, it does what it claims. It works, and it lets me work, flying through my Gmail with keyboard shortcuts, effortlessly opening, reviewing, changing and reattaching Office documents to emails. Sometimes, it even feels incredibly cool - using an iPython Notebook running on my Linode to graph and explore data from the tablet is absolutely great, even if it’s only possible thanks to the single-click jailbreak.

Act Three: Surprise

You see, there’s something else, something that changes things in ways I never expected: I can read the Surface’s screen in direct sunlight.

While I can just about work on my iPad in the shade of a tree, the Surface screen is clear and bright lying in direct sunlight in the hammock on my balcony, on a pier at the beach, outdoors in a café or on a rug in the garden. This changes the game again. Working in a natural environment can be both beautiful and liberating. It’s just a shame it’s coupled to a device that’s otherwise somehow disappointing.

Visiting my friends in Munich is typical of my mixed feelings for the situation. It’s a 7 hour train journey and a 7 day trip. I take the Surface for working on but also pack the iPad for playing games, so now everything weighs as much as a small laptop would anyway. My friends in Munich consistently tell me how healthy I’m looking. I put it down to my suntan from all those mornings in the hammock with the Surface.

I prefer the experience of working on the iPad. The amazing, unexpected mental freedom of having all my state on an automatically backed-up, always-on Linode coupled to a simple, essentially stateless window onto that world that I could toss around like a paperback book. The ability to open and close it at will, let the battery run flat, leave apps open with the contents unfinished and never give them a second thought.

The Surface doesn’t persist application state. Every week it threatens to restart itself within 2 days to install updates. If I haven’t manually saved work when it does that, the work is lost. Some things are saved on SkyDrive, some on the local disk, which isn’t automatically backed up either. So now I am forced to be aware of this leaky abstraction, to manage the remote and local state and at this point I might as well just have a MacBook Air and be done with it.

It lacks a zen-like calm.

And that’s what this comes down to. If you’re mostly doing non-web development, go for an iPad+Linode. If that combination can’t do the work you’re doing - like the MS Office editing I need to do now - then it’s a choice between the Surface and a laptop, not an iPad. Do I recommend the Surface for working like this? I don’t know. It’s been months and I still don’t know.

I would miss working outside if I had to go back to my laptop full time. Cycling into nature and working in a beautiful spot is fabulous. But these are things the screen lets me do, not the things the Surface lets me do. I expect to see similar screens on other devices soon. A good screen is not fundamental to the form factor or the manufacturer. There are probably options out there already that I haven’t seen because I never thought to look before.

I do know that I almost never use the Surface as a tablet. I use it like a little laptop. Maybe I’ll find the perfect combination of powershell scripts and metro apps to recreate an elegant workflow, but I’m not really motivated to because while I could use shell scripts and python programs on the Linode to work around the iPad’s email limitations I can’t do anything work around the Surface’s deeper usability flaws.

Every time I use it I miss my MacBook a little more.

Update: HN discussion here (including my thoughts on Microsoft Phone).

Update: I forgot to mention my Working in the Cloud mailing list. Articles like this appear there first, sign up if you’re interested in how things go from here!

[1] Actually it autosaved a file, and when I next tried to open an attachment during a conference call I ignored the annoying little restore blah blah tab. I’ve since learned not to do that. But I shouldn’t have to.

Collection of Letters for Neural Network OCR Training

Ben E. C. Boyter — Tue, 03 Sep 2013 08:59:42 GMT

I was looking for this on Google the other day and unable to find it. Essentially what I needed was a collection of images which are all the same size, but of different fonts so that I use them for training Neural Networks and test other OCR techniques. Since I couldn’t find any I thought I would upload my own collection.

I used the below images when working on my thesis. From memory over 20 different fonts and sizes were used to create about 200 examples of each letter. The full data set proved to be pretty accurate when it came to recognizing most examples of text I found on the web.

Content but Restless

Josh Thompson — Tue, 03 Sep 2013 03:00:00 GMT

There is tension between being content with what you have, and striving for more. We have all heard the “serenity prayer”:

God, grant me the serenity to accept the things I cannot change, The courage to change the things I can, And wisdom to know the difference.

This prayer is supposedly common in Alcohol Anonymous and other 12 Step programs. A little farther down in the Wikipedia article, however, the whole prayer (attributed to American theologian Reinhold Niebuhr) is printed, and it is different:

God, give me grace to accept with serenity The things that cannot be changed, Courage to change the things Which should be changed, And the Wisdom to distinguish The one from the other.

Living one day at a time, Enjoying one moment at a time, Accepting hardship as a pathway to peace, Taking, as Jesus did, This sinful world as it is, Not as I would have it, Trusting that You will make all things right, If I surrender to Your will, So that I may be reasonably happy in this life, And supremely happy with You forever in the next.

So there is the original. The difference between the original and the shortened version is deciding what to change .

If you sat around and changed only the things you could, you’d change easy things, and insignificant things, because changing hard things and meaningful things is hard. It is hard to change things that should be changed, but those are the only changes worth making. And, the original prayer says nothing about changing what you ** can. It talks about changing what you should.

Action is empowering, and it leads to taking more action.
Action implies making things happen.
Making things happen will eventually lead to failure.

There is great hope in taking action, and there are great lessons to be found in failure. You know how every motivational poster ever to be seen in a school talks about how “You have what it takes” and “You are a beautiful and unique snowflake”?

In addition to being so stupid it hurts, these are wrong. They should say:

“Get Shit Done – it will make you feel better about yourself.”
“You are not unique. Millions before you have wrestled with your problems. Some have surpassed you, some have fallen far behind. Until you are dead, there is hope for you.”
Take action. Keep going until you fail. Then try again.

I’m not sure where I am going with all this. But please, go do something meaningful. It is the only thing that matters. Money, your job, your hobby, your friends – none of these matter without something meaningful being done with it or through it.

The good news is you can define what is meaningful. Then you have to do it.

Aubade

ho.dges.online — Tue, 03 Sep 2013 03:00:00 GMT

I work all day, and get half-drunk at night.
Waking at four to soundless dark, I stare.
In time the curtain-edges will grow light.
Till then I see what’s really always there:
Unresting death, a whole day nearer now,
Making all thought impossible but how
And where and when I shall myself die.
Arid interrogation: yet the dread
Of dying, and being dead,
Flashes afresh to hold and horrify.

The mind blanks at the glare. Not in remorse
—The good not done, the love not given, time
Torn off unused—nor wretchedly because
An only life can take so long to climb
Clear of its wrong beginnings, and may never;
But at the total emptiness for ever,
The sure extinction that we travel to
And shall be lost in always. Not to be here,
Not to be anywhere,
And soon; nothing more terrible, nothing more true.

Barbara Cartland

ho.dges.online — Tue, 03 Sep 2013 03:00:00 GMT

Barbara Cartland wrote - or ‘wrote’ since she mainly dictated - up to 8,000 words a day, and frequently finished two books a month: in 1976 she published 23 books; she wrote 723 books in total.

Nobody cares because they’re all shit.

John Lanchester, “Maigret’s Room”, LRB 42, 11

Downton Abbey Back Again

Zac Szewczyk — Mon, 02 Sep 2013 21:24:08 GMT

Shortly after Downton Abbey’s third season ended, iTV announced a fourth set for the latter-half of this year. Even as an ardent fan of the British television programme, I paid little attention to the announcement and any ensuing chatter until, presently, it faded from my mind entirely.

Permalink.

Syrian Waves

Zac Szewczyk — Mon, 02 Sep 2013 15:42:39 GMT

Of the few topics I consistently refrain from writing about, I most actively avoid religion and politics. Not because I hesitate to post anything inflammatory or fear alienating potential readers, but more so because I do not know enough about either topic to write with any valid authority. That list used to include Apple rumors and speculation, but the last few weeks have seen me gradually enter that front as well. Today, I expand my topic list once again to include politics.

Permalink.

Puppet-Gluster and me at Linuxcon

The Technical Blog of James on purpleidea.com — Mon, 02 Sep 2013 08:50:23 GMT

John Mark Walker, (from Redhat) has been kind enough to invite me to speak at the Linuxcon Gluster Workshop in New Orleans. I’ll be speaking about puppet-gluster, giving demos, and hopefully showing off some new features. I’m also looking forward to meeting up with gluster expert Joe Julian.

If there are features that puppet-gluster is missing, or you have a use case that I haven’t covered, please let me know, and I’ll try to work on it for you ahead of the conference. If you want to meet up for some puppet-gluster help, or to hack on code, I’ll be around from the 16th to the 20th of September. My talk is on the 19th.

Now You See Me

🦉 olshansky 🦁 — Mon, 02 Sep 2013 04:34:22 GMT

Olshansky's review of Now You See Me

Adding Godaddy G2 root cert to JDK 7

Rich Dougherty — Mon, 02 Sep 2013 01:27:00 GMT

Mucoce 2.0 Coming Soon

Niklas Korz — Mon, 02 Sep 2013 01:00:00 GMT

Lately, I have been working on version 2.0 of my Mac application called “Mucoce”.

Lapis: Lua for the Web

Separate Concerns — Sun, 01 Sep 2013 19:00:00 GMT

I use different programming languages for different tasks, but the one I prefer is Lua. I have always wanted to use it for the Web, and in a way I already do: this blog is a static website generated by a custom Lua program. I have also written several services that can speak HTTP+JSON in Lua. For larger, HTML-based Web applications however, I have never found the framework I wanted. I have tried several of them, but kept coming back to more dependable platforms.

Last March, I gave Lapis a try. It is a relatively new framework written by Leaf Corcoran, the author of MoonScript, a programming language that compiles to Lua (like CoffeeScript for JavaScript). Lapis is powered by OpenResty, an incredibly fast web application server that run inside the nginx Web server and is already used by large websites like Taobao and CloudFlare.

Lapis was built with MoonScript in mind, so I had to hack around it to make it work with plain Lua. It worked but was too verbose, so I eventually gave up on that and on Lapis altogether. But that was Lapis version 0.0.1! Leaf continues to improve it and recently released version 0.0.4. Last Friday evening, on a train to Bordeaux, I decided to give it another try.

Lapis now natively supports Lua and has improved in various aspects. I have found it comfortable to write the views and the configuration file with the MoonScript DSLs provided by the framework. For logic (models and controllers) I used Lua directly since I prefer its syntax to MoonScript for regular code.

I have published a small skeleton application which demonstrates this dual languages style to GitHub. I chose to use Redis for the datastore because I know it well and had it running on my laptop, so I did not use the database integration layer of MoonScript which is designed primarily for PostgreSQL (but it looks nice as well). This application is a kind of Hello World but it demonstrates most features of the framework, including sub-applications, widgets, layouts, exception-handling and input validation.

If you want an example of a larger Lapis codebase with a different style, MoonRocks is written in Lapis and its code is on GitHub.

So, what did I think of it? Well, finally I could see myself write a serious Web application in Lua! I will still choose Python and Flask in a professional setting because it is is a more stable, more feature-complete stack, and because I would not want to ask a whole team to learn both Lua and MoonScript to work on the project. But if I make a Web application as a personal side project, I will certainly try to use Lapis for that.

Steven Enns and "Craftsmanship"

Liza Shulyayeva — Sat, 31 Aug 2013 14:46:37 GMT

“Craftsmanship is really taking pride in your work. In terms of craftasmanship for me that means looking at the past and looking at where leatherworking came from and trying to take that and include smart design from now to create some really great leather products.” - Steven Enns

GAME ON 2.0 wraps up!

Jason Eckert's Website and Blog — Fri, 30 Aug 2013 03:00:00 GMT

All good things must come to an end…..and unfortunately this also applies to the Game On 2.0 exhibition at the Ontario Science Centre, which ran for the past 6 months (starting March 9th). This Labour Day weekend is the final time that you can check it out as it closes Sept 2nd.

Our college (triOS College) was the presenting sponsor for the exhibition, which, for me was incredible - not only because I run our video game program, created the information for our game development booth, gave numerous Ontario Science Centre talks on gaming topics, and helped organize various game-themed events - but because I’m an avid retro gamer who has many of the same arcade machines and vintage consoles showcased in Game On 2.0 in my own home! For me, it was like merging my home and work lives. I could actually bring my personal passion and knowledge of retro gaming into my day job! Not many people can say that.

Eve with Python 3.3 Support

Nicola Iarocci — Thu, 29 Aug 2013 03:00:00 GMT

Another Eve release is out and I’m particularly proud about it since it brings full Python 3.3 support (among other things). Check out the relevant blog post: Eve 0.0.9 is out!

Mentors and Attitude

Josh Thompson — Wed, 28 Aug 2013 03:00:00 GMT

Having a mentor is equal parts “having a mentor” and “being one who can be mentored”. If I am too thick-headed to evaluate things that someone tells me and figure out how to apply that to my life, both of us are wasting our time. Having a mentor is life-changing because you have intentionally adopted a teachable disposition. It is a commitment to growth. If you have a conversation with your mentor, and that conversation is live-streamed to a friend who is not interested in getting mentored, but wants to hear what nuggets of wisdom come from that conversation, you will get far more out of the conversation than he, even though you both heard the exact same thing.

I don’t have any formal mentoring relationships but there are a few people in my life who consistently share wisdom, insight, and sometimes tell me “That would be a bad way to go about X - how about this other way?”

I am thankful for these relationships, and I have been deeply impacted by them.

Do you have any mentors? If not, why not?

Comprehensive Linux Backups with etckeeper & backupninja

duncanlock.net — Tue, 27 Aug 2013 22:36:36 GMT

I’m going to build on Jamie Zawinski’s excellent advice about backups, which you should read first. This is basically that, but with some extra bits. If this seems too complex, then just do what he says.

The plan is to use Backupninja to backup everything to an external USB drive – and also to Amazon S3 or Dropbox, depending on what it is. Backupninja provides a centralized way to configure and schedule many different backup utilities, just by dropping a few simple configuration files into /etc/backup.d/.

I have a multiple hard disk setup for my desktop Linux box - my /home folders live on one disk and / lives on another one. I don’t want to backup everything from the system disk - I can re-install it in 10 mins, and I don’t really want to complicate this by backing up non-essential stuff. I just want to backup a few system wide configuration items from / - and my MySQL databases, which are kept on there.

To do this, I’m going to tell backupninja to backup the system config, MySQL databases and anything else I want backed up, to my /home folder, then backup the whole /home folder.

I’m also going to do extra backups to Amazon S3, so we’ll have some extra cloud backups of critical stuff.

I’m going to use etckeeper to store the system wide config from /etc in a git repository - this way I get a history of changes and the ability to roll back config changes. I’m then just going to backup that git repository.

Making sure your USB disk is mounted at backup time

If you just plug in a USB drive, it will generally auto-mount and appear inside /media. This is often good enough, but if your machine isn’t setup to do this, or it doesn’t work properly for some reason, you will need to mount the drive permanently by editing /etc/fstab.

I suggest that you mount the backup drive via it’s label, as the device name can change for external devices depending on what’s plugged in at the time. To have an external USB drive called ‘backups’ and formatted as ext4, mounted at /mnt/backups, first do the following:

$ sudo mkdir /mnt/backups

then add something like this to your /etc/fstab file:

# <file system>  <mount point>  <fs-type>  <options>                         <dump-freq>  <pass-num>
LABEL=backups    /mnt/backups   ext4       nodev,nosuid,noatime,nodiratime   0            0

you can test this by running:

$ sudo mount -a

If this works, it shouldn’t print out any errors and browsing to /mnt/backups should show you the contents of your external drive.

In the steps below, I’m going to use /mnt/backups as the backup location, but change this to point to the right place for your local setup.

Backing up System Configuration using etckeeper

Basically, etckeeper runs itself - you just have to install it and switch it on. You can commit changes to /etc manually if you want to, but by default it hooks into apt to commit changes when you install things and has a cron job to backup outstanding changes daily:

etckeeper allows the contents of /etc be easily stored in Version Control System (VCS) repository. It hooks into apt to automatically commit changes to /etc when packages are installed or upgraded. Placing /etc under version control is considered an industry best practice, and the goal of etckeeper is to make this process as painless as possible.

– Ubuntu Server Guide

To install etckeeper, run this in a console:

$ sudo apt-get install git etckeeper

The etckeeper from the Ubuntu repositories is setup to use bzr by default, because they’re idiots, so lets change it to use git. Edit the /etc/etckeeper/etckeeper.conf file like so:

# The VCS to use.
#VCS="hg"
VCS="git"
#VCS="bzr"
#VCS="darcs"

If you have bzr installed for some reason, then the etckeeper bzr repository will be automatically initialized. To undo that, run this:

$ sudo etckeeper uninit

Then to re-initialize with a git repository:

$ sudo etckeeper init

If you don’t have bzr installed it will fail to initialize the bzr repo, so you can just run the second one.

One thing to know about running etckeeper is that it keeps its git repo inside /etc (which is fine) - but this means it runs as root - which takes a bit of getting used to if you’re going to use it manually. You will also need to setup at least a minimal git config for the root user:

$ sudo su -
$ git config --global user.name "Your Name"
$ git config --global user.email duncan.lock@gmail.com
$ exit

Once you’ve done that you can check everything in:

$ cd /etc
$ sudo git status
$ sudo etckeeper commit "Initial Commit"

Setting up backupninja & postfix

The Ubuntu package for backupninja also installs[1] postfix - which it can use to send notification emails. Postfix is a fully capable - but very lightweight - MTA/email server. I’m just going to configure it to send outgoing emails and nothing else. This will allow backupninja to send me emails when backups succeed - or fail.

Install backupninja like this:

$ sudo apt-get install backupninja

Configure Postfix

During install you will see the postfix install wizard, which will prompt you for some configuration values. You can accept the defaults for everything, except these:

For ‘type of mail configuration’ select ‘Satellite system’.
For ‘system mail name’, either accept the default, or enter the domain name to use in the from: address for outgoing emails.
For ‘relay host’, make sure it’s blank.

That should be all the configuration postfix requires. Once the install has completed, you can test it by running this at the command line:

$ echo 'test email body' | mail -s 'test email subject line' send.to.address@wherever.net

You should receive an email at send.to.address@wherever.net - remember to check your spam/junk folder. Waking up to an email like this is very reassuring:

Configure Backupninja

The backupninja install will create a config folder: /etc/backup.d where we’ll be storing our backup jobs - and a config file /etc/backupninja.conf which we’ll configure like this - everything else can stay at its defaults:

reportdirectory = /home/duncan/Dropbox/backups
when = everyday at 02:00
reportemail = your.email@example.net

I’m sending the backup report log to Dropbox & email - and kicking everything off at 2am.

The backupninja config files are extremely well commented, explaining what everything does in great detail. The best way to learn how to configure it is just to read the config files. It also installs some thoroughly commented example backup jobs - one of each type - into /usr/share/doc/backupninja/examples/ which you can use as the basis for your backup jobs.

Now we’ll setup each of the backup jobs we want to run, by adding a simple text file to the /etc/backup.d folder for each job. These are executed in alphanumeric order, so I suggest you create them like this:

The only caveat is that Backupninja config files need to be owned by root and not world or group readable, so make sure they’re: -rw-------, by doing this:

$ sudo find /etc/backup.d/ -type f -exec chmod 600 {} \;

and this, to check it worked:

$ sudo ls -lah /etc/backup.d/

total 40K
drwxrwx---   2 root root 4.0K May 19 16:54 .
drwxr-xr-x 154 root root  12K May 19 15:25 ..
-rw-------   1 root root 1.4K May 19 16:54 10-little-things.sh
-rw-------   1 root root 3.5K May 19 16:54 50-daily-all-db.mysql
-rw-------   1 root root  219 May 19 16:54 60-daily-home-rsync.sh
-rw-------   1 root root  135 May 19 16:54 70-photos-to-s3.sh
-rw-------   1 root root  134 May 19 16:54 71-ebooks-to-s3.sh
-rw-------   1 root root  138 May 19 16:54 99-cleanup-afterwards.sh

Speaking of which, backupninja also runs as root, so any files it creates during the backup will be owned by root, so my housekeeping scripts fix that up afterwards.

10-little-things.sh

This does some initial housekeeping and copies some little things into the /home folder for later backing up:

# Backup installed packages list
dpkg --get-selections > /home/duncan/backups/dpkg-selections.txt

# Take simple copies of major config files for convenience
cp /etc/hosts /home/duncan/backups/
cp /etc/fstab /home/duncan/backups/
cp /home/duncan/.bashrc /home/duncan/backups/
cp /home/duncan/.bash_aliases /home/duncan/backups/
cp /home/duncan/.inputrc /home/duncan/backups/
cp /home/duncan/.gitconfig /home/duncan/backups/
cp /home/duncan/.filezilla/sitemanager.xml /home/duncan/backups/

# Copy a few things over to dropbox, for extra safety
cp /home/duncan/backups/hosts /home/duncan/Dropbox/backups/
cp /home/duncan/backups/fstab /home/duncan/Dropbox/backups/
cp /home/duncan/.bashrc /home/duncan/Dropbox/backups/
cp /home/duncan/.bash_aliases /home/duncan/Dropbox/backups/
cp /home/duncan/.inputrc /home/duncan/Dropbox/backups/
cp /home/duncan/.gitconfig /home/duncan/Dropbox/backups/
cp /home/duncan/.filezilla/sitemanager.xml /home/duncan/Dropbox/backups/

# Backup etckeeper, plus any other git repo's I've backed up to /home/duncan/backups/git-backups
cd /etc/
git bundle create /home/duncan/backups/git-backups/etc.git-bundle --all
rsync -vaxAX --delete --ignore-errors /home/duncan/backups/git-backups /home/duncan/Dropbox/backups/git-backups

# Change permissions on the backup folders so that I can use them
chown -R duncan /home/duncan/backups/
chown -R duncan /home/duncan/Dropbox/backups/

50-daily-all-db.mysql

This backs up all my MySQL databases into my home folder using mysqldump:

### backupninja mysql config file ###

databases   = all
backupdir   = /home/duncan/backups/mysql
hotcopy     = no
sqldump     = yes
compress    = yes
dbusername  = ******
dbpassword  = ******

This uses backupninja’s built in support for backing up MySQL databases, so you just need a config file, ending in .mysql, telling it what to backup.

60-daily-home-rsync.sh

This is the big one that backs up the /home folders to an external USB disk, provided it’s mounted where it’s supposed to be:

if mountpoint -q /mnt/backups
then
   info "backup drive is mounted, backing up"
   rsync -vaxAX --progress --delete --ignore-errors --exclude '.cache/' --exclude '.local/share/Trash/' /home/ /mnt/backups/
else
   fatal "backup drive is not mounted, quitting"
fi

Backupninja does have support for running rsync backups directly, just like it does for MySQL, but it does time machine style incremental/ hardlink based backups, which wasn’t what I wanted at the moment. I just used this shell script to run rsync - which works fine.

70-photos-to-s3.sh

This one backs up my photo’s to Amazon S3. It requires s3cmd to be installed and configured:

# Backup photos to Amazon S3
s3cmd -vH --progress --guess-mime-type sync /home/duncan/Photos/ s3://dflock-backups/dunc-desktop/photos/

To install and configure s3cmd, do this:

$ sudo apt-get install s3cmd python-magic
$ s3cmd --configure

See here for more info on setting up s3cmd:

You will be asked for the two keys - copy and paste them from your confirmation email or from your Amazon account page.

– http://s3tools.org/s3cmd

71-ebooks-to-s3.sh

I also do the same with my eBooks collection:

# Backup ebooks's to Amazon S3
s3cmd -vH --progress --guess-mime-type sync /home/duncan/Books/ s3://dflock-backups/dunc-desktop/books/

99-cleanup-afterwards.sh

This one just does a tiny bit of housekeeping at the end:

# Change permissions on backups so that I can use them
chown -R duncan /home/duncan/backups/
chown -R duncan /home/duncan/Dropbox/backups/

Testing with ninjahelper

Backupninja comes with a great little tool called ninjahelper to test your backup configurations and manually run jobs. When it starts it gives you a list of each of your jobs:

Choose the job you want to test, then you’ll see this:

Do a test run, then a real run of each job. This will also test permissions etc… and tell you if anything needs changing.

Use this to do a test run of each of your jobs in turn until they work, then to actually run each one and check the output. Once they all work here, you’re good to go.

You can check your backup system configuration changes into etckeeper now:

$ sudo etckeeper commit "Initial setup of backup system"

So, your backup system configuration is now backed up :)

Physical Off-site Backups

I also want physical off-site backups of everything - in case anything happens to my building - like a fire, flood or burglary, for example.

Once you’ve setup the above, this is simplicity itself - just remove the external USB backup disk, stick a post-it note with the date on it, and take it to work, or give it to a friend who lives separately from you.

Then just get a new blank disk and put it where the old one was, format, label and mount it the same way. Backups will then happen to that disk.

Then, like jwz says - every month, bring that other drive back, plug it in and run the backup to it, then either take it away again or swap them over.

Mounting & Unmounting

To un-mount your existing backup disk, so you can safely remove it, do this:

$ sudo umount /mnt/backups

Then remove it and plug the new disk in. Make sure it’s formatted and labeled correctly[2], then mount it like this:

$ sudo mount -a

Which will mount everything in your /etc/fstab that isn’t already mounted.

Testing

I’m deliberately not doing anything too fancy here - no compression, no encryption, etc… - just a simple copy of stuff. This means less things to go wrong - and that testing is easier. Open some files from the backup and check that they’re OK.

Copy some files off the backup disk to check that works; download some stuff from s3.

Do this periodically. Backups that don’t restore are worse than no backups.

Remember to keep an eye on the log file that Backupninja makes at /var/log/backupninja.log - and make sure you’re getting the emails - and check and immediately fix any errors or failures.

Then… relax

Once this is all setup, you can take a deep breath and relax - safe in the knowledge that you’re covered if anything bad happens to your digital life. This only took me a couple of hours to setup from scratch - but will take you much less because you can copy & paste my hard work. What are you waiting for - give yourself the gift of some peace of mind.

Footnotes & References

The Ubuntu packages install postfix when you install backupninja via a dependency on +mail-utils+, which depends on +mail-transport-agent+, which is provided by +postfix+. ↩
i.e. usually the same format as your source drive (ext4 in my case) and labeled ‘backups’. I use the excellent GParted for this, which you can install from your distributions repository in the usual way. ↩

Saving Resources for Humans in PHP

Ben E. C. Boyter — Tue, 27 Aug 2013 03:23:43 GMT

One of the issues I have run into running searchcode.com is that a huge amount of time spent serving pages is serving them to bots (about 900,000 hits a day are from bots). I have been watching the load averages and they can spike to over 30.00 occasionally which is pretty bad for a 4 core/ht system. I don’t have any problems with bot’s really other then the fact that I cannot really control them. Sure you can specify crawl delays but its of limited use if the bot chooses to ignore it.

carvr

Matt Keeter — Tue, 27 Aug 2013 03:00:00 GMT

Image resizing with seam carving

Use a Custom Tld for Local Development

Baptiste Fontaine’s Blog — Mon, 26 Aug 2013 23:31:00 GMT

In this post, we’ll create a custom TLD for local development, and configure Apache to work with that. It’ll allow you to work on your local version of mysuperwebsite.com with the local domain mysuperwebsite.dev, with the exact same URLs, except that little .com which is replaced by .dev.

This post is focused on OS X, but the tools used are available on Ubuntu and others. Additionally, you can choose whatever unexisting domain you want, just replace .dev with the one you chose in the commands described in the article.

DNSMasq

The major problem we have when we develop locally with custom domains is that we have to add an entry to /etc/hosts for each website. Wildcards are not supported, so you can’t write the following line in it:

127.0.0.1 *.dev

There are different workarounds, but here we’ll use DNSMasq as a local DNS resolver. If you don’t have homebrew, install it first, then install DNSMasq:

brew install dnsmasq
# enable the daemon on startup
sudo cp $(brew --prefix dnsmasq)/homebrew.mxcl.dnsmasq.plist /Library/LaunchDaemons/

DNSMasq will run locally and redirect any query for a *.dev domain to the local host, 127.0.0.1. Open /usr/local/etc/dnsmasq.conf (or create it if it doesn’t exist) and add the following lines:

address=/dev/127.0.0.1
listen-adress=127.0.0.1

Then start DNSMasq:

sudo launchctl load homebrew.mxcl.dnsmasq

You’ll have to tell OS X to send its DNS queries to the local server first, then try the other ones, to intercept the queries for the *.dev domains. Go to System Preferences → Network → Advanced → DNS, and add 127.0.0.1 at the top of the list of DNS servers.

You can then check that it works using dig:

$ dig foobar.dev
…
;; QUESTION SECTION:
;foobar.dev.            IN  A

;; ANSWER SECTION:
foobar.dev.     0   IN  A   127.0.0.1

;; Query time: 0 msec
;; SERVER: 127.0.0.1#53(127.0.0.1)
…

If you have some server listening on port 80, you can try foobar.dev in your browser, it’ll display whatever you’re serving on 127.0.0.1:80. If you have any troubles, empty your cache (use dscacheutils -flushcache on OS X), or restart your computer.

That’s all! You can stop there, but if you’re using Apache you may be interested by the next section of this article.

`mod_vhost_alias`

This Apache module allows you manage virtual hosts dynamically, so you won’t have to create a new one for every (local) website. This is useful if you have a large number of virtual hosts with similar configurations. In this section, we’ll see how to associate a .dev domain with a directory on your computer. We’ll assume you already have Apache installed and working.

With mod_vhost_alias, Apache extracts the hostname from the client query (with the Host HTTP parameter) and use it to get the directory path. The official doc has a lot of examples, I personally prefer to be able to use whatever directory name I want, so I’m using a vhosts directory which contains symbolic links to the right directories. Like with DNSMasq before, you need to add only two lines of configuration here. Open /etc/apache2/extra/httpd-vhosts.conf (you’ll need to use sudo), and add the following lines at the end of it:

UseCanonicalName Off
VirtualDocumentRoot "/Users/baptiste/some/dirs/vhosts/%-2.0.%-1.0"

You may want to customize the path. This one takes the last two parts of the domain (i.e. the domain and the tld), and use the directory ~/some/dirs/vhosts/domain.tld/ for it. Note that it’ll use the same directory for bar.dev, foo.bar.dev, qux.foo.bar.dev, etc.

Then, use ln -s to make symbolic links from vhosts/ to the right directories, e.g.:

~/some/dirs/vhosts/foo.dev -> ~/sites/foo.dev
~/some/dirs/vhosts/bar.dev -> ~/perso/blog

If all the websites are in the same directory, you can skip the “symbolic links” part. Restart Apache with sudo apachectl restart (on Ubuntu, use sudo service apache2 restart), and you’re done. In the future, you won’t have to restart Apache for each new site, you need to restart it only when you modify its configuration.

If you get some issues with rewrite rules, add

RewriteBase /

in the .htaccess of the websites that use them, and it’ll work.

Writing Sensible Tests for Happiness

Fred Wu (@fredwu) — Mon, 26 Aug 2013 17:11:00 GMT

Finding YAML errors in puppet

The Technical Blog of James on purpleidea.com — Sun, 25 Aug 2013 07:31:49 GMT

I love tabs, they’re so much easier to work with, but YAML doesn’t like them. I’m constantly adding them in accidentally, and puppet’s error message is a bit cryptic:

Error: Could not retrieve catalog from remote server: Error 400 on SERVER: malformed format string - %S at /etc/puppet/manifests/foo.pp:18 on node bar.example.com

This happens during a puppet run, which in my case loads up YAML files. The tricky part was that the error wasn’t at all related to the foo.pp file, it just happened to be the first time hiera was run. So where’s the real error?

The Television Revolution

Zac Szewczyk — Sat, 24 Aug 2013 22:41:45 GMT

In an uncharacteristically long post from The Loop titled The state of Apple’s TV quest, Dave Mark made an interesting observation regarding Apple’s alleged impending entrance in to the television industry. The pertinent sentence — cited below — draws a parallel between the music industry prior to the introduction of iTunes and the television industry of today:

Permalink.

The MacRumors Buying Guide

Zac Szewczyk — Sat, 24 Aug 2013 22:41:38 GMT

On a recent episode of what I believe was Back to Work, Dan and Merlin mentioned in passing a great page on the MacRumors website offering buying advice for Apple products. Based on average product cycles and current rumors, the editors at MacRumors decide whether to give the green-light to purchasing a new Apple device, whether to caution against it in the case of a yellow light, or give a product the red light signifying their advice against purchasing it at this time. Even for those steeped in the Apple community and familiar with all the current rumors, this page is nice to keep around if you ever lose track of whether or not now is a good time to buy a new MacBook Pro.

Permalink.

Quickly navigate your filesystem from the command-line

Zac Szewczyk — Sat, 24 Aug 2013 22:41:33 GMT

Possessing the ability to write a CMS and code a website is great — don’t get me wrong — but it’s neat little scripts like this one that make me glad I learned to program.

Permalink.

China's Yellow Mountains

Zac Szewczyk — Sat, 24 Aug 2013 16:24:47 GMT

“Considering Huangshan’s extreme beauty, it’s not surprising that the area derives much of its significance from Chinese art and literature. It has inspired poets such as Li Bai, many Chinese ink paintings, and more recently, photography. According to Wikipedia, over 20,000 poems were written about the mountains between the Tang Dynasty (618-906) and the end of the Qing Dynasty (1614 to 1911). They’ve also inspired modern works, lending to the fictional world designed for James Cameron’s 2009 film Avatar.”

Seeing such majestic scenery as this mountain range is so common in many of today’s movies and TV shows, yet it takes an article like this to realize that such places do actually exist in the real world.

Permalink.

A Fantastic Yet Familiar Future of Machines in Nature

Zac Szewczyk — Sat, 24 Aug 2013 16:23:18 GMT

“His paintings show a universe much like our own, but beside the everyday humans carrying out everyday activities are massive buildings and machines running on technologies currently unknown.”

This is exactly the sort of article I subscribed to Visual News for. Very impressive.

Permalink.

Side Effects

🦉 olshansky 🦁 — Sat, 24 Aug 2013 08:02:53 GMT

Olshansky's review of Side Effects

Watch behind my shoulder: Debugging

My Own Fortune — Sat, 24 Aug 2013 02:30:51 GMT

Warning: long-winded tech post. If you don’t want to improve your debugging skills or don’t have lots of free time, don’t read this. I decided to do some pro-bono debugging, and as I was diving in I thought that some of you might be interested in a glimpse of how I work. I find that […]

Bellmanstafetten relay race - didn't die!

Liza Shulyayeva — Fri, 23 Aug 2013 21:22:20 GMT

Yesterday I took part in Bellmanstafetten - a 5km relay race - with other runners from DICE. We had three teams, one of which was aiming to beat last year’s company record for the race (I wasn’t on that one). We got shirts and everything!

Feedback pt. 2

Josh Thompson — Fri, 23 Aug 2013 03:00:00 GMT

Traditional Feedback is Explicit

Feedback is the means by which any system makes changes. From the gene pool to the swimming pool, feedback works to eliminate the insufficient and improve the sufficient. (See what I did with the “pool” thing?)

Your car gives you feedback if the oil is running low - this allows you to take corrective action before ruining your action. Your computer gives you feedback if its running hot - this allows you to save your work before your computer automatically shuts down, to cool off. Just about any system that can break has feedback mechanisms built in, so the user can evaluate the individual components of that system before the effect of poor performance ruins the whole thing.

Coaches and teachers give feedback, too. If your not throwing the ball right, or moving in exactly the right way, a good coach will give you feedback so you can improve. If your paper is not shaping up as it should, your teacher will give you feedback.

Here’s the problem - in each of these examples, there is a built-in system for feedback. If your car says the oil is low, or your gas is running out, you don’t get angry and stomp off. If your coach tells you how to do a specific move better, you (hopefully) don’t take it as a personal dig.

When It Is Not Explicit

In most areas of life, however, feedback is not built it. It just happens, if you happen to be looking for it or not. Users complaining about a problem (real or perceived) constitute feedback, even though they didn’t fill out a survey. If everyone you are talking to ends up leaving the conversation, they are giving you feedback, even though they’ll never tell you why they’re leaving.

These subtle forms of feedback are extremely valuable, and if you are attentive, you can learn a lot about how people relate to you, your product, and your ideas. I am not advocating reshaping yourself based on the subtle indicators ofothers, but you would be wise to be aware of the messages that are being sent. You can then pick and choose which to be attentive to.

Here are three areas where I’m trying to wrap my head around explicit vs. implicit feedback:

At my job, I talk with the users of our product regularly. They usually get in touch with us only when they are confused or their expectations have not been met. I could pass this off as user “confusion” or “user being disconnected from reality”, or I can think “their reaction is because something is not being communicated as it should be. Let me figure out what that is.”
I am intentional about trying to meet with people that I respect, so I can learn from them. Sometimes these attempts do not pan out - I could either dismiss the unsuccessful attempts as “he’s being a jerk” or “he must be really really busy”, or, I can think “Someone could figure out how to get in touch with this guy - what does that person know that I do not? How can I learn that too?’
Here is a reversal of implicit vs. explicit feedback: My wife is a source of tremendous joy to me. Her favorite things are different than my favorite things, however. She feels very loved if, as we’re driving somewhere far away, I pull over and make a spontaneous date out of a meal, rather than eating in the car. Whenever we’ve done this, she tells me in very plain words “This makes me feel loved. Thank you.” No matter how well I know this, I still regularly try to trick myself into thinking she doesn’t care that much, so we’ll just grab food while driving. In this last instance, I try to make explicit feedback (“This makes me feel loved”) into implicit feedback (“That was fun”) and then dismiss it. Not something I’m proud of, but its what I do, in order to get my way.

This is my thoughts on feedback. There is a lot of growth that can happen quickly if you pay attention to how things are received, and adjust accordingly.

Get at it.

Scalar Subqueries in Oracle SQL WHERE clauses (and a little bit of Exadata stuff too)

Tanel Poder Blog — Fri, 23 Aug 2013 00:03:25 GMT

My previous post was about Oracle 12c SQL Scalar Subquery transformations. Actually I need to clarify its scope a bit: the previous post was about scalar subqueries inside a SELECT projection list only (meaning that for populating a field in the query resultset, a subquery gets executed once for each row returned back to the caller, instead of returning a “real” column value passed up from a child rowsource).

I did not cover an other use case in my previous post – it is possible to use scalar subqueries also in the WHERE clause, for filtering the resultset, so let’s see what happens in this case too!

Note that the tests below are ran on an Oracle 11.2.0.3 database (not 12c as in the previous post), because I want to add a few Exadata details to this post – and as of now, 18th August 2013, Smart Scans don’t work with Oracle 12c on Exadata. This will of course change once the first Oracle 12c patchset will be released, but this will probably happen somewhere in the next year.

So, let’s look into the following simple query. The bold red part is the scalar subquery (well, as long as it returns 0 or 1 rows, if it returns more, you’ll get an error during query execution). I’m searching for “objects” from a test_objects_100m table (with 100 Million rows in it), but I only want to process the rows where the object’s owner name is whatever the subquery on test_users table returns. I have also disabled Smart Scans for this query so that the database would behave more like a regular non-Exadata DB for now:

SELECT /*+ MONITOR OPT_PARAM('cell_offload_processing', 'false') */
    SUM(LENGTH(object_name)) + SUM(LENGTH(object_type)) + SUM(LENGTH(owner))
FROM
    test_objects_100m o
WHERE
    o.owner = (SELECT u.username FROM test_users u WHERE user_id = 13)
/

Note the equals (=) sign above, I’m simply looking for a single, noncorrelated value from the subquery – it’s not a more complex (and unpredictable!) IN or EXISTS subquery. Let’s see the execution plan, pay attention to the the table names and execution order below:

------------------------------------------------------------------------------------------------------------
| Id  | Operation                              | Name              | Rows  | Bytes | Cost (%CPU)| Time     |
------------------------------------------------------------------------------------------------------------
|   0 | SELECT STATEMENT                       |                   |     1 |    33 |   405K  (1)| 00:52:52 |
|   1 |  SORT AGGREGATE                        |                   |     1 |    33 |            |          |
|*  2 |   TABLE ACCESS STORAGE FULL            | TEST_OBJECTS_100M |  7692K|   242M|   405K  (1)| 00:52:52 |
|*  3 |    TABLE ACCESS STORAGE FULL FIRST ROWS| TEST_USERS        |     1 |    12 |     3   (0)| 00:00:01 |
------------------------------------------------------------------------------------------------------------

   2 - filter("O"."OWNER"= (SELECT "U"."USERNAME" FROM "TEST_USERS" "U" WHERE "USER_ID"=13))
   3 - filter("USER_ID"=13)

That sure is a weird-looking execution plan, right?

Gotchas in the Ruby Sequel Gem

Fred Wu (@fredwu) — Wed, 21 Aug 2013 15:39:00 GMT

Post War but not Post Confict

Luke Singham — Wed, 21 Aug 2013 03:00:00 GMT

"What happened in Sri Lanka was a major Rwanda-like atrocity, in a different scale, where the West didn't care. There was plenty of early warning. This [conflict] has been going on for years and decades. Plenty of things could have been done [to prevent it]. But there was not enough interest." -N. Chomsky

A bloody civil war that gripped the island nation of Sri Lanka for over a quarter of a century came to a horrific end in 2009. The Liberation Tigers of Tamil Eelam (LTTE) were overwhelmingly defeated by the state led Sinhalese majority government forces. The atrocities committed by the state to reach such a conclusion have been vastly underreported. Estimates of civilian deaths in the final five months of the war range between 9,000 and 75,000 (BBC, 2013). One United Nations report puts the number at 40,000; most recently they have reported that up to 70,000 civilians could have died in the final 5 months (UN, 2011, & UN, 2012). If this is true, as Frances Harrison of the Guardian states, the magnitude of the estimated civilian deaths is on ‘the scale of Syria but condensed in speed into 5-6 months whereas Syria has been going on for 18 months [to] two years.’ Former Norwegian diplomat Erik Solheim said ‘There were massive war crimes in the last phase which were probably the biggest bloodshed of the twenty first century.’

A UN panel of experts reported that the government of Sri Lanka has engaged in:

Killing of civilians through widespread shelling
Shelling of hospitals and humanitarian objects
Denial of humanitarian assistance
Human rights violations suffered by victims and survivors of the conflict, including both Internally Displaced People (IDP) and suspected LTTE cadres
Human rights violations outside the conflict zone, including against the media and other critics of the Government

An insidious and well-planned strategy by the government has meant very little independent reporting, foreign aid bodies being prevented from going into the warzone and to date, the resistance of any post-war independent investigation.

The host of CHOGM (Commonwealth Heads of Government Meeting) is the same government, the same people who are ultimately responsible. The question of accountability will not go away, particularly for the Tamil people, but also for those courageous journalists now in exile who dared to question the government.

Sadly, the end of the war has not meant the end of human rights abuses perpetrated by the Sri Lankan government. The once Tamil controlled northern areas are now under military occupation. Many displaced Tamils are unable to return home since the government have seized their property for ‘military purposes’ or for ‘agricultural purposes’. Ongoing disappearances, rape, sexual abuse, land grabbing and beatings are stories that are still coming out of Sri Lanka leading some critics to call the post-war, but not post-conflict scenario a ‘structural genocide’. The Sri Lankan government is unsurprisingly against transparency and judicial independence, as demonstrated by the unconstitutional impeachment and removal of the Chief Justice earlier this year, further showing the abuse of power wielded by the Executive.

For many progressives, the recent Labor asylum policy announcement borne out of political pragmatism rather than compassion and morality has come as an utter disappointment. However, it raises the challenge of changing the hearts and minds of the electorate. This will occur through learning about the plight that refugees flee. Each country’s refugee has its unique and often complex story. This motion aims to shed light on the Sri Lankan Tamils’ story while also advocating for diplomatic pressure to be placed on the Sri Lankan Government.

What can we do about it?

International pressure has been shown to be an effective tool in pressuring governments to do the right thing. The Sri Lankan government may not care about the Tamils but they do care about the Commonwealth. A boycott of CHOGM would make a good start. Apartheid is a good example of an international sporting boycott that raised awareness and pressured a nation towards corrective action. A boycott of Sri Lankan cricket, I believe, would mount enough pressure both internationally and domestically on the government to accept the calls for an independent investigation into the final stages of the war.

If you would like to find out there are few links below:

Boycott CHOGM Petition

Documentaries

How to convert FLAC files from 24/48 bit to 16 bit on Ubuntu Linux

duncanlock.net — Tue, 20 Aug 2013 08:40:59 GMT

I recently needed to convert some FLAC music files from the increasingly common 48 bit encoding, down to 16 bit at 44100 kHz, so that they’ll play on my Sonos. Here’s how to do it:

If you don’t already have sox installed, do this to install it:

$ sudo apt-get install sox

Then run this to do the conversion, in the folder with music in:

$ mkdir resampled
$ for flac in *.flac; do sox -S "${flac}" -r 44100 -b 16 ./resampled/"${flac}"; done

And that’s it - it will convert all the .flac files in that folder to 16 bit at 44100 kHz and put the result into the ./resampled subfolder, preserving the metadata.

Things You Can't Do from Behind a Computer, pt. 1

Josh Thompson — Tue, 20 Aug 2013 03:00:00 GMT

Meet people.

Over the last nine or ten months, I can clearly remember a handful of conversations I had. I initiated each conversation with someone that I wanted to learn from. Most I had some prior relationship with (I.E. I had met them, or I knew someone who knew them). This was all precipitated by a useful and provoking post by Ramit Sethi. more

These conversations were not social events, although in each conversation I have enjoyed myself. Each meeting was an opportunity for me to learn more about how these people have done what they have done. I framed them in my mind as “informational interviews”. In other words , I interviewed them.

I’ve met with a company-leading salesman, two business consultants employed by one of the “big three” consultancies, a freelancer who runs a very successful production studio, a CEO, a CMO/Marketing Director, a UX designer, another UX designer/web developer, a senior project manager in the banking industry, and a lawyer. In every instance I asked similar questions:

What challenges have you faced, first in your career, and second on your job, in the last few months.
How has your career developed, and led you to this place.
How did you achieve X (x=prior mentioned achievement, or something on their LinkedIn profile - yeah, I stalk.)
What is the most enjoyable part of your day/job?
Where do you see your self in two or three years?

I ask more questions. I always ask for just fifteen or twenty minutes, and I stick to whatever time limit I’ve set, unless they want to go longer. Half of these conversations have been over the phone, the other half face-to-face. I have derived so much value from these conversations. They have contained plenty of career advice, actionable suggestions, and encouragement.

Here’s a few gems that have been consistent across all of these “informational interviews”:

Career growth is not sexy - spend time cultivating useful skills, and then spend time figuring out how to use those skills in a way that can benefit your company or your career.
Get out and meet people and learn from them.
Learn to solve problems for others, but be sure to communicate this in a way that makes sense to them.
Sometimes the best option is to quit a specific job ASAP.

The goal of these informational interviews is not self-promotion or trying to get hired. I think this is the quickest way to ruin a conversation, and, oh yeah - COMPLETELY MISSES THE POINT OF AN INFORMATIONAL INTERVIEW!

Finally, here is how I benefited, and why you can never possibly achieve the same benefit until you get out there and do the same:

Now, when meeting with anyone (stranger at a BBQ, long-lost family members, friends) I try to guide the conversation with two ideas in mind: How can I learn more about them, and what wisdom might they have to share. Believe me - this makes more a much more interesting conversation than weather and football.
I am getting better and better at engaging in mature conversation with competent people. This is a skill that can compensate for lack of technical depth, and can open up doors that otherwise would not be open.
I am able to hear very specific bits of advice and wisdom, consider how to apply it to my own life, then immediately ask if my interpretation is correct.
I am getting better at reading subtle indicators of how a conversation is going. (Hint - you should know when to end a conversation, and it should be before the other person is thinking about ending the conversation.)
I’ve had a number of job offers/offers to connect me with people who are hiring.
I still sometimes get indescribably nervous, and can feel my chest tighten and it feels like my voice must be shaking and I’m about to fall over. Insane, and embarrassing. I’m working on it. This happens sometimes in other situations and is intriguing. The more time I spend “there”, the more I’ll be able to handle it.
I have decided very concretely a few career options that I certainly do not want to pursue. (Consultant with Deloitte? What was once a dream now sounds like hell. No thanks.) The time savings alone of not wasting hours or days (or months, years, and thousands of dollars) are incalculable.

You don’t need impressive networking skills to set up a meeting. Here is the FIRST email I sent out, asking to meet up with someone:

Hey R,

This is Josh, from [company where I had met R]. N, a friend there, recently gave me your contact information and said I should get in touch with you.

I would love to take advantage of your offer to get in touch with you by chatting with you for fifteen or twenty minutes about the work that you do with [company], what led you to work with them, and what has led you to stick with them.

I will, of course, work around your schedule for a time to meet. If it is convenient I would love to buy you a cup of coffee at a location and time of your choosing.

Are you willing to set up a short meeting?

Thanks for your time!

Short, sweet, and it was so scary to send. This was what I sent, redundancies and all. I guess I should get a copy editor. The conversation I had with R was extremely helpful, encouraging, and still impacts me today. That was the first.

If you’re not sure what you want to do with your life, go start talking to people. I did not even know that User Experience and Design was a thing. I found out about it after some informational interviews and reading some books.

This is all I have for now, but please - take a step. Write down a list of three people you’d like to learn from. Make it happen. They’ll be flattered. Wouldn’t you be?

NetSuite’s Ridiculous Security Questions

huphtur — Tue, 20 Aug 2013 03:00:00 GMT

Netsuite is pretty powerful app but the UI and UX are seriously stuck in 1996. Some of their security questions are pretty ridiculous as well…

What was your childhood nickname?
What is the name of your favorite childhood friend?
What street did you live on in third grade?
What school did you attend for sixth grade?
What was your childhood phone number including area code? (e.g., 000-000-0000)
What was the name of your first stuffed animal?
What was the last name of your fourth grade teacher?
In what city did you meet your spouse/significant other?
What is your oldest sibling’s birthday month and year? (e.g., January 1900)
What is the middle name of your oldest child?
What is your oldest sibling’s middle name?
What is your oldest cousin’s first and last name?
In what city or town did your mother and father meet?
In what city does your nearest sibling live?
What is your oldest brother’s birthday month and year? (e.g., January 1900)
What is your maternal grandmother’s maiden name?
In what city or town was your first job?
What is the name of the place your wedding reception was held?
What is the name of a college you applied to but didn’t attend?

Guess which action I take every single time this screen pops up?

Update: Crap! Looks like Netsuite caught on to me…

Jobs Review: A Movie About a Titan Starring a Tit

Zac Szewczyk — Mon, 19 Aug 2013 19:02:11 GMT

“There’s a great movie to be made about the life of Steve Jobs, but Jobs is not it. The primary challenge in making a film about the co-founder of Apple is finding an actor who can play an overtly cerebral, egomaniacal dick, but a dick for whom you want to root. Besides a striking resemblance to the young Steve Jobs, Ashton Kutcher is a terrible choice: There’s nothing about his character that makes you want to root for him, and all of his attempts to depict Jobs as a dick are layered in frat-boy douchebaggery.”

I haven’t seen Jobs yet, but I absolutely love everything about this review, from the title to the closing paragraph. Easily one of the best articles I have read in quite some time.

Permalink.

An Untenable Goal

Zac Szewczyk — Mon, 19 Aug 2013 19:00:06 GMT

Although the first movie adaptation of Christopher Paolini’s Eragon could have passed as a mildly successful yet unremarkable summer movie, it falls far short when compared to the original series from which it borrowed little besides character names and basic plotlines, only to discard the latter whenever the “director” deemed it convenient. Anyone who has ever seen a book-turned-movie undoubtedly read that without any surprise; the book invariable proves better than the movie, or so that adage goes, and there are countless examples supporting the phrase in just the last year alone.

Permalink.

ShowMOS: How to get rid of the annoying “The Page has Expired” dialog in My Oracle Support

Tanel Poder Blog — Mon, 19 Aug 2013 15:00:58 GMT

So, how many of you do hate the dialog below?

Good news – there is a fix! (or well, a hack around it ;)

Before showing the fix, you can vote & give your opinion here:

The fix is actually super-simple. The page expiration dialog that grays out the browser screen is just a HTML DIV with ID DhtmlZOrderManagerLayerContainer, overlaying the useful content. If you want it to disappear, you need to delete or hide that DIV in the HTML DOM tree. The javascript code is below (I just updated it so it should work properly on IE too):

How not to run Midnattsloppet

Liza Shulyayeva — Sun, 18 Aug 2013 12:13:15 GMT

Midnattsloppet is a yearly night-time 10km race in Sweden, taking place in multiple cities including Stockholm. I’ve been signed up for months. It was yesterday. Let me tell you about it.

Trying out the Rearth Ringke Fusion Nexus 4 case

Liza Shulyayeva — Sun, 18 Aug 2013 11:43:52 GMT

(Note: this post was going to have pictures. Unfortunately my SD card is MIA. I’ll add them here when I can find it)

A Prayer for Heart Surgery

trv.rs — Sun, 18 Aug 2013 03:00:00 GMT

Six months ago I prayed that you would tear out the veil of flesh in my heart, bringing my will, hopes, and dreams all under your control. Now, I find that while you have been good to your promise, I have not. I continually fight to maintain control of my precious toys.

Forgive my willfulness. Continue your work of regeneration, the act of cosmic surgery. It is painful, but the cancer in my heart must be removed.

So come Lord. Bring the scalpel of your truth to my soul and excise all the blackness, all the necrotic desires of my old self. Illuminate my life, show all the places where my deeds of self-worship have diseased my dreams and twisted the structure of the man you want to make. Scrape, sever, sear, and suture every last bit of me away so that only you remain.

Give me the willingness to go under the knife every single morning, and grant me the patience as you put me through spiritual rehab. You are the great Physician, your hand is true and your knowledge of our workings is perfect as our Creator and Father. You knit me together, heart and soul, now unmake me and make me like Christ. I pray in Jesus' precious and powerful name, amen.

Photo: Welcome to Narnia

Journaling Prayer

trv.rs — Sat, 17 Aug 2013 03:00:00 GMT

For some time now, I have added to my morning devotions the exercise of writing a prayer. It was born out of a need for focus, as the act of composition and recording brings together all my faculties towards a single task. I'm writing, I'm thinking, I'm planning. It is so easy for me to become distracted in the morning, when all the day's needs and tasks rush at me. Journaling has been a real blessing.

It has the benefit of providing a record of my heart's state, a history of the concerns I have lifted to the Lord, a bitter reminder of the pain of sin, the sweet restoration of repentance, and of the glory of seeing the Lord work in my life despite me.

Up to this point, I have decided not to publish, share, or otherwise show people parts of this journal. I feared that knowing that other people might read it would taint the personal, raw, often painfully honest conversation I have had with the Lord. However, I realized tonight that it might be an encouragement, as I have often been mightily encouraged by Scotty Smith's blog.

With this goal in mind, I'm going to publish a few of them as I go... probably quite a while after I originally wrote them, and with any truly personal details excised. I hope they are some comfort to you, and perhaps will inspire you to try a similar discipline in your relationship with the Lord.

Photo credits: Let it flow - by evan travers

Trying Emacs

Srijan Choudhary, all posts — Fri, 16 Aug 2013 03:00:00 GMT

Bare bones emacs configuration from when I first started using Emacs

Language Skills

Zac Szewczyk — Thu, 15 Aug 2013 20:09:53 GMT

Whereas Matt appears to perhaps unintentionally relegate his condemnation to those producing poorly-formed written work for public consumption, I would take his advice one step further and apply it to every single written sentence, whether that fragment of prose is something so innocuous as a text message or important as a book. Regardless of the medium, there exists no suitable excuse for degrading the writers’ craft with poor work.

Permalink.

Call to fund research on an easy and COMPLETE alternative to Gmail, Facebook etc...

Welcome to Marco Fioretti's website! on Stop at Zona-M — Thu, 15 Aug 2013 11:50:09 GMT

Source: Ray MacLean on Flickr http://www.flickr.com/photos/raymaclean/3548172441/

</em></u>

UPDATE 2013/09/17: THIS PROJECT NOW HAS A HOME AT per-cloud.com

I have been using my own email service and self-hosted blogs since 2006/2007. I started explaining why everybody should do the same three years ago, when I proposed Virtual Personal Email Servers to overcome the big limits of today’s email. In 2011 I repeated why it is important to find alternatives to Gmail.

Since real support for privacy, control and data ownership should be present in everything we do online, last January I also pointed out that alternatives to corporate social networks already exist and only need proper packaging.

Now the Snowden/NSA/PRISM affair has finally made evident, to an audience immensely larger than geek circles, that I (with many others of course) was right. Everybody, including non-geeks (no: starting from them) should have, as soon as possible, at least the possibility to

Why Mailpile, FreedomBox, Diaspora... aren't enough

Welcome to Marco Fioretti's website! on Stop at Zona-M — Thu, 15 Aug 2013 09:47:38 GMT

On Feedback

Josh Thompson — Thu, 15 Aug 2013 03:00:00 GMT

Most of what makes us who we are is based on some sort of feedback obtained earlier in our life. By my best estimation, there are two types of feedback:

Explicit feedback , which comes in a little box labeled “this is feedback”, and is hard to miss.
Implicit feedback , which is unlabeled, and but for your attention to it, goes unnoticed.

By my age (mid-20s) most of my life has been guided by explicit feedback. As a baby, I was rewarded for doing things like crawling and disciplined when I tried to lick power outlets; as a young child I was rewarded for doing what I was told to do, and disciplined when I didn’t. As a student, I was rewarded with good grades when I did what I was told (“Learn this material in such a fashion that you can regurgitate it on a test with unique but similarly structured questions.”) or when I synthesized old ideas in old ways (“Make an assertion, defend it using intelligible thought and a passing understanding of the English language. No less than twelve pages.”)

Jobs come laden with explicit feedback. Being given a job usually comes with explicit feedback: “we are happy to bring you on board because of X, Y, and Z, and we think you’re a good fit for the role.” Ditto with raises, promotions, and “employee of the month” awards. More explicit feedback is available in the form of reprimands, and of course, being fired.

Relationships have explicit feedback. Someone verbally agreeing to be your friend or (in the case of my wife) agreeing to marry me is providing explicit. When they say “I hate it when [x]” or “I love [Y]”, this is explicit feedback. They are verbalizing their feelings.

The interesting thing about all this, though, is ** this: **implicit feedback can lead to so much growth. So much more growth than explicit feedback. If you are sensitive to others around you and have a sincere desire to learn, you can figure out how to kick butt at work, or in a relationship, or a lot of other things. Implicit feedback allows you to infer what is going on under the surface.

There are a lot of areas this applies to. Relationships, jobs, friendships, self-monitoring… I’ve hardly thought of them all.

If you apply this method to all areas of your life, I think the results could be quite interesting. This is an idea that has been rolling around in my head for a few days, and I want to keep fleshing out. There are some specific situations that this applies to me, and I’ll talk more about that soon.

Your feedback is welcome! (pah. of course it is.): In what areas do you wish you had more feedback in? In those areas, could you possibly be more attuned to implicit feedback?

Working in the Shed

Zac Szewczyk — Wed, 14 Aug 2013 21:19:41 GMT

When this article originally made its rounds, I saved it to Instapaper but put off reading the piece. With a title like “Working in the Shed”, I assumed Matt Gemmell had gone off the deep end and actually taken his Macbook out into a backyard shed in an extreme attempt at curbing his Twitter addiction. Having finally gotten around to reading his excellent article though, I’m here to say that Working in the Shed is much, much more than an anecdote about avoiding distraction. I won’t go any further though: go read the article yourself.

Permalink.

Contagion

🦉 olshansky 🦁 — Wed, 14 Aug 2013 11:08:07 GMT

Olshansky's review of Contagion

Speeding up compilation times for Libreoffice / C++ projects

Srijan Choudhary, all posts — Wed, 14 Aug 2013 03:00:00 GMT

Faster compile times for libreoffice (and other C/C++ projects)

My First Android Game: Izuna Drop

Mustafa Akın — Wed, 14 Aug 2013 00:33:01 GMT

As a part of my CS-319 Object-Oriented Software Engineering course, I developed a computer game with Nail Akıncı and Naime Nur Çadırcı, called Izuna Drop. It is a simple space shooter clone. As the design was more imporant in that course, the implementation was not very efficient, it was written on Java, and due to our bugs, it requried approximately 1 GB of memory. If you wonder what that looked like, it is avaialable on GitHub/Izuna.

The Rule of Thirds - followup

CRAIG KERSTIENS — Tue, 13 Aug 2013 23:55:56 GMT

Several months back I wrote about how we do higher level, long term planning within the Heroku Postgres team. If you haven’t read the previous article please start there.

The exercise or rule of thirds is intended to be approximate prioritization and not a perfect science. Since that time I’m familiar with some teams both in and out of Heroku who have attempted this exercise with varying levels of success. We’ve now done this process 4 times within the team and after the most recent exercise attempted to take some time to internalize why its worked well, creating some more specifics about the process. Heres an attempt to provide even more clarity:

Gather data ahead of time

Its really common to have a list things to work on, but knowing the impact of those is commonly pure speculation. There may be some people that talk to customers, but even then its a subset of your actual customer base. Going into the exercise as much data you can have ahead of time on impact of features and specific problems helps. In our case we do this by:

Surveying current customers and users
Surveying attriters
Engaging with customer facing teams to hear trends
Input from external parties such as analysts on trends

Allow for casual discussion

We typically conduct our planning exercise at an offsite, this is a multi-day time of team bonding, planning, hacking. We intentionally schedule our planning excercise towards the end of the offsite. This allows us to have updates/presentations frmo the data we’ve gathered and from those that are customer facing. Presentations are meant to be short and direct, discussion can flow casually after. This gets a lot of people on the same page at a smaller level and reduces the problem of too many cooks in the kitchen come time for the actual exercise.

The rule of thirds

Creating the list

Coming to the exercise itself… We begin by everyone writing a list of their ideas individually, this is meant to be a list of the features we want to place on the grid. At this point theres no prioritizing of difficulty or impact. In addition each list while individually created does not have to contain items that only pertain to you, its more a comprehensive list of all the things you can think of that may be important to do.

Bucketing part 1

Once individual lists are created you can then collectively or designate one or two people to clean it up. We do this in two forms:

Removing duplicate items, which there should be several of.
Bucketing my a common/theme idea, this simply makes things more digestable

If you’re a big group of greater than 7 then it may be advisable to designate two people to do this exercise together. If a smaller group it can be manageable to coordinate collectively.

Bucketing part 2

Once you’ve removed dupes, identified themes, and removed excess items (depending on your team size you’ll find how many feels right - we aim an average of 5-6 per square for a team of 10) its then on to actually putting them on the grid. In the past we’ve done this a variety of ways but our most recent process seemed to be quiet efficient. We gave each item 60 seconds, at the end of that minute wherever the item was it was left there. This forced some quick discussion on impact and difficulty but in the end left us at a very good hit rate without taking multiple hours to complete the exercise.

Final pass

We intentionally design it so that low effort and high impact is on the top right corner. Finally once everything is on there we allocate names to the tasks, and put boxes around items we’re planning to do in the coming months. With boxes make it very clear of what we are doing as well as explicitly things we are not. The initials or names make it clear of how loaded down people are. If your name is on 3 tasks that are high difficulty, then you’re likely over allocated.

At this point things usually fall out pretty quickly and we emerge with some rough roadmap that in retrospect we’ve followed pretty accuately.

Oracle 12c: Scalar Subquery Unnesting transformation

Tanel Poder Blog — Tue, 13 Aug 2013 17:55:27 GMT

I promised to write about Oracle 12c new features quite a while ago (when 12c got officially released), but I was actually on (a long) vacation then and so many cool 12c-related white-papers and blog entries started popping up so I took it easy for a while. I plan to be focusing on the less known low-level internal details anyway as you see from this blog entry.

As far as I can remember, Oracle has been able to unnest regular subqueries since 8i and merge views since Oracle 8.0.

First, a little terminology:

Update: I have changed the terminology section below a bit, thanks to Jason Bucata’s correction. A scalar subquery sure can also be used in the WHERE clause (as you can see in the comments). So, I clarified below that this blog post is comparing the “Scalar Subqueries in SELECT projection list” to “Regular non-scalar Subqueries in WHERE clause”. I also wrote a Part 2 to explain the scalar subqueries in WHERE clause.

A “regular” subquery in Oracle terminology is a query block which doesn’t return rows back to the select projection list, but is only used in the WHERE clause for determining whether to return any rows from the parent query block, based on your specified conditions, like WHERE v IN (SELECT x FROM q) or WHERE EXISTS (SELECT x FROM inner WHERE inner.v=outer.v) etc.

The subquery can return zero to many rows for the parent query block for evaluation.

A scalar subquery is a subquery which can only return a single value (single row, single column) back to the parent block. It can be used both in the WHERE clause of the parent query or right in the SELECT list of the parent query instead of some column name. (In this post I am discussing only the case of a scalar subquery in SELECT clause). Whatever the scalar subquery returns, will be put in the “fake” column in the query result-set. If it returns more than one row, you will get the ORA-01427: single-row subquery returns more than one row error, if it returns no rows for the given lookup, the result will be NULL. An example is below.

I crafted a very simple SQL with a scalar subquery for demo purposes (the tables are just copies of all_users and all_objects views):

SELECT
    u.username
  , (SELECT MAX(created) FROM test_objects o WHERE o.owner = u.username)
FROM
    test_users u
WHERE
    username LIKE 'S%'

Now, why would you want to write the query this way is a different story. I think it’s actually pretty rare when you need to use a scalar subquery, you usually can get away with an outer join. I have used scalar subqueries for populating some return values in cases where adding a yet another (outer) join to the query would complicate the query too much for my brain (as there are some limitations how you can arrange outer joins). I have only done this when I know that the query result-set (on which the scalar subquery is executed once for every row returned, unless the subquery caching kicks in!) will only return a handful of rows and the extra effort of running the scalar subquery once for each row is acceptable.

Nevertheless, non-experienced SQL developers (who come from the procedural coding world) write lots of scalar subqueries, even up to the point of having every single column populated by a scalar subquery! And this can be a serious problem as this breaks the query into separate non-mergeable chunks, which means that the CBO isn’t as free to move things around – resulting in suboptimal plans.

So, starting from Oracle 12c (and maybe even 11.2.0.4?), the CBO transformation engine can unnest some types of the scalar subqueries and convert these to outer joins internally.

C# Vector Space Implementation

Ben E. C. Boyter — Tue, 13 Aug 2013 08:59:09 GMT

Since I am writing lots of Vector Space implementations in Go, Python etc… I thought I would add another one in C#. This one is a little more verbose then either the Python or Go implementations. The verbosity is mostly due to not using any of the nice C# LINQ functionality which would really reduce the size.

In any case here it is in case you are looking for a simple implementation of this useful class.

Jim Dalrymple on Apple's rumored September 10 iPhone event

Zac Szewczyk — Tue, 13 Aug 2013 01:20:21 GMT

Well, there goes that theory.

Permalink.

The new Instapaper web beta

Zac Szewczyk — Tue, 13 Aug 2013 01:02:55 GMT

With the beta release of Instapaper’s newly overhauled and undeniably much more attractive website, we are finally beginning to see some of the great new features Marco sold Instapaper to Betaworks for. As I said in What Happened to Instapaper?, I’m very excited to see where the company takes Instapaper in the near future. A new website was a wonderful place to begin.

And for those thinking Betaworks has sat on their hands for the last four months, Marco Arment dispels that notion in his blog post responding to the announcement:

“Betaworks has only owned Instapaper for a few months so far, and they’ve already hired a staff, moved the entire infrastructure to AWS, improved support, rewritten much of the back end, and overhauled the website design.”

This is a very promising start. Next up: a new version of Instapaper for iOS, likely to be released around the same time iOS 7 hits the market.

Permalink.

Are You a Real Writer?

Zac Szewczyk — Tue, 13 Aug 2013 00:58:17 GMT

Can’t say I love the site, but his flow chart is excellent. That’s all there is to it, folks; it’s not too complicated.

Permalink.

GoLang Vector Space Implementation

Ben E. C. Boyter — Mon, 12 Aug 2013 09:51:30 GMT

UPDATE – This is now actually available as a real Golang import with tests. Get it at https://github.com/boyter/golangvectorspace

I have mentioned this before somewhere but one of the first things I usually attempt to implement in any programming language I want to play with is a vector space. Its my own personal FizzBuzz implementation. It usually covers everything I need to know in a language (imports, functions, string manipulation, math functions, iteration, maps etc…) so I consider it a good thing to get started with.

20 Things 20-Year-Olds Don't Get

Josh Thompson — Mon, 12 Aug 2013 03:00:00 GMT

Jason Nazar recently wrote an article titled 20 Things 20-Year-Olds Don’t Get.

Please read it, but with a big grain of salt.

Nazar opens with the statement “I made a lot of mistakes along the way, and I see this generation making their own.”

This seems to be an aspirational list, rather than scolding, but it sure does feel like scolding.

I thought I’d give my own feedback, as a member of the “20-somthings club” for four years.

In Nazar’s defense, he has two challenging constraints - brevity and clicks. He covers a lot of ground in just a few words, and his article is posted to generate clicks, not necessarily to deliver nuanced perspective to the reader.

Here we go. Italicized words are mine: more

Time is Not a Limitless Commodity – I so rarely find young professionals that have a heightened sense of urgency to get to the next level. In our 20s we think we have all the time in the world to A) figure it out and B) get what we want. Time is the only treasure we start off with in abundance, and can never get back. Make the most of the opportunities you have today, because there will be a time when you have no more of it.

Partially right - time is the most important resource, and can be easily wasted or squandered on dumb things, like obsessing over achieving “the next level” in your career. No one has said on their death bed “I wish I spent more time at work.” Time is valuable, and must not be wasted, but all your time should not be spent on your career; you’ll be worse at your job, bad at relationships, and have nothing to remember about your life but disliking your commute.

2. You’re Talented, But Talent is Overrated - Congratulations, you may be the most capable, creative, knowledgeable & multi-tasking generation yet. As my father says, “I’ll Give You a Sh-t Medal.” Unrefined raw materials (no matter how valuable) are simply wasted potential. There’s no prize for talent, just results. Even the most seemingly gifted folks methodically and painfully worked their way to success. (Tip: read “ Talent is Overrated”)

Nazar is 100% right - but for most people, they’ve grown up in a school system that relentlessly rewards existence, not results. It is not fulfilling to be rewarded for existing - people are fulfilled when doing meaningful work, and a lot of young folks have been kneecapped by being told (usually be an older generation) that “they have what it takes” and “everyone is unique”. This disconnect from producing hurts everyone.

3. We’re More Productive in the Morning – During my first 2 years at Docstoc (while I was still in my 20’s) I prided myself on staying at the office until 3am on a regular basis. I thought I got so much work done in those hours long after everyone else was gone. But in retrospect I got more menial, task-based items done, not the more complicated strategic planning, phone calls or meetings that needed to happen during business hours. Now I stress an office-wide early start time because I know, for the most part, we’re more productive as a team in those early hours of the day.

Again, 100% right, but he belies his priorities - what’s the problem with working until 3am? It’s not just a productivity issue, it is a priority issue. I love mornings, and usually get up before 6am to do the “complicated strategic planning” things I need to do for my life. I once worked 90 hours a week for a business - not only did my work quality suffer, I abdicated all sense of priority in my life to my employer. I will never do this again - I have a wife, and a life.

4. Social Media is Not a Career – These job titles won’t exist in 5 years. Social media is simply a function of marketing; it helps support branding, ROI or both. Social media is a means to get more awareness, more users or more revenue. It’s not an end in itself. I’d strongly caution against pegging your career trajectory solely to a social media job title.

20-somethings are not the only ones guilty of this. Also, since we were just talking about delivering results (and therefore value) if you can deliver value to a business via social media, get to it. I’ve come across dozens of small businesses that have no Facebook page, or any other web presence. You’ll never get paid to just tweet for a company, but if you can help them enter the arena in which most of their potential customers do business, you’re growing their bottom line.

5. Pick Up the Phone – Stop hiding behind your computer. Business gets done on the phone and in person. It should be your first instinct, not last, to talk to a real person and source business opportunities. And when the Internet goes down… stop looking so befuddled and don’t ask to go home. Don’t be a pansy, pick up the phone.

I have nothing to add to this. He hits it on the head. You can connect with people over the phone in a way you cannot in an email. Since business is about relationships, you should figure out how to build relationships. Relationships can be built over the phone. They are hard to build over email.

6. Be the First In & Last to Leave – I give this advice to everyone starting a new job or still in the formative stages of their professional career. You have more ground to make up than everyone else around you, and you do have something to prove. There’s only one sure-fire way to get ahead, and that’s to work harder than all of your peers.

This is wrong, and it is t he most damaging item on the list . Again, we have been talking about adding value to a business. If you can add 3 units of value/hour to a company for 10 hours a day, or add 6 units of value/hour for 8 hours a day, which is better for your company? That is 30 units of value vs. 48 units of value. Excuse my arbitrary measuring, but the emphasis is not”work longer”, it’s work smarter. Obviously, don’t slack off, but don’t hand your soul over to your business. Work hard at meaningful work. Simple as that.

7. Don’t Wait to Be Told What to Do – You can’t have a sense of entitlement without a sense of responsibility. You’ll never get ahead by waiting for someone to tell you what to do. Saying “nobody asked me to do this” is a guaranteed recipe for failure. Err on the side of doing too much, not too little. (Watch: Millennials in the Workplace Training Video)

You should never have a sense of entitlement, even if you have a sense of responsibility. Yes, do too much rather than too little. If you watch that video and find it anything but condescending and not that funny, you can probably stop reading now.

8. Take Responsibility for Your Mistakes – You should be making lots of mistakeswhen you’re early on in your career. But you shouldn’t be defensive about errors in judgment or execution. Stop trying to justify your F-ups. You’re only going to grow by embracing the lessons learned from your mistakes, and committing to learn from those experiences.

Agreed. This holds true for all ages, and not taking responsibility for mistakes afflicts everyone, regardless of age. Be someone who takes responsibility, not someone who avoids it.

9. You Should Be Getting Your Butt Kicked – Meryl Streep in “The Devil Wears Prada” would be the most valuable boss you could possibly have. This is the most impressionable, malleable and formative stage of your professional career. Working for someone that demands excellence and pushes your limits every day will build the most solid foundation for your ongoing professional success.

He’s wrong. You should be growing, but Streep would be a terrible boss. If her direct reports (terrible word) manage her staff the same way she manages them, it’ll turn the entire company into picking on everyone one rung down the ladder. That’s toxic to the success of a company. If Nazar is down with this management style, I feel sorry for his staff.

10. A New Job a Year Isn’t a Good Thing – 1-year stints don’t tell me that you’re so talented that you keep outgrowing your company. It tells me that you don’t have the discipline to see your own learning curve through to completion. It takes about 2-3 years to master any new critical skill, give yourself at least that much time before you jump ship. Otherwise your resume reads as a series of red flags on why not to be hired.

I am confident that Nazar hires the best employees he can, and I bet even he has broken this implicit rule when hiring. Since a business is (or should be) interested in delivering value, if a candidate has moved around every year or so, but delivers value and understands the implications of that rapid movement, there shouldn’t be any concerns.

11. People Matter More Than Perks – It’s so trendy to pick the company that offers the most flex time, unlimited meals, company massages, game rooms and team outings. Those should all matter, but not as much as the character of your founders and managers. Great leaders will mentor you and will be a loyal source of employment long after you’ve left. Make a conscious bet on the folks you’re going to work for and your commitment to them will pay off much more than those fluffy perks.

Good people will take care of their staff, and provide appropriate “fluffy perks” when it matters to staff. Staff deliver value, happy staff deliver more value. Take care of your staff.

12. Map Effort to Your Professional Gain – You’re going to be asked to do things you don’t like to do. Keep your eye on the prize. Connect what you’re doing today, with where you want to be tomorrow. That should be all the incentive you need. If you can’t map your future success to your current responsibilities, then it’s time to find a new opportunity.

Yes. But don’t be a pushover. Don’t do 90 hour weeks. Work harder than your coworkers, and deliver more value, but don’t be a pushover. Life is too short to spend three years sucking up st work for a jerk of a manager - and doing this will change who you are. You will **become one who does that which you do not want to do. Draw the line.

13. Speak Up, Not Out – We’re raising a generation of sh-t talkers. In your workplace this is a cancer. If you have issues with management, culture or your role & responsibilities, SPEAK UP. Don’t take those complaints and trash-talk the company or co-workers on lunch breaks and anonymous chat boards. If you can effectively communicate what needs to be improved, you have the ability to shape your surroundings and professional destiny.

Conflict is inherent in relationships, and conflict management/resolution/however you want to label it is possibly the most valuable skill you can have. As you learn to get stuff done and deliver value, you will inevitably run the risk of stepping on toes. You can either complain about the stick-in-the-mud that can’t handle your amazing money-making ideas, or you can figure out how to work within the framework of your business to make change happen. There are people that do this all day for the government, so if you work in the private sector, it’s totally possible. If it’s still not possible to make change happen, leave your job.

14. You HAVE to Build Your Technical Chops – Adding “Proficient in Microsoft Office” at the bottom of your resume under Skills, is not going to cut it anymore. I immediately give preference to candidates who are ninjas in: Photoshop, HTML/CSS, iOS, WordPress, Adwords, MySQL, Balsamiq, advanced Excel, Final Cut Pro – regardless of their job position. If you plan to stay gainfully employed, you better complement that humanities degree with some applicable technical chops.

True. Learn to code, design, or whatever.Learn things. If you don’t have time to learn things, make time.

15. Both the Size and Quality of Your Network Matter – It’s who you know more than what you know, that gets you ahead in business. Knowing a small group of folks very well, or a huge smattering of contacts superficially, just won’t cut it. Meet and stay connected to lots of folks, and invest your time developing as many of those relationships as possible. (TIP: Here is my Networking Advice)

It’s not just “networking”, but it’s “relationship building”. Unless you know everything there is to know about anything you’d like to know about, you stand to benefit from building relationships. As you build these relationships, deliver value. Sometimes (especially if you’re young) the experience and knowledge ratio is so one-sided the only thing you can deliver is a heart-felt “thank you for your wisdom, and your time.” This counts as delivering value, so get out there and meet people. Learn from them.

16. You Need At Least 3 Professional Mentors – The most guaranteed path to success is to emulate those who’ve achieved what you seek. You should always have at least 3 people you call mentors who are where you want to be. Their free guidance and counsel will be the most priceless gift you can receive. (TIP: “ The Secret to Finding and Keeping Mentors”)

If you don’t yet have mentors, just go meet professionals and experts. Even a mortician (if they are really good at what they do) has a lot to tell you about building a business, empathizing with customers, and mastering a craft. If you can’t see past the dead people, you probably are not ready for a professional mentor anyway.

17. Pick an Idol & Act “As If” – You may not know what to do, but your professional idol does. I often coach my employees to pick the businessperson they most admire, and act “as if.” If you were (fill in the blank) how would he or she carry themselves, make decisions, organize his/her day, accomplish goals? You’ve got to fake it until you make it, so it’s better to fake it as the most accomplished person you could imagine. (Shout out to Tony Robbins for the tip)

Again, yes. Have mentors, friends, and role models. It’s OK if they are imaginary.

18. Read More Books, Fewer Tweets/Texts – Your generation consumes information in headlines and 140 characters: all breadth and no depth. Creativity, thoughtfulness and thinking skills are freed when you’re forced to read a full book cover to cover. All the keys to your future success, lay in the past experience of others. Make sure to read a book a month (fiction or non-fiction) and your career will blossom.

He speaks truth. If you like what you read here, you may enjoy these books.

19. Spend 25% Less Than You Make – When your material needs meet or exceed your income, you’re sabotaging your ability to really make it big. Don’t shackle yourself with golden handcuffs (a fancy car or an expensive apartment). Be willing and able to take 20% less in the short term, if it could mean 200% more earning potential. You’re nothing more than penny wise and pound-foolish if you pass up an amazing new career opportunity to keep an extra little bit of income. No matter how much money you make, spend 25% less to support your life. It’s a guaranteed formula to be less stressed and to always have the flexibility to pursue your dreams.

The last four points are worth this entire article. Even the dumb stuff is far outweighed by these items. Please apply these to your life, starting today. Read I Will Teach You To Be Rich to get started.

20. Your Reputation is Priceless, Don’t Damage It – Over time, your reputation is the most valuable currency you have in business. It’s the invisible key that either opens or closes doors of professional opportunity. Especially in an age where everything is forever recorded and accessible, your reputation has to be guarded like the most sacred treasure. It’s the one item that, once lost, you can never get back.

Rather than treating your reputation as a finite, delicate item like fine china, get out there and make honorable choices with courage. If you always try to do the right thing, care for others (especially if they are “below” you), and focus on serving customers and staff, you will not be damaging your reputation, you’ll be improving it. If you are one to cheat, steal, and beg, maybe you should keep that on the DL, but it’s not exactly a sustainable lifestyle.

There was useful stuff in this article, but I wanted to add my two cents. Thanks for reading, and let me know if you agree or disagree. I’m open to it all!

Unfair Platform Advantage

Zac Szewczyk — Sun, 11 Aug 2013 22:19:43 GMT

I devoted my last post to discussing Ina Fried’s prediction of a September 10th iPhone launch date, forgoing my thoughts on the article itself and its rise to popularity over the last twenty-four hours. From my opening paragraph:

Permalink.

The September iPhone Launch

Zac Szewczyk — Sun, 11 Aug 2013 22:19:12 GMT

Earlier this morning, as I scrolled through my RSS reader, I came across a number of articles mentioning an unassuming and altogether unremarkable AllThingsD piece by Ina Fried. Despite its lukewarm tone, the prediction of a September iPhone launch event ran the gamut of popular tech sites and garnered a great deal of attention even though it said nothing surprising or even particularly interesting at this point. Setting that aside for a future article though, I would like to focus on the rumor itself.

Permalink.

Why E-Mail made in Germany is a farce

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sun, 11 Aug 2013 14:32:40 GMT

Security-wise, the last few weeks have been interesting, to put it mildly. After much idle assertions about how our intelligence services have never acted outside the law (pinky promise, I swear!), finally something good has happened: GMX, T-Online, and WEB.DE introduced E-Mail made in Germany, a new initiative with “high standards for security and privacy”. With these players on board, we can finally show those bad Americans how E-Mail is done! German efficiency and all that stuff…

Unfortunately, this initiative is a farce. These companies really try to hoodwink their prospective customers. Big time. Let me explain why this sort of advertising makes me angry.

What is wrong with the advertisement?

First of all, they advertise the fact that their servers understand SSL encryption. Well, it’s 2013, so any mail server that comes even close to deserving that name offers SSL encryption. If the server of your provider doesn’t, you should really think hard about doing any further business with them. Besides, it seems like what they are really talking about is STARTTLS, meaning that your insecure connection can now be encrypted to a secure one. Great–what year was it again? 2002?

Second, they talk about how the transmission between servers is encrypted, but only if you use their servers. Their advertisement even has the gall to belittle other e-mail providers. Money quote (loosely translated): “Sending e-mails to other providers such as Google, Yahoo, or Microsoft, is of course still possible. However, for these providers, neither secure transmission nor (exclusive) data processing in Germany can be guaranteed”. To me, this sounds slightly threatening: “What a nice INBOX. It would be a terrible shame if something were to happen to it”. Cue the images of the standard German villains from movies (you know which ones I am thinking about).

Third, data processing is apparently exclusively done in Germany, using “secure data centres” and the “high standards of German privacy laws”. I couldn’t care less. While our courts have already established some sort of “basic human right to privacy”, our security agencies still don’t give a fig. Let me just drop the keyword Bundestrojaner (literally: federal trojan) here.

Fourth, and last, they try to use E-Mail made in Germany to pave the way for De-Mail. De-Mail is the idea of offering a new e-mail service to send legally-binding e-mails. While this may sound like a good idea, the actual implementation suffers from essentially the same.

What is wrong with E-Mail made in Germany and De-Mail?

In short, it does not offer end-to-end encryption. This means that while the connection from your device to the server is encrypted, the data is still stored in plain text. Even if data is encrypted when being transmitted between different providers, it still is stored in plain text somewhere. Let me reiterate: The data is stored in plain text. In plain text. Somewhere.

This implies that any malevolent individual or organization simply needs to obtain access to one of the servers to obtain all sorts of communications data. The fact that there is an encrypted connection between your device and the server simply ensures that the customers of the Starbucks you are sipping your latte in cannot easily see what you are sending. Other than that, the encryption is worthless.

For De-Mail, it gets even worse: Since your e-mail is legally binding, you might have a hard time to prove that an attacker modified an e-mail or sent it without your involvement.

Isn’t this all very academical?

No. E-mails have been forged and read by unauthorized persons. Disgruntled ex-employees, employees with voyeuristic tendencies, and so on. I don’t say that this is going to happen to you with a very high probability. But it still might. The possibility is not that far-fetched.

Are there any solutions?

Plenty! S/MIME and GPG (PGP) are two standards that can be used to obtain end-to-end encryption between two parties. Both systems could also be made legally binding, if any government desired to do so. It really is just a matter of identifying a person (which is what a government should be good at) and certifying it. I mean this both figuratively and literally. For S/MIME, each participant requires a certificate. For GPG, each participant creates a private key that is signed off by other participants to ensure a valid identity.

Both standards would be viable alternatives, yet almost no one uses them. Neither do governments endorse them to make e-mail legally binding. To make a wild guess, I think this is related to the fact that most people still think that any form of encrypted communication necessarily implies that both participants are criminals. If you are one of these people, convincing you is beyond the scope of this rant and almost certainly beyond the scope of my argumentative powers.

Do you have some sources?

Upon re-reading this article, I see that I made some outlandish statements here, regarding the possibilities of privacy violations for ordinary citizens. Here’s a list of cases where e-mail privacy has been violated:

Lavabit ceases operations.
How the German police used their trojan horse to identify petty thieves and small-time drug dealers (article is in German). This one is not so much about email privacy violations but more about what German police considers to be adequate surveillance.
How an NYPD detective allegedly hacked 40 e-mail accounts to spy on his ex-girlfriend.
WikiLeaks volunteer gets e-mails seized by US District Court for the Eastern District of Virginia. He also has a more detailed account on his personal website.
The tabloid News of the World apparently hacked some e-mail accounts, as well. They also got some flak for illegal access to voicemails.

These are some articles that pertain to e-mail access specifically. There are others about (illegal) surveillance and abused privacy.

To end on a happy note…

I do not mean to sow despair, but rather to inform on shallow double standards and false advertising. If you use e-mail and do not wish to encrypt it, simply treat it more like a postcard. Do not talk about things that you consider too private. The same goes for chats on social networks, for example.

I mean to write about simple tools for encrypting your data some time soon. In the meantime, you may want to take a look at these great articles:

Get RFCs in Your Terminal

Baptiste Fontaine’s Blog — Sun, 11 Aug 2013 13:16:00 GMT

When working with Internet protocols, we have to read RFCs a lot. They can be found on the Web, but it’s better to have them directly in the terminal. Ubuntu provide some packages to have them offline, but if you aren’t a sudoer, you can’t install them with apt-get. So I needed a little script to fetch RFCs from IETF’s website and read them locally.

Here comes rfc

rfc was initially a small Bash script (~5 lines) that cURL-ed RFCs and displayed them with less. I used it for the Networking class at Paris Diderot. A few weeks ago, I enhanced it with a local cache (it now download an RFC the first time only), and an offline search feature. Thanks to ecksun, it can also be used to read drafts. The script works pretty much everywhere, and is really simple to use:

$ rfc <number>

For example, get the RFC 6749 (OAuth 2.0) with:

$ rfc 6749

That’s all! Since it’s just plain text, you can pipe it or redirect its output to anything:

$ rfc 42 | lolcat        # rainbow RFC
$ rfc 4534 > rfc4534.txt # local copy

Install

Since that’s a standalone Bash script, you can put it where you want, but the directory must be in your PATH. Here is a basic install:

mkdir -p ~/bin
curl https://raw.github.com/bfontaine/rfc/master/rfc > ~/bin/rfc
chmod u+x ~/bin/rfc

If you don’t have ~/bin in your PATH, add this line in your ~/.bashrc:

export PATH="$HOME/bin:$PATH"

The only requirements are a pager (less is the default, but it’ll use $PAGER if it’s set) and curl (it’ll use $CURL if it’s set, and fallback on wget if curl can’t be found).

For more info, check the project on GitHub.

Shortstory: Die Flut-Hilfe-App - Hochwasserhilfe per Smartphone

Philipp Zentner — Sat, 10 Aug 2013 11:12:15 GMT

flut.stomt.de, Hochwasser-Hilfe

Ich hatte in diesem Blog noch gar nichts von der Flut-Helfer-Koordinations-App erwähnt. Ein Blogpost, der schon längst hätte früher passieren müssen.

Was in den letzten zwei Monaten geschah:

Selbst von der Flut betroffen, kam mir nach einer Woche Schaufeln und Menschenketten bilden die Idee, die Helfer-Koordination („wie viele werden wo gebraucht?“, „wer geht wo bereits hin?“) über eine App einfacher und effizienter zu gestalten.

Die App arbeitet mit einer cookie-basierten Wiedererkennung (Wiedererkennung nur temporär notwendig), welche es dem Nutzer erspart, sich zu registrieren oder einzuloggen.

Almost Two Years On: Where is SDN?

rob.sh — Sat, 10 Aug 2013 09:47:17 GMT

Almost two years ago I wrote a post on this site entitled Some Initial Thoughts on the SDN. Clearly, since then the SDN concept gained some more legs (and entered a new stage of the hype cycle) - so, where are we right now?

Firstly, I think its fair to say that the concept presented by Scott Shenker of having a single centralised computational element controlling COTS OpenFlow-speaking switches has fallen out of favour somewhat (based on the discussions with other network architects, engineers, and implementors that I have had). Somewhat as predicted, there are real challenges with this approach within high-scale, distributed networks:

Online photo printing prices in NZ

Rich Dougherty — Fri, 09 Aug 2013 12:30:00 GMT

Idleness by Douglas Dunn

ho.dges.online — Thu, 08 Aug 2013 03:00:00 GMT

Can you hear them? The flap of a butterfly.
The unfolding wing of a resting wren.
The sigh of an exhausted garden-ghost.
A poem trapped in an empty fountain pen.

Version Number 0: A New Way to Do Software Versions

Justin Garrison's Homepage — Thu, 08 Aug 2013 03:00:00 GMT

I had this idea while driving into work with a friend and, like a lot of my ideas, I just wanted to

The missing PostgreSQL documentation

CRAIG KERSTIENS — Wed, 07 Aug 2013 23:55:56 GMT

For a couple of years I’ve complained about the Postgres documentation and at the same time paraded it as one of the best sets of documentation I’ve encountered. In many ways the reason I veer towards Postgres as well as Python and Django is the quality of their documentation. If you need to find details about something its documented, and more importantly well and thoroughly documented.

In large part I came to Python by happenstance through Django, and Postgres through happenstance of an employer. Yet, Django was very little of an accident. The Django Tutorial got me a large part of what I needed to know and more excited about development than I had been in some time. Python has done some work at adding docs to make this even better, sadly its still very much needed for PostgreSQL.

Whats Missing in the Postgres Docs

Theres a huge variety of types of documentation, off the top of my head theres:

Reference docs (Postgres excels at this)
Onboarding (Postgres tutorial huh?)
Tailored guides (Postgres? I can haz? Nope… We don’t understand….)

Postgres is great if you know the name of what you’re looking for, but if you don’t you’re entirely left in the dark.

Understanding the power of Postgres

Postgres is good enough at performance, good enough at usability, and awesome at how powerful and flexible it can be. But all of this is entirely lost if you have to know the esoteric name of what you’re looking for.

What the hell is an hstore… In so many ways KVstore makes infintely more sense. In the same sense PLV8, I have to know not only what PL stands for but V8 as well, versus the JavaScript extension for Postgres.

I understand there are plenty of reasons why some of these things are the way they are, but its also limiting how great the broader perception is. Postgres externally is this hard to use DB, that well is just a database, versus giving developers a set of powerful and useful functions to make their lives better.

The Solution

Lets fix things, there are a ton of people that would love to know more about all things Postgres. This ranges from a good set of onboarding docs, to specific blog posts on topics that people are curious about. Just last week I got an email about improving the Postgres tutorial… Yes theres a tutorial hidden in the 2000 page set of documentation for Postgres. Its simply old, mostly uninteresting, and well just needs to be completely recreated. A great alternative would be a few tutorials/guides for:

Noobs to databases in general (Total 101 guide)
Building and architecting your application with Postgres (App Devs)
Administering and maintaining Postgres (DBAs)
SQL and reporting in Postgres (consumers of data, analysts, product people, marketing, etc.)

If jumping in and contributing to fixing the core tutorial isn’t your cup of tea because you don’t want to learn and write in SGML, send a pull request to postgresguide.com or do a [guest post on my blog](mailto:craig.kerstiens@gmail.com]. If thats too much effort please just let us know, what do you want to see - craig.kerstiens at gmail.com

While We're Trying To Follow His Game Of Checkers, Jeff Bezos Is Playing Chess

Zac Szewczyk — Wed, 07 Aug 2013 22:57:34 GMT

Last night I posted a link to John Gruber’s commentary of MG Siegler’s article cited above. I found Gruber’s realization that rather than a floundering monolith Amazon is instead a flourishing innovator pouring almost the entirety of its profits back in to the very ecosystem responsible for creating that revenue in the first place a very interesting one, especially given Mathew Alexander’s similar sentiment expressed on a past episode of his podcast Bionic.

Today I got around to reading the original piece from MG Siegler, and I couldn’t agree with Gruber more: it’s a wonderful article well worth the read, especially for those who do not fully understand Amazon and the Apple community’s continued fascination with the company.

Permalink.

8 Changes Apple Made In iOS 7 Beta 5

Zac Szewczyk — Wed, 07 Aug 2013 22:46:45 GMT

“Ability to disable Control Center while using apps. The feature previously worked no matter where you were in iOS 7. Now you can select to have it turned off whenever an app is open. It can also be disabled on the lock screen.”

Immediately upon reading this it struck me how very strange it is for Apple, notorious for choosing the one experience it considers best and enforcing it with a hard and unyielding hand, to give its users control over such a major feature in iOS 7. I wouldn’t be surprised to see the setting gone by the next beta release.

Permalink.

Bitsplitting Podcast Hiatus

Zac Szewczyk — Wed, 07 Aug 2013 22:46:41 GMT

Bitsplitting has been and remains my single favorite interview podcast. One hundred episodes of Hypercritical exposed me to fields of knowledge I otherwise would never have come across, but it took a different kind of show to really acquaint me with the internet’s favorite critic. Although I would not go so far as to presume to know John Siracusa, Bitsplitting gave me wonderful insight into the man behind the curtain not only for Hypercritical, but many other podcasts as well. This hiatus will serve as a great opportunity for new listeners to catch up on the first season before Daniel Jalkut picks back up again, hopefully in the near future. Go check it out; I promise you won’t be disappointed.

Permalink.

Give Yourself a Break

Zac Szewczyk — Wed, 07 Aug 2013 22:44:53 GMT

When I set out to write this piece, I began with a title: “Sometimes, I Need Lighter Fluid”. As is often the case, inspiration for the title and accompanying article came at quite the inopportune moment: just after I had started shaving. Nevertheless, I captured both and began writing intending to bemoan the fact that over the last three months or thereabouts, I had failed to produce a respectable number of substantial articles. Attributing this lack of prolificacy to my job, I planned to write about how posting linked list items kept writing at the forefront of my mind, and how these types of articles often served as the gateway drug, if you will, to the long-form pieces I wrote in the evenings and on weekends.

Permalink.

MAC Spoofing under Linux

zufallsheld — Wed, 07 Aug 2013 20:49:00 GMT

The announcement of the recent attacks on Tor-users that exploit a Firefox vulnerability in Javascript suggested some things to remain anonymous whilst using Tor, such as disabling JavaScript, using the most recent versions of Firefox, install firewalls and so on. One interesting measure named was to often change your MAC …

The evolution of Information Technology

Jason Eckert's Website and Blog — Wed, 07 Aug 2013 03:00:00 GMT

As a Dean for the technology faculties of a private college in Canada, I’m always looking to make our programs more aligned to the industry - my motto is: always look forward and never look back!

However, when it comes to Information Technology (IT), I regularly find that the general perception of IT jobs is stuck in the past by at least a decade. I can’t tell you how many times I’ve met people who think that IT guys are stuck in the back closet of some company doing some menial job, such as re-soldering chips on a computer motherboard much like working on the engine of an old car. {shiver}

Jeff Bezos's Strategy With Amazon

Zac Szewczyk — Tue, 06 Aug 2013 23:07:37 GMT

John Gruber, commenting on MG’s article: “I’ve harped on Amazon’s seemingly eternal lack of profitability as much as anyone, but when you think about it and study their business, it’s not that they can’t turn a profit. They’re not burning through money like they were in the go-go ’90s. They simply choose not to turn a profit, and instead invest everything in operations and low prices.”

Mathew Alexander of One37.net and the popular podcast Bionic, in an episode from quite some time ago, made a similar point responding to the hyperbole following an Amazon earnings announcement painting the company as an unprofitable and therefore doomed company. Flying in the face of the familiar rhetoric the Apple community almost univocally spouts, the notion that instead of simply being unable to make money Amazon instead pours almost all of its profits back in to the very ecosystem that created it in the first place rather than saving those funds for a rainy day as Apple does is a very interesting — and apparently novel — way to think of the company, and one that lends a great deal of credence to the notion of Amazon emerging as a major player in the tech sector sometime in the near future.

Permalink.

Worst Idea So Far This Week, But the Week Is Young

Zac Szewczyk — Tue, 06 Aug 2013 23:00:31 GMT

Speaking of why I read John Gruber’s work, this kind of post, with this type of headline, is exactly why I read Daring Fireball: it made me laugh out loud, and showed me something I otherwise would not have come across. Good stuff.

Permalink.

Oblivion

🦉 olshansky 🦁 — Tue, 06 Aug 2013 20:36:55 GMT

Olshansky's review of Oblivion

Cancel Your Cable. Seriously.

Josh Thompson — Tue, 06 Aug 2013 03:00:00 GMT

No one likes to waste money, right? There are two things that are even worse to waste.

Time
Energy

Money can be earned, and if more is needed, you can spend less or earn more. Energy is what you need to bring ideas to fruition. Unlimited time with no energy gets you nowhere, as does unlimited energy with no time. more

Cable TV tricks you into making the wrong evaluation of the value proposition. If companies can get you to think that either 100 channels at $30 a month or 700 HD channels at $100 a month is a better deal than the other option, they’ve won.

The real calculus is this: five to fifteen hours of my week wasted vs. spent intentionally. Really, you should be willing to pay your cable company the price of your bill if they could simply deliver to you additional time.

If the small cost of $100 month was all it took to get an extra five hours a week, I’d do immediately. I value my own time above $5 an hour, and you should to (This is why I’ve been trying to wake up earlier every day).

If not cable, then what?

Watching stuff is a lot of fun. I enjoy my fair share of movies, but I get them when I want them, and I don’t have to watch commercials. Between Redbox, Netflix, and all the free options for watching good showsonline, there’s no reason that by cutting your cable you’re missing out on entertainment opportunities.

Oh - and all commercials do is try to sell you stuff. We already know that things cannot buy happiness. Experiences and relationships are what matter. So reject passive entertainment, spend less time exposing yourself to ads for cleaning supplies, cars, hair products, clothing, insurance, fast food, soft drinks, and all the rest of that crap. You will not go wrong.

This article provides an excellent write-up of how to go about dropping the TV.

A look at Foreign Data Wrappers

CRAIG KERSTIENS — Mon, 05 Aug 2013 23:55:56 GMT

There are two particular sets of features that continue to keep me very excited about the momentum of Postgres. And while PostgreSQL has had some great momentum in the past few years these features may give it an entirely new pace all together. One is extensions, which is really its own category. Dimitri Fontaine was talking about doing a full series just on extensions, so here’s hoping he does so I dont have to :)

One subset of extensions which I consider entirely separate is the other thing, which is foreign data wrappers or FDWs. FDWs allow you to connect to other data sources from within Postgres. From there you can query them with SQL, join across disparate data sets, or join across different systems. Recently I had a good excuse to give the postgres_fdw a try. And while I’ve blogged about the Redis FDW previously, the Postgres one is particularly exciting because with PostgreSQL 9.3 it will ship as a contrib module, which means all Postgres installers should have it… you just have to turn it on.

Let’s take a look at getting it setup and then dig into it a bit. First, because I don’t have Postgres 9.3 sitting around on my system I’m going to provision one from Heroku Postgres:

$ heroku addons:add heroku-postgresql:crane --version 9.3

Once it becomes available I’m going to connect to it then enable the extension:

$ heroku pg:psql BLACK -acraig
# CREATE EXTENSION postgres_fdw;

Now its there, so we can actually start using it. To use the FDW there’s four basic things you’ll want to do:

Create the remote server
Create a user mapping for the remote server
Create your foreign tables
Start querying some things

The setup

You’ll only need to do each of the following once, once you’re server, user and foreign table are all setup you can simply query away. This is a nice advantage over db_link which only exists for the set session. One downside I did find was that you can’t use a full Postgres connection string, which would make setting it up much simpler. So onto setting up our server:

# CREATE SERVER app_db
FOREIGN DATA WRAPPER postgres_fdw
OPTIONS (dbname 'dbnamehere', host 'hostname-here);

Next we’ll actually create our user mapping. In this case we’ll take the remote username and password and map it to our current user we’re already connected with.

# CREATE USER MAPPING for user_current
SERVER app_db
OPTIONS (user 'remote_user', password 'remote_password');

And finally we’re going to configure our tables. There were some additional pains here as there wasn’t a perfectly clean way to generate the CREATE TABLE. Sure you could pg_dump just that table, but overall it felt a bit cludgey.

# CREATE FOREIGN TABLE users
(
id integer,
email text,
created_at timestamp,
first_name text,
last_name text
)
SERVER app_db OPTIONS (table_name 'users')

Now we’ve got all of our local data, as well as remote data. For that report against two databases where you previously wrote a ruby or python script, ran a query, constructed another query, then executed it you can directly do in your database. We can simply query our new table - SELECT * FROM users LIMIT 5;

But the real power of foreign data wrappers goes well beyond just Postgres to Postgres. Having a defined contract in translating from one system to another, will really allow reinventing the way we work with data. This is especially true in large datasets where doing ETL on terrabytes of data takes longer than asking the questions of it.

While we’re waiting for more FDWs to be ready to use in production situations the Postgres FDW is a great start, though the Redis one is on its way. Even better is that it ships with standard installs of Postgres, meaning it will see more usage and help push them to advance further.

One final nicety, you’re not required to have ALL Postgres 9.3 DBs, just one that can then connect to the others, so go ahead and give it try :)

XKCD 'Time'

Zac Szewczyk — Mon, 05 Aug 2013 00:35:18 GMT

“Randall Munroe’s web comic XKCD has long been known for pushing boundaries in strange ways, but his latest experiment topped them all. Over the course of four months, ”Time“ grew as a frame was added every 30 minutes or so, ending up with over 3,000 individual frames by the time it wrapped up earlier this week.”

I absolutely love XKCD. I have read every one of Randall Munroe’s 1246 comics, and Time — which you can watch in its entirety over at Aubron Wood — is one of my favorites. I plan to read the next 1246 strips as well; I suggest you do the same.

Permalink.

Where is the Android John Gruber?

Zac Szewczyk — Mon, 05 Aug 2013 00:30:02 GMT

“That is the very reason Android has no Gruber-like figure - they have no central philosophy that would allow such a figure to emerge. What would the Android Gruber write about? There are of course Android writers out there, but they mostly cover the latest greatest phone or compare feature sets. They never really put things into context with the overall philosophy of the platform like Gruber does with Apple, because there is no overall philosophy.”

An interesting article to be sure, but I can’t quite say I agree with him: I subscribe to Daring Fireball’s RSS feed because I enjoy the occasional snarky comment Gruber tacks on to his articles and because his site is a great place to discover trending topics in the Apple world. To date, I can’t say I have ever read a single one of his long-form articles, so to say that the reason I read his site is for pieces that “put things into context with the overall philosophy of the platform” couldn’t be farther from the truth: I would still subscribe to his site if he wrote about Android, so long as this Gruber-like figure did his job well and with an attitude.

Permalink.

Swimming in a Sea of Shit

Zac Szewczyk — Mon, 05 Aug 2013 00:29:50 GMT

“This has nothing to do with politics, or gender. I know women who have been threated physically because of their thoughts on real-time strategy games. I knew men who had their spouses and children threatened, or had racial or sexual harassment thrown their way, because of review scores. This isn’t new. This isn’t rare. And it’s not something anyone can easily ignore, or something they should expected to endure silently and gracefully.” - Ben Kuchera for Penny Arcade in Swimming in a sea of shit

Permalink.

Upgrading from Fedora 18 to Fedora 19

The Technical Blog of James on purpleidea.com — Sun, 04 Aug 2013 08:02:18 GMT

It was time to take the plunge and upgrade from Fedora 18 to Fedora 19. Fedora 18 was one of the worst releases ever, so I figured it could only get better. I ran my backups as usual, however this time I didn’t seem to need them, the upgrade process went off without a hitch! I used the fedup-cli process over the network. I always run these things inside of screen.

Publishing README files automatically with `gitweb`

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sun, 04 Aug 2013 00:23:11 GMT

If you are using gitweb to serve your git repositories, you can add a file named README.html to the (bare) repository. gitweb will then display the contents of this file along with the tree of commits.

It is more satisfying, however, to generate the HTML file automatically. This is 2013, after all. We have the technology! I personally like Markdown as a lightweight and readable format. With the corresponding converter, you won’t ever have to think about HTML again.

My current setup looks like this:

A git repository on a local machine somewhere
A file named README.md in the root directory of this repository
A remote bare repository on a server that is accessed by gitweb

To create the README.html file within the bare repository, I created a simple post-receive hook:

#!/bin/sh
git cat-file blob HEAD:README.md | markdown > $GIT_DIR/README.html

Place this hook in the hooks subdirectory under the name post-receive and make it executable. After the chunks for each commit have been received, the hook will look for the file README.md on the master branch of the repository and generate the corresponding HTML file from it. The best part of this is that the file is getting updated along with the program and you never have to worry about re-generating the documentation.

Analyzing the EIG (HostGator, BlueHost, HostMonster, JustHost) Outage

Kevin Ohashi — Sat, 03 Aug 2013 21:01:34 GMT

I just published an article looking at the impact of the major outage that occurred yesterday (August 2, 2013) when EIG's Provo, UT datacenter failed. I also predict what to expect based on previous major outages.

There was definitely a major spike in data produced and I got down to analyzing it.

Full Story: http://reviewsignal.com/blog/2013/08/03/service-interrupted-a-look-at-th...

John Carmack Keynote

Daniel Little Dev — Sat, 03 Aug 2013 04:00:00 GMT

John Carmack's keynote this year was a fantastic talk about software engineering. Parts three and four of the keynote touched on all the key…

EverQuest Next Revealed

Ben Overmyer's Site — Sat, 03 Aug 2013 03:00:00 GMT

I'm writing this just a couple minutes after watching the EverQuest Next reveal video on Twitch. I couldn't watch it live yesterday, but it was totally worth the wait. For an hour and a half, I was on the edge of my chair. The introduction was a beautiful piece of sand performance art, which I otherwise won't talk about. The rest of the video was an introduction into what will probably be the single most revolutionary MMORPG to come out since 2003.

Dave Georgeson, director of development for EverQuest Next, started things off with a reveal of the art style. Let me tell you, this is a gorgeous game. The whole thing is very painterly, and is rendered using a modified version of the engine powering Planetside 2.

All of the races have been redone, and we were treated to concept art for several: the High Elf, the Dark Elf, the Human, the Dwarf, and the Kerran. The Dark Elf and the Kerran were probably the biggest departure from previous EQ designs. Kerrans are distinctly more lionesque, with pronounced lion's heads instead of the old cat faces and huge builds. Dark elves look like standard dark elves, except they have draconic eyes and short horns. There's a story behind that that I really want to hear.

The art style for characters is exaggerated, even slightly cartoony. I'm really OK with that, especially since they're building SOEmote into the game from the beginning. It's easy to see the expressions of the players themselves on their characters, and that's marvelous for a roleplayer, but also for immersion and socializing in general.

Movement is fantastic. Characters slide, leap, vault, grab, and otherwise interact with the terrain in a very natural way. With EQN's “active movement system,” players are free to really enjoy moving around in the world. There are items and spells that allow additional ways to move, like the Boots of the Zephyr in the video that allowed the players to float gently downward. Brilliant stuff.

Then, we got into the Four Grails, as Dave put it.

The Core Game

Grail 1 is the “Core Game.” This was the least impressive of the Grails, but it was still nice to see. Character evolution from a mechanical standpoint is based on collecting classes from around the world and mixing and matching abilities from them. It sounds like a hybrid of Guild Wars 2's system and Rift's system. Weapon choice matters, like it does in GW2.

Destructibility

Grail 2 is “Destructibility,” and this was the first mind-blowing revelation. The entire game world is built of voxels, despite looking natural and perfectly designed. It's fully destructible, even though it heals over time. It's like if SOE took a look at Minecraft and applied that on a grand scale. The way it works, too, is gorgeous. You can definitely see the aftermath of epic battles in the environment that it occurred in.

A Life of Consequence

Grail 3 is “A Life of Consequence.” Besides the standard “every action you take matters” spiel, we were introduced to the idea of emergent AI in an MMO. SOE will create mob behavioral patterns - likes, dislikes, etc. - and then release mobs of that type into the world. They will live, react, and die according to how they're programmed to behave. This means it's entirely possible to have roving bands of orcs that actually decide to set up camp in a particular area - choose their own spawn point, as it were. It's also possible to drive them out.

Permanent Change

Grail 4 is “Permanent Change.” For the most part, Dave talked about the Rallying Cry system, which is a little like a server-wide public quest that lasts 2-3 months each… and has permanent effect on the game world. These Rallying Cries are promised to be different on every server, and that along with the Life of Consequence and Destructibility Grails ensure that no two servers will have the same environment and history, let alone community.

EverQuest Next Landmark

As if all this wasn't enough, then they got into the EverQuest Next Landmark game that's coming out later in 2013. Landmark sounds basically like Minecraft on an epic scale, except that one continent in each Landmark server will have EverQuest Next art direction enforced… and creations from those areas will make it into EverQuest Next as real, lasting landmarks.

Player Studio

On top of that, SOE's Player Studio will find a very interesting real money economy implementation for people who enjoy building things in Landmark; you'll be able to sell not only finished works, but components. The example that Dave gave was of a player creating a nice crenelated tower. People could buy that tower, then make castles from it and sell those castles, and the player who created the tower would get royalties based on how many of that tower were used in the castle design for every castle sold. It's a fascinating system.

Basically, EverQuest Next sounds like the game I've been waiting for my entire gaming life. I really want to hear about how the crafting system works, and more about all the races, but… it sounds awe-inspiring. EverQuest Next takes player involvement in the game to a level never before seen.

EverQuest Next - Landmark Focuses on Construction and Exploration, Is Free-to-Play

EverQuest Next + Jeremy Soule = Geek Delight

EverQuest Next Redefines Next-Gen MMOs Enhanced by Zemanta

Basic Implementation of A* in Erlang

Srijan Choudhary, all posts — Sat, 03 Aug 2013 03:00:00 GMT

Implementing the path finding algorithm A* in Erlang

Postgres Dollar Quoting

CRAIG KERSTIENS — Fri, 02 Aug 2013 23:55:56 GMT

After my most recent post on documenting your database I had a colleague and friend chime in:

{% blockquote @danfarina https://twitter.com/danfarina/status/362007008079126528 %} @craigkerstiens You may want to mention for another post the generality of dollar quoting: it’s not just for CREATE FUNCTION. {% endblockquote %}

Luckily I was able to convince him to create the post. You can read a bit more on him below, but without further adieu here’s a bit on dollar quoting within Postgres:

Postgres supports two forms of entry of data literals into the system. One is the familiar single-quote:

=> SELECT 'hello';
?column?
----------
hello
(1 row)

This format is problematic when one might be using single quotes in the textual string.

Postgres also supports another way to enter data literals, most often seen in CREATE FUNCTION, but can be profitably used anywhere. This is called “dollar quoting,” and it looks like this:

=> SELECT $$hello's the name of the game$$;
?column?
------------------------------
hello's the name of the game
(1 row)

If one needs nested dollar quoting, one can specify a string, much like the ‘heredoc’ feature seen in some programming languages:

=> SELECT $goodbye$hello's the name of the $$ game$goodbye$;
?column?
---------------------------------
hello's the name of the $$ game
(1 row)

This can appear anywhere where single quotes would otherwise be, simplifying tasks like using contractions in database object comments, for example:

=> CREATE TABLE described(a int);
=> COMMENT ON TABLE described IS $$I'm describing this,
including newlines and an apostrophe in the contraction "I'm."$$;

Or, alternatively, entry of literals for types that may include apostrophes in their serialization, such as ’text’ or ‘json’:

=> CREATE TABLE json(data json);
=> INSERT INTO json(data) VALUES
($${"quotation": "'there is no time like the present'"}$$);

Security

Even though dollar quotes can be used to reduce the pain of many quoting problems, don’t be tempted to use them to avoid SQL injection: an adversary that knows one is using dollar quoting can still mount exactly the same kind of attacks as if one were using single quotes.

There is also no need, because any place a data literal can appear can also be used with parameter binding (e.g. $1, $2, $3…), which one’s Postgres driver should support. Nevertheless, for data or scripts one is working with by hand, dollar quoting can make things much easier to read.

About the Author

Daniel Farina is a long time colleague and friend, having worked together at 5 different companies. He’s part of the Heroku Postgres team as the resident tuple groomer, and the creator of WAL-E.

As is always the case if you have articles you’d like to see created or if you’re interested in doing a guest post please feel free to drop me a line craig.kerstiens at gmail.com. And if you have articles you feel are helpful to others in the Postgres world drop me a note as well for including them in Postgres Weekly.

Declarative Approach to Nesting Backbone Models

Untrod — Fri, 02 Aug 2013 09:57:00 GMT

Backbone doesn't have great (any?) support for nested models. Here's my approach. I think it's kind of fun (we get to write recursive functions!), and hopefully useful. I'll report back when I've lived with it for a bit longer.

Here's the problem: We have a Backbone model with attributes that …

Waking Up Early, Part 3

Josh Thompson — Fri, 02 Aug 2013 03:00:00 GMT

I’ve written about my attempts to wake up early before.

Most recently, I promised to take a sleep log, to track trends. Fortunately, I did not intend to try to wake up early, because I didn’t.

Here’s what I learned in the last three weeks:

Benadryl messes with your ability to wake up.

moreI got poison ivy all over my leg a few weeks ago, and have been taking antihistamines pretty regularly. I’m not sure the Benadryl directly contributed to making it hard to wake up at 5:30, but I can’t imagine that it helped.

It is extremely hard to go to bed early. I spent a week on a family vacation in Rehobeth Beach, Delaware, and I had a great time. I also rarely made it to bed before 12:30a. I would try to get out of bed at 6:30 or 7:00, but couldn’t get up until about 8:00, most days. (This is still early in terms of early-20s vacation standards - I did not once sleep in until 9, let alone noon, so I’m counting this as a win. But I’m far from my goal.) Even after my vacation, I still really struggle to get to bed at a good hour.

For example, I am typing this at 10:00 pm. Ideally, by 10:00 pm, I would have not looked at my computer for two hours. Yet here I am. I hope to be in bed in less than an hour, but that still has me not falling asleep until after 11:00 pm. Not good enough.

I don’t need to focus on getting up early anymore. I need to master my bedtime. I have very real minimum sleep requirements, and it is foolishness to skimp on sleep, and then being my day at 5:00am. I may be getting only six hours of sleep, and by the time the end of my work day rolls around, I would have been going for twelve hours. That math, while not terrible, is not sustainable.
I am a level two sleeper. I can get up early if I have properly rested. Jeff Chrisler sent me this article. It covers how backpackers naturally adapt to being early risers, synching their circadian rhythm with the sun. It’s not rocket science, but it helped me realize that there are some who believe it is physically impossible to wake up early, feeling rested, without being a “morning person”.Well, I can stand here and confidently say, in the words of the great entrepreneur Guy Kawasaki: “Bull shiitake. It’s possible. I did it.”

A level one sleeper is one who, in the words of Josh Thompson is “a ‘night owl’ and cannot comprehend the possibility of being an early riser.” This is, to him, not a lack of will power. It’s a lack of imagination. Note that there is nothing inherently wrong with being a level one sleeper.

So, I didn’t move much in the direction I had hoped, these last two weeks, but I did come to some important realizations, and more importantly, I didn’t completely waste my time. I’m going to spend the next two weeks recording my time up and my time asleep, and I’ll present my findings here to you, my kind, generous, and supremely intelligent readers.

I have a two-part call to action:

If you want to be an early(er)-riser, track when you go to bed and when you get up every night for the next two weeks.
If you plan on doing step one, tell me. I’ll pester you in a few days to see how you’re doing.

QApplication and the locale

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Thu, 01 Aug 2013 22:23:50 GMT

In Germany, we do things differently. While our way of writing dates is debatable, one thing is a constant source of confusion: The decimal dot. In the US, it’s a real dot–in Germany, it’s a comma. You read that right. π ≈ 3.14159… for scientists, but we continue to claim that it is actually ≈ 3,14159….

Why is this a problem? Well, software sometimes expects input in the form of floating point numbers. In case your locale settings indicate that you are German, smart programs expects you to use the decimal comma, pretty please. Unfortunately, not all parts of our programs are built that smart. In some cases, we bluntly assume that you use decimal dots.

To clear that source of confusion, I added std::setlocale( LC_NUMERIC, en_US"); at the very beginning of our program. This fix worked beautifully until that fateful day where stopped. After much confusion, I found the culprit: QApplication! It turns out that QApplication likes to reset the locale settings for some reason. This is even detailed in the documentation for QCoreApplication (which I of course read after the problem had already been solved):

This can cause a conflict when using POSIX functions, for instance, when converting between data types such as floats and strings, since the notation may differ between locales. To get around this problem, call the POSIX function setlocale(LC_NUMERIC,"C") right after initializing QApplication or QCoreApplication to reset the locale that is used for number formatting to “C”-locale.

So, I heeded the wise words of the fine manual and moved the code for setting the locale after the initialization of QApplication. What a fun way to spend almost one hour.

A colleague suggested that I should search for “QApplication, what the fuck?”, so these are the search terms to be used forthwith (the phrase “QApplication resets locale” might also be helpful, so I am including this here).

Automatically inline Python function calls

Tom Forbes — Thu, 01 Aug 2013 18:54:18 GMT

Edit: Code is here on GitHub Calling functions in Python can be expensive. Consider this example: there are two statements that are being timed, the first one calls a function that returns an integer while the second one calls a function that returns the result of a second function call which return...

Only Usain Bolt Looks at the Clock

Dan Stroot — Thu, 01 Aug 2013 03:00:00 GMT

If you watch someone run the 100 meters, they sneak glances around. Sprinters watch each other while they run. They want to know where are in the pack. I noticed that only Usain Bolt looks at the clock. Why?

This post Only Usain Bolt Looks at the Clock first appeared on Dan Stroot's Blog

Clean Repository Data Access in C#

Ben E. C. Boyter — Thu, 01 Aug 2013 02:52:14 GMT

Mostly as a self reference here is an extremely clean data access pattern possible using C# and Entity Framework. It saves you the effort of mocking the database context as the code you end up writing is so simple it is all compile time checked.

Essentially you define a very simple class which provides a single method for getting data (although you may want a save data method too) and make sure you add an interface to make unit testing/mocking easier.

Dream Big, and Build Optionality

Josh Thompson — Wed, 31 Jul 2013 03:00:00 GMT

We all can dream big. I have dreams, and you probably do to. For example: Travel, location independent living, being wealthy/choosing to do work that interests you, enjoying “simple” things. The list could go on, and on, and on.

But then we go right along doing all the normal things, wishing and wishing, but never taking any action.

I don’t want to spend the next ten years of my life wishing for lots and doing nothing - that is one of the reasons I started this blog. I want to do epic stuff, and writing about my progress helps me do that. more

And then I came across another phenomenon. I wrote down a huge list of things I want to do and learn, and I have made progress on many of them. I’ve experimented with a Dvorak keyboard layout, I’m learning to write in italics, I set aside enough time to read at least two books a week, I’m learning Krav Maga, and my wife and I are slowly sorting out how to cook.

But here’s the problem: None of these things will produce disproportionate rewards. Even if I could type at 150 wpm, write at 55 wpm, read four books a week, cook amazing meals, and was amazing at Krav Maga, I’m no closer to my really big goals. (Travel hacking, having an awesome job, eventual location independence/self-employment, etc.)

I derive significant value from the things I’m learning, and I’d rather invest my time in something that produces returns, rather than spend another hour a day commuting, or watching TV, but right now, my efforts at self-improvement lack direction.

My attitude has changed as I’ve read and integrated information from two sources. I am not currently working on specific plans to achieve my strategic goals, because there are so many different ways to those ends, and its pretty foolish to predict what may be happening in six months.

I am currently working on building stability in a few important areas of my life, so I can expose myself to limited risk that could have tremendous payoff.

If I can achieve significant financial security, I can experiment more with self-employment, if a good opportunity comes along.
If we can reduce our monthly expenses to just a few hundred dollars (not including rent), Kristi and I can experiment with extended international travel.
If I can build a strong network of professional relationships, I can learn from experts and expose myself to really cool job opportunities.
If I can achieve a fairly high level of fitness, I can enjoy opportunities to by physical, as they arise. (Have you ever run all the way up the Medical Center metro escalator? I’ve tried a few times, and last time I went up it, I ran the whole way. It was awesome.)
If I can build a strong, trusting relationship with my wife, we can do hard things without experiencing as much relationship stress as we would if it were a weak relationship.

Where on this list does Dvorak typing fit in?

It doesn’t.

How about learning to code?

Not yet.

I want to build antifragilityinto our lifestyle. We’re getting there, but have a ways to go yet.

I don’t yet know exactly how to make my big goals happen, but I do know I can take steps to be prepared. I cannot let my uncertainty prevent preparation, so right now, we are figuring out how to reduce our possessions, reduce our living expenses, possibly grow our income, and expose ourselves to cool opportunities and relationships. Then, when something amazing comes up, we will be able to jump on it.

How about you? What big dreams do you have? Are you putting yourself in a position to be exposed to these opportunities, and take advantage of them when you encounter one?

The Future of Programming

Nicola Iarocci — Wed, 31 Jul 2013 03:00:00 GMT

Bret Victor on Vimeo.

Guides to buying things

Rich Dougherty — Tue, 30 Jul 2013 10:45:00 GMT

SF New Tech Presentation on Gigwalk

MattCrampton.com — Tue, 30 Jul 2013 08:00:00 GMT

SF New Tech Presentation on Gigwalk On Jul 30, 2013 I gave a presentation at SF New Tech on Gigwalk, crowdsourcing and the gig economy. Download Presentation Video File size: 119mb

Excuses for Lazy Coders

Nicola Iarocci — Tue, 30 Jul 2013 03:00:00 GMT

Did you check for a virus on your system?

You must have the wrong version.

It’s a third party application issue.

That code was written by the last guy.

Programming Excuses. We’ve all been there.

Documenting your PostgreSQL database

CRAIG KERSTIENS — Mon, 29 Jul 2013 23:55:56 GMT

Just a few days ago I was surprised by what someone was doing with their database, and not in the typical horrifying travesty against mankind. Rather, it was a feature that while familiar with I’d never seen anyone fully take proper advantage of - COMMENT or describing tables. Postgres has a nice facility for you to provide a description for just about anything:

Table
Column
Function
Schema
View
Index
Etc.

The specific use case was a database acting as a datamart pulling in data from multiple sources to be able to report against disparate data. Over the years I’ve seen this occur really one three ways, the first is that a limited set of people, typically one person, have knowledge over all the datasources and thus far the sole individual responsible for creating reports and answering questions of the data. The second, is wide open access to anyone that wishes for it. In this case you often have people asking questions of the data, and because they don’t understand the relationships coming up to entirely wrong conclusions. The final approach is to create some external documentation, entity relationship diagrams, data dictionaries, etc. This last one often works okay enough, but often suffers from lack of updates and being too heavyweight.

A better solution, and all around good process is simply documenting clearly within the database itself. Simply comment each table and column, just as you would outside of your DB then it can be quite clear when inside the database working interactivly:

COMMENT ON TABLE products IS 'Products catalog';
COMMENT ON COLUMN products.price is 'Current price of a single item purchased';

While an obvious example above naming even the most mundance columns can help create more accurate reports. Then of course when you want to inspect your DB its quite clear:

\d+ users
# \d+ users
Table "public.users"
Column | Type | ... | Description
------------+-----------------------------+-...-+-----------------------------------------
id | integer | ... | auto serial pk
first_name | character varying(50) | ... | required first name of user
last_name | character varying(50) | ... | required first name of user
email | character varying(255) | ... | email address of account
data | hstore | ... | mix of data, city, state, gender
created_at | timestamp without time zone | ... | when account was created, not confirmed
updated_at | timestamp without time zone | ... | time any details were last updated
Indexes:
"idx_user_created" btree (date_trunc('day'::text, created_at))
Has OIDs: no

But it doesn’t necessarily have to stop there. Which actually brings me to one other item, you should be commenting your SQL just the same. SQL comments can be done easily by just starting a line with --, or you can have it at the end of the line with further info. Here’s a nice example:

-- Query aggregates all project names that have open past due tasks grouped by email
SELECT
users.email,
array_to_string(array_agg(projects.name), ',')) as projects # Aggregate all projects and separate by comma
FROM
projects,
tasks,
users
-- A user has a project, which has tasks
WHERE projects.id = tasks.project_id
-- Check for tasks that are due before now and not done yet
AND tasks.due_at > tasks.completed_at
AND tasks.due_at < now()
AND users.id = projects.user_id
GROUP BY
users.email

You comment your code, why shouldn’t you comment your database?

Gigablast Aquired and Code Posted

Ben E. C. Boyter — Mon, 29 Jul 2013 08:58:30 GMT

Interestingly it seems that Matt Well’s search engine Gigablast has been acquired by Yippy.com [1]1 [2]2 [3]3 (demo here http://demo.yippy.com/). Gigablast has always been one of my favorite search engines simply because it is so interesting. Started by a single guy, with an interesting blog and being one of the last true new indexes of the web it was always worth a look. While its sad to see it go this way I am happy that Matt presumably has been able to cash out on his creation. Well done to him. I must admit Gigablast had been going downhill for a while and this might explain why ProCog appeared and then vanished so quickly.

Free Robust Email Validation API

Nicola Iarocci — Mon, 29 Jul 2013 03:00:00 GMT

The guys at Mailgun are taking a very interesting approach at the ever-lasting problem of proper Email validation:

Given an arbitrary address this service validates address based off syntax checks (RFC defined grammar), DNS validation, spell checks, and if available, Email ServiceProvider (ESP) specific local-part grammar.

They’re relying on formal grammar and not on regex like the rest of us, which is perhaps the more intriguing aspect of the project. Being Email Service Providers themselves they have good knowledge of most ESPs local-part grammars (the left side of the @ symbol) so when there is a match, they’re validating local-parts too.

Upgrade makes Mirabox unbootable

kyrofa's blog — Mon, 29 Jul 2013 03:00:00 GMT

For some reason (I can’t really put a finger on it exactly), I like to keep my servers up-to-date. I know! All those security patches, all those new features– they’re a killer! In all seriousness, I host several websites on a Mirabox from right behind my TV. I hopped on the plug computing train way back when the SheevaPlug was just a dev kit, and I’ve been on it ever since.

Warm Bodies

🦉 olshansky 🦁 — Sun, 28 Jul 2013 16:43:37 GMT

Olshansky's review of Warm Bodies

Art of Living Foundation's Kurshed Batliwala Debunked

Anmol Sarma — Sun, 28 Jul 2013 13:07:52 GMT

A critical look at Khurshed Batliwala’s talk, “Technology of Spirituality” delivered at Ruia College, Mumbai.

Mr. Batliwala makes a number of extraordinary claims about the state of ancient Indian science and technology. Most of them however, turn out to be exaggerations, misinterpretations or outright fabrications. He then attributes all scientific progress to ‘spirituality’.

The talk is nothing more than a sales pitch for Mr. Mr. Ravi Shankar’s ‘Art of Living Foundation’.

Recursively download website files using WGET

Thomas Hunter II — Sun, 28 Jul 2013 03:00:00 GMT

Customizing Your Mac Input Source Icon

Salvatore's Blog — Sun, 28 Jul 2013 03:00:00 GMT

Motivation

Pair programming is pretty common around Square, and I’ve had the fortunate experience of pairing with my manager, Xavier. Now, if (you have a Mac and) you’ve ever had to type in a different language, you know that there is a flag in the top right corner that signifies the layout. The U.S. traditional Qwerty layout that we all know and love.

A layout for people who want to try new things.

The layout I had to use for the one semester I took Chinese.

The layout that I never heard of before Square and a layout that pretty much only Xavier uses.

This brings us back to pair programming. Xavier is very proficient with his keyboard layout and added it to the configurations. When I first the little ‘CO’ in the top corner, I joked that it stood for ‘communist’, and from then on, it was referred to as Xavier’s communist layout. To drive the point home, I changed the display from this… … to this …

How to make a custom layout

Step 1: Make an icon.

Select an image for your layout, and visit iConvert. I tried their software with no luck, but you might have a better outcome. Browse to your image and hit convert. Once it does its magic, click the “Download .icns” button.

Step 2: Make the keyboard layout

Download the Unicode Keyboard Layout Editor, Ukelele (version 2.2.4 worked for me), and open it. Once you have it open, make sure your keyboard layout is the one you want to replicate.

If it isn’t you can change it by navigating to  > System Preferences > Language & Text > Input Sources and checking the box for the layout you want. Then, click the layout icon in the top right corner of your screen and select the one you want.

In Ukelele, select File > New From Current Input Source which should open a new keyboard window with your current keyboard layout.

Then, set your icon file by going to Keyboard > Attach Icon File… and layout name by going to Keyboard > Set Keyboard Name….

Finally save your layout by going to File > Save As Bundle….

Step 3: Use the layout

To install the layout, take your newly minted .bundle file and store it in your Library/Keyboard Layouts folder. If you can’t find this folder, go to Applications > Utilities > Terminal and paste this line in:

open ~/Library/Keyboard\ Layouts/

Once you have your bundle in the layout folder, restart your computer, and your new layout will be listed under  > System Preferences > Language & Text > Input Sources. Check your custom keyboard, select it from the top corner.

When you share your layout bundle, make sure to upload it to Dropbox or Skydrive and send the link to the bundle. I tried emailing the bundle and Gmail striped-out some important piece that prevented it from working.

Here is the Communist Colmak and Jedi Dvorak that I made for Xavier and this blog post respectively.

Again, some updates

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sat, 27 Jul 2013 22:08:12 GMT

I finally managed to deliver some dearly-required updates. Most notably for visitors other than the Google Bot, I added a new portrait that greets visitors with a smile.

In the wake of the whole “2013 mass surveillance scandal” made public by “Edward Snowden”, I finally severed the last ties to Google. Without thinking too much about it, I had used a customized Google Analytics tracker on all pages. Following the German privacy laws, I instructed the tracker to make the IP addresses anonymous (which amounts to discarding the last 8 bits of each address). After the curiously precise denials by Apple, Facebook, and Google regarding their participation in PRISM, it struck me: I had thrown my visitors to the wolves–without their consent and (sometimes) their knowledge.

The only viable course of action was thus to remove all tracking code. I still count site visits, but only using internal log files that are not served by Apache. I am sorry for not thinking clearly about this. If you value your privacy, I would strongly suggest installing Ghostery.

To end this post on a lighter and informative note: My site now features a news box at last, courtesy of ikiwiki. The main index page will now always show the five latest blog posts, making it easier for me to point out new content.

Automating Git Branch Cleanup

Joshua Rogers — Sat, 27 Jul 2013 15:00:00 GMT

I'm a huge fan of Git. Used properly, Git's branching system can be immensely powerful. In fact, it forms a core part of our engineering workflow at the office. By providing a healthy degree of isolation between different changes to the codebase, we can provide QA with a clean way to test various change sets in total isolation before we produce a release candidate. This sounds rather nice until the realization that after we finally get a release candidate that we accept, somebody is left we the rather tedious job of removing all of the source branches from our repo.

URL path segment encoding

Rich Dougherty — Sat, 27 Jul 2013 12:29:00 GMT

Don't use form encoding

Instant Backbone.js Application Development

Thomas Hunter II — Sat, 27 Jul 2013 03:00:00 GMT

Pixar Optix Lighting Preview Demo

Code & Visuals — Sat, 27 Jul 2013 03:00:00 GMT

For the past two months or so, I’ve been working at Pixar Animation Studio as a summer intern with Pixar’s Research Group. The project I’m on for the summer is a realtime, GPU based lighting preview tool implemented on top of NVIDIA’s OptiX framework, entirely inside of The Foundry’s Katana. I’m incredibly pleased to be able to say that our project was demoed at SIGGRAPH 2013 at the NVIDIA booth, and that NVIDIA has a recording of the entire demo online!

The demo was done by our project’s lead, Danny Nahmias, and got an overwhelmingly positive reception. Check out the recording here:

Using NVIDIA® OptiX™ for Lighting Preview in a Katana-Based Production Pipeline

FXGuide also did a podcast about our demo! Check it out here.

I’m just an intern, and the vast majority of the cool work being done on this project is from Danny Nahmias, Phillip Rideout, Mark Meyer, and others, but I’m very very proud, and consider myself extraordinarily lucky, to be part of this team!

Edit: I’ve replaced the original Ustream embed with a Vimeo mirror since the Ustream embed was crashing Chrome for some people. The original Ustream link is here.

Reawakening the Starborn

Ben Overmyer's Site — Sat, 27 Jul 2013 03:00:00 GMT

About a year and a half ago, I started a project to create a sci-fantasy sandbox MMORPG. It was called Starborn: Universe. I went through the trouble of getting a HeroEngine/HeroCloud environment and began learning the toolset. Design documents popped up in my Documents folder and on the dev blog I started for the project. Then, I got busy with other things, and Starborn: Universe went dark. Until now. I'm dusting off the design documents, but Starborn: Universe is as much of an experiment as it is a game. See, my theory is that online player-driven games can start with very little and grow over time. The idea of the “Lean Startup” can apply just as much to an MMORPG as it can to an iOS app. The trick is that MMORPGs are hard to produce. They have a lot of moving parts and require a lot of resources on the part of the developer and operator. So how does one or two people accomplish this monumental feat? By starting small, and iterating quickly. If you're curious as to what I have in mind, head over to the Starborn: Universe devlog. That's where I'll be writing about Starborn.

CoffeeScript's Scoping is Madness

Donat Studios — Fri, 26 Jul 2013 01:19:44 GMT

CoffeeScript is a programming language that compiles to JavaScript. Its mission is to "expose the good parts of JavaScript in a simple way". I've heard a lot of interest in it lately from various channels.

After a coworkers departure, I inherited maintenance on our deployment bot, and it was written in CoffeeScript. While trying to make some small modifications, I ended up getting unexpected issues I didn't understand. Things I did not touch were suddenly breaking. I did not understand until I investigated the generated JavaScript.

It ends up CoffeeScripts approach to scoping of variables is to not scope variables. There is no shadowing. There is no var, let nor const equivalent, there is simply no way to explicitly define scope.

Variables in CoffeeScript are scoped to their outermost definition, regardless of whether the name was already in use elsewhere. When you use a variable of a name, its scope now includes all inner scopes, trampling any existing definitions of the variable in those scopes.

Let's examine the following examples:

CoffeeScript

test = (x) ->
  y = 10
  x + y;

alert test 5

Generated JavaScript

var test;

test = function(x) {
  var y;
  y = 10;
  return x + y;
};

alert(test(5));

Now let's make one small change and define a variable y in the outer scope, outside the function.

CoffeeScript

y = 0;
test = (x) ->
  y = 10
  x + y;

alert test 5

Generated JavaScript

var test, y;

y = 0;

test = function(x) {
  y = 10;
  return x + y;
};

alert(test(5));

The Problem

Notice the highlighting indicating the scope of the y variable. By defining y in the global scope all subsequent y's are also now that global. You may no longer have a variable named y in your code, at any deeper scope. The outer y is the only y.

Creating a global of a name given overrides all subsequent definitions.

In JavaScript var, let, and const keywords define the scope of a variable. Leave it out and it scopes downward until it hits a var definition of that variable or the global level. This means that inner scopes inherits from outer scopes unless it defines its own scope of the variable. CoffeeScript on the other hand offers you no method to scope a variable. Scoping is entirely left to the lowest level use of a variable name.

This behavior is dangerous and makes code very difficult to maintain. The problem is twofold. Firstly, when writing a function, you need to be aware of all shallower scopes variable definitions, as not to trample them. Secondly, when altering code at any scope but the outermost, you need to be aware of all deeper scopes variables as to not trample any of them.

The only "safe" way to write CoffeeScript is to assume all variable names are global. In practice they are.

There have been proposed solutions, such as a Go-lang style := for inner scoping, but these have not been accepted as of this writing. The creator of CoffeeScript, Jeremy Ashkenas, when questioned about it by Armin Ronacher on Twitter replied:

Not gonna happen ;) Forbidding shadowing altogether is a huge win, and a huge conceptual simplification.

This is not true for applications of any scale larger than toy. It makes development more complex, having to check every inner scope before using a new variable name. This is not simpler. The entire behaviour of all inner scopes can change with a single bad variable defintion.

Finally

CoffeeScripts goal of "expos[ing] the good parts of JavaScript in a simple way" was missed. Instead of improving JavaScript's scoping which can be kind of daunting to learn, they actually made it worse. If you want to improve JavaScript make every variable local until explicitly defined global, as is the behavior in the vast majority of languages.

JavaScripts "global unless defined as local" behavior is weird, but manageable. CoffeeScript's "local until defined elsewhere globally" behavior on the other hand is simply difficult to predict and makes it easy to accidentally change the entire meaning of code even when you entirely understand the behavior.

It is a bad behavior, period.

Update

I've a fight on Reddit here.
I've irked Reginald Braithwaite, the author of CoffeeScript Ristretto, so badly he's giving away 100 copies of his book for free!
- The author has upgraded me to Not Wrong™!

SSDs are awesome, buy one.

Tom Forbes — Thu, 25 Jul 2013 22:54:58 GMT

I recently brought a Samsung 840 Series Pro 256GB 2.5 inch SATA Solid State Drive and its easily the best PC hardware purchase I have ever made. Before I purchased it I was thinking about replacing my laptop as it was getting pretty sluggish, despite having decent specs even 2 years after I purchase...

Do I look like I give a shit (public license)

Sam says you should read this — Thu, 25 Jul 2013 20:10:52 GMT

I'll make this short and sweet. I felt that we needed a new license. Blogfile was/is released under the WTFPL, and it's sub-project, SHITLang was also released under the same license.

I have no interest in maintaining SHITLang, and wanted to discourage people from trying to get me to look at pull requests.

Anyway, today, it is moving to the brand new license that I created (based heavily on the concept of the WTFPL): the Do I Look Like I Give A Shit Public License.

So what should this license be used for?

You are sick of maintaining a side project
You really don't give a shit about the project
You …

My Good Friends (Who Don't Know Me)

Josh Thompson — Thu, 25 Jul 2013 03:00:00 GMT

Rumor has it you become like those you spend time with. Or “birds of a feather flock together”, or “you are what you eat”. Maybe that last one was Hannibal Lector, having an old friend for dinner. Anyway, the person that you are is influenced by the people you spend time with. Ditto for me. There are three kinds of people you can spend time with: real people who know you just as you know them, real people who do not know you, but you know them, and imaginary/fictitious people who have never existed.

We’ll come back around to that last category in a minute. I am not insane. more

Mentors

There are people who I know, who know me, that I seek out to spend time with. I call them mentors. Some of these relationships have popped up out of nowhere (thanks, Wayne), while others have been more formal. (Think paid counseling.) You should seek these people out, because the value you can derive from these relationships is nearly endless. Life changing. Seriously.

Role Models

Real people who I know but don’t know me, I’ll call role models. They are people that, for some reason or another, I want to emulate. It is important to specify the way I want to emulate these people. An easy example is Chris Sharma - an amazing rock climber, but sort of looks like he’s stoned all the time . I want to climb like him, not communicate like him.

Other examples: books and blogs by or about noteworthy figures ( why they are noteworthy is entirely up to you) make up the bulk of this category.

Literary Role Models

In high school and college, we all had to read high quality literature. If you were like me, you didn’t much care to read this stuff, for a variety of reasons. Since I’ve finished college, I’ve dug back into books (and learned more for less than I ever did in college - that’s another discussion all together.) but I’ve enjoyed both non-fiction and fiction.

When I read fiction, some times it’s classy (think of a famous dead author - he’s classy) and sometimes it’s not as classy, but still interesting.No matter how classy or non it is, when you spend a few hours immersed in a world of the author’s creation, you’re spending time with the individuals in that book. If you “spend time” with people who wrestle with hard problems and make good decisions and generally conduct themselves in an honorable, respectable way, you are surrounding yourself with people who make good decisions and conduct themselves in an honorable and respectable way.

Another title for “literary role models” is “imaginary friends”. Don’t judge. They influence you, they’ve just never had a physical existence.

Why Friends Matter

I am now going to lump all three categories above into a bucket named “friends”. These categories differ from your normal, every day friends in at least one specific way: You must seek them out. Only one of these groups of people (physical people who know you) can influence you without your permission. Think of a text from a friend - you didn’t ask for it, but you’re being influenced by its content. In the other two categories, you must seek out that person (or literary figure), and intentionally expose yourself to their influence.

Much of your family life you don’t have much control over. Nor do you have control over where you went to school, or the friends you once had. Your past cannot be changed. Your present is mostly a function of your past. Your future, on the other hand, is up for grabs. If you are not intentional about influencing your future, you won’t do much about influencing your present context, and, therefore, your future will largely be determined by your past.

Bear with me.

If you want to influence your future, but you’re not sure how you want to do so, consider spending time with those you want to emulate. You can emulate a professional painter not because he’s a painter, but because he’s a professional. You can emulate an amazing teacher not because he’s a teacher, but because he’s amazing. You can emulate a real estate investor not because they know real estate, but because they have figured out how to turn one dollar into two dollars. You can emulate a Buddhist monk not because they’re a monk, or a Buddhist, but because they are content. You can emulate a passionate computer programmer not because they are a computer programmer but because they are… passionate.

You can choose who you spend time with, who you emulate. If you’re not ready to follow around a physical person to be more like them, you can follow around a digital one or an imaginary one. Find out who’s influenced them, and go be influenced by them.

Whatever you do, please ,find some quality in some person to emulate. Expose yourself to that quality, to that person (without exposing yourself in the criminal sense) and you’ll find yourself slowly gaining more and more influence over your future.

I will soon discuss my mentors, role models, and imaginary friends. I have dozens, if not hundreds. Literally nothing that comes out of my mouth or rattles around in my head is original, and I’d be a fool to pretend otherwise.

Do you have mentors, role models, or imaginary friends?

Eve v0.0.8 has been released

Nicola Iarocci — Thu, 25 Jul 2013 03:00:00 GMT

Most significant features are probably the native support for MongoDB write concern settings, new event hooks allowing for transformation of documents before they are sent to clients, increased handling of both pagination and CORS, and the native validation of float data types.

Get it on PyPI, go straight to the source code or more likely, visit the project homepage.

Open My Eyes

trv.rs — Thu, 25 Jul 2013 03:00:00 GMT

Open the eyes of my heart Lord. I want to see. To truly see.

I know that if my eyes would truly see I would see the vast legions of angels, like Elijah's servant. I would also see that their martial array is dwarfed by your might.

I would see your careful artistry planning and outlining every beautiful thing in this world, placing it into place, lighting it just so and giving us a wink as we suddenly catch a moment of absolute beauty in your creation. Thank you for those reminders of your mastery.

I would see into history and see the magnificent tapestry of all that has been and the threads drawing together towards the End of the weaving. I would see each tangled thread struggling for selfish purposes unknowingly and purposefully knit into the skein of time towards your ends, and I would know that your victory and glory is sure.

I would see your compassion and love for us, as you intercede and move on our behalf. I would wince in the brightness of the eternal moment of glory that awaits, away from pain and fear, united with you. A wedding feast of immense proportions, and ever-increasing joy.

So open the eyes of my heart Lord. I would have seep deep into my soul the joy, the trust, the love that you give me. I would it pervade my life so that when the petty brambles of this world seek to entangle I am clear-sighted and able to perceive the way you would have me walk in despite my situation. Take some mud. Clean my eyes. Let the scales drop away and may I behold your face.

If you are interested in the photo, you can read more about how I took it and where on my flickr.

The One-Episode Story

Zac Szewczyk — Wed, 24 Jul 2013 21:37:04 GMT

Both Burn Notice and NCIS, arguably two of USA Network’s most popular television broadcasts, adhere to a strict rule set in each and every episode: a sailor dies, the NCIS team responds and eventually solves the case, and in the last few minutes the overarching story progresses ever so slightly. Similarly, Burn Notice opens with the client, someone with a problem that Michael will agree to solve after a varying amount of reluctance, and closes with the minute progression of a larger plot just as NCIS does. Although I have only occasionally seen other installments of USA’s programs, shows like Psych and to a lesser degree Covert Affairs follow the same basic outline.

Permalink.

Teach a man to fish (and he'll die when he catches Fugu)

Sam says you should read this — Wed, 24 Jul 2013 18:22:14 GMT

Let's talk about how we teach new people to program.

There is a saying which I see getting thrown around frequently in the mailing lists and user groups for programming languages. Everyone knows the saying, and I used the latter half of it as the title for this post.

"Give a man a fish, and you feed him for a day. Teach a man to fish, and you've fed him for life."

This is a common refrain when people ask for resources to learn to program. I see it for Python; I see it for PHP; I see it for JavaScript; I see it in almost every community I'm a part of. People say it meaning that new users should s…

Porting Interdiction to Android with CocoonJS - overcoming mouse position offset problem

Liza Shulyayeva — Wed, 24 Jul 2013 17:42:42 GMT

For the month of August I am porting Interdiction to Android using CocoonJS. The AI is far from perfect right now, but it works. I am going to keep improving it. For now, however, Android port it is. If I’m lucky I can get it all ported before this year’s js13kGames challenge starts mid-month. If that’s the case I may participate in that and release that game as the September One Game a Month project, but we’ll see.

ORM is an anti-pattern

Nicola Iarocci — Wed, 24 Jul 2013 03:00:00 GMT

In ORM is an anti-pattern Laurie Voss concentrates everything I’ve been saying on the ORM plague in all these years.

If your project really does not need any relational data features, then ORM will work perfectly for you, but then you have a different problem: you’re using the wrong datastore. The overhead of a relational datastore is enormous; this is a large part of why NoSQL data stores are so much faster. If your data is relational, however, that overhead is worth it: your database does not merely store your data, it represents your data and can answer questions about it on the basis of the relations captured, far more efficiently than you could in procedural code.

Jerome Choo: Founder of Whizzimo

Sam Solomon — Wed, 24 Jul 2013 03:00:00 GMT

Jerome Choo is a human experience designer. He is the founder of Whizzimo, an app designed to facilitate communication students with Dyslexia and their tutors.

Open Spotify links with the Desktop client

Baptiste Fontaine’s Blog — Tue, 23 Jul 2013 22:55:00 GMT

Spotify’s Web app is great, but you may prefer to use the desktop client. The problem is that the links default to the Web app. Here is a quick tip to make what you want.

First, install Switcheroo. It’s a Chrome extension (Firefox users, go here) that allows you to setup custom redirect rules for any http request, using a string replacement. Then, add a rule to replace http://open.spotify.com/ with spotify://.

That’s it! Now, all open.spotify.com/something links will open in the desktop client instead of the Web one.

Note: I found the original tip here, but it was not working because the author suggested to replace with spotify instead of spotify://.

JS/HTML Obfuscation

Venam's Blog — Patrick Louis (Lebanon) — Tue, 23 Jul 2013 20:00:00 GMT

Hello fellow readers, This thread is about obfuscating the content of a webpage. This might not be so useful, security wise, because all the sensitive information should be kept server side. However, for the ones trying to reverse engineer the page this is a huge obstacle.

Designing a Cardboard Canoe

Varun Ramesh's Blog — Tue, 23 Jul 2013 05:26:00 GMT

Every year, my high school holds a canoe race, where students from the Engineering, Physics, and Calculus classes compete to design, build and race a Canoe over the span of two weeks.

The Beauty of a Limited Run

Zac Szewczyk — Mon, 22 Jul 2013 21:39:29 GMT

Just over two short weeks in to the new year, Casey Liss, former Build & Analyze host Marco Arment, and former Hypercritical host John Siracusa released a casual car podcast aptly dubbed Neutral. The show went on to received critical acclaim not only for its fantastic roster, but for its role pioneering a new show format in the podcasting space as well. Finishing in just twelve short episodes, Neutral and its hosts proved not only the the viability of a limited run in podcasting, but its worth as well.

Permalink.

Why I use a Kindle

Josh Thompson — Mon, 22 Jul 2013 03:00:00 GMT

Amazon’s e-reader is extremely functional. Most reasons to not use one focus either on practical issues (depending on something with a battery) or on aesthetic reasons. These are valid issues, of course, but these pale in comparison to the many, many reasons to use a Kindle. more

Extremely portable
Quite compact
Can hold near-infinite number of books
Instantly acquire new books.
Purchased books are cheaper on Kindle than physical books (usually)
You can “rent” books on your Kindle from a library - without ever going to the library.
Easy to use one-handed, either lying down (in bed) or standing up (metro).
Built-in dictionary for all those words you don’t know how to use. (Oh, and you can have dictionaries in just about any language.)
No page-turning - just tap a convenient button that is ambidextrous.
You can read while eating without your book falling shut.
You can hold it with one hand and turn pages. Simultaneously. Difficult to do with a regular book.
When not in use, fold the cover shut, and drop it in the thinnest pocket of whatever bag you’re carrying with you. (You do have a cover for it, right?)
It weighs less than just about any book you could buy.
It takes up less space than just about any book you could buy.
While it does require charging, I find myself charging it less than once a month. (And I use it a lot.)
You can play games on it, if you’re so inclined.
You can have it for $69.
It uses the Amazon bookstore. Amazon is awesome.
It makes reading fun, so you read more than you would otherwise.
It can hold over a thousand books simultaneously, so you can start slimming down your library.

This is a short list of how I do most of my reading. If you don’t have a Kindle yet, look into it. It could change your life.

Book Review: Hands-on Testing with PHPUnit How-to

Thomas Hunter II — Mon, 22 Jul 2013 03:00:00 GMT

Pre-populating an Entity in a Symfony 2 Form

Jurgens du Toit — Mon, 22 Jul 2013 03:00:00 GMT

I’ve been working on teach-a-rific.com in my spare time, and I’m learning a lot about how Symfony 2 Forms work. One thing I need to do a lot, is to show a form with a entity field pre-populated. In this situation you also don’t want the user to be able to edit the field. This is how I did it.

First, you need to retrieve the mapped entity, in this case a Student, and set it in the entity which you’re creating a form for. In this case a ContactDetail. This all happens in the newAction method of the ContactDetailController. Notice how I save the student ID in a session variable. More on this later.

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17 <?php
//ContactDetailController::newAction
$detail = new ContactDetail();

if ($studentId = $request->query->get('student_id')) {
    $student = $this
        ->getDoctrine()
        ->getManager()
        ->getRepository('NotesNoteBundle:Student')
        ->find($studentId);
    if ($student) {
        $this->get('session')->set('contact_detail:create:student', $studentId);
        $detail->setStudent($student);
    }
}

$form = $this->createForm(new ContactDetailType(), $detail);

On to the form. Quite simply, if the entity already has a Student, don’t add the field for the student.

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18 <?php
use Symfony\Component\Form\AbstractType;
use Symfony\Component\Form\FormBuilderInterface;
use Symfony\Component\OptionsResolver\OptionsResolverInterface;

class ContactDetailType extends AbstractType
{
    public function buildForm(FormBuilderInterface $builder, array $options)
    {
        if ($builder->getData()->getStudent() === null) {
            $builder->add('student');
        }
        $builder
            ->add('type', 'choice', array('choices' => array('Email' => 'Email', 'Cellphone' => 'Cellphone')))
            ->add('content')
        ;
    }
}

On to the actual form. If the student field is defined in the form, display the form widget. Otherwise display the student in an uneditable text input. Displaying the student can be skipped if it’s not necessary.

1
2
3
4
5
6
7
8
9
10 {% if form.student is defined %}
    {{ form_row(form.student, { form_type: 'horizontal' }) }}
{% elseif form.vars.data.student.id is defined %}
    <div class="control-group">
        <label class="control-label">Student</label>
        <div class="controls">
            <span class="input uneditable-input">{{ form.vars.data.student }}</span>
        </div>
    </div>
{% endif %}

And on to the updateAction. Just get the Student whose ID we stored in the session, and set it on the ContactDetail before populating the form:

1
2
3
4
5
6
7
8
9
10
11
12
13
14 <?php
//ContactDetailController::createAction
$entity  = new ContactDetail();

if ($studentId = $this->get('session')->get('contact_detail:create:student')) {
    $student = $this
        ->getDoctrine()
        ->getManager()
        ->getRepository('NotesNoteBundle:Student')
        ->find($studentId);
    if ($student) {
        $entity->setStudent($student);
    }
}

Simple enough. Any suggestions on how to improve it, or comments on how to do it differently?

An Edgy iPhone 6 Concept

Zac Szewczyk — Sun, 21 Jul 2013 15:42:32 GMT

Last month, in Apple’s Wildcard, I predicted Tim Cook announcing an iPhone 5S rather than an iPhone 6 this fall, pointing to the 3G and 3GS, 4 and 4S models as proof. I did, however, hedge my bets with Tim Cook’s “Can’t innovate, my ass” comment:

Permalink.

Ghosts of Girlfriends Past

🦉 olshansky 🦁 — Sun, 21 Jul 2013 06:44:19 GMT

Olshansky's review of Ghosts of Girlfriends Past

The Machinist

🦉 olshansky 🦁 — Sun, 21 Jul 2013 06:43:34 GMT

Olshansky's review of The Machinist

Why I still recommend Windows

Nemo's Home — Sun, 21 Jul 2013 03:00:00 GMT

Even though I am a long time Linux user, and a big time fan of the many Linux distros that I’ve tried out over time, I still go around recommending Windows to people who ask me for advice. The only exception I make is when the person in question is a developer, in which case I try to convert them to the Church of Linux.

The main reason I recommend windows to non-developers is because it is a far better operating system than most Linux distributions (for general public). Now, before you bring out your pitchforks, hear me out.

The first and foremost reason that I give is that Windows sports a far better integration across all its services. Nautilus/Nemo in the Linux world do not reach same level of integration that Windows Explorer does. For instance, just look at the way the “Send To” feature works in explorer. To add a folder to the send to entry, you just have to add a shortcut to that folder inside the special “Send To” folder. On nautilus, the equivalent would be going about installing an extension, and editing a configuration file by hand.

Or take a look at how the “Play All” feature in Explorer. Or the “Libraries” feature in Windows 7. Or the simple way that you handle file sharing in Windows. Even though Linux has (arguably better) Samba support for files sharing, you have to go about editing a handful of files to make it work. I personally find apache easier to configure to just share files one way.

Games are another reason. Even though Steam is available on Linux, all of the non-Valve triple-A titles are missing on Linux. Even though I continue to buy and play the Humble Bundles that offer Linux as a platform, I’m reminded of the stark reality every day when my friends ask me if I’ve played a recent title such as Call of Duty, Metro, NFS or even Swapper.

The next peeve that comes to my mind is the ridiculous driver support. It has been improving since a long time, but its still not there. Even Ubuntu needs to fetch proprietary drivers for my WiFi support on Broadcom, which needs an internet connection in the first place. This means I need to find out a LAN network connection to even start using Ubuntu. Similarly the pain I’d to go through to install drivers for Ralink network drivers on a friend’s laptop was immense. I can never use circular scrolling or touchpad zoom on my laptop in Linux because there are still no drivers available anywhere for it. And don’t get me started on UEFI boot issues. No matter what people believe or pretend, hardware support is just not good enough to be relied on in the Linux world. As a side note, I haven’t synced my iPad in Ubuntu since I shifted to iOS 5, and apple driver support on Linux will remain abysmal forever just because iTunes will never be released for Linux. The last version of iOS that had music sync support (via libimobiledevice) was iOS 4.0 (released 3 years ago in June 2010).

Next I want to point put out the upgrade pain that everyone has to go through. It’s like a constant rite of passage, which turns a Linux noob into an actual user. I am yet to do an Ubuntu upgrade which went smoothly and didn’t break a thing; and I’ve been upgrading my Ubuntu since 10.04 was released. The upgrade tag on askubuntu is chock full of horror stories.

Another thing that frustrates me to no end is that the Ubuntu Dash, and the GNOME Overview are both slow as hell. I’m currently using Cinnamon, which is faster than both of these, but still an order of magnitude slower than the Windows Start Menu. Synpase is better, but cannot be set as the deafult.

I was using Windows 7 on my cousin’s laptop these last few days and I remembered the favourite app that I used to no end: Everything. It is the quickest file search I’ve ever used. The alternatives, in the Linux world are synapse, zeitgeist, and plain old locate command. The only issue is that I’ve to manually run updatedb manually, while Everything was always up to date, using the NTFS File Journal. To this date, I am yet to find a good enough alternative to Everything.

It is true that Windows lacks many of the good things that Linux distros provide, such as the excellent package management support, POSIX compatibility, and the plethora of tools we get on the command line; but at the same time, it is also a better operating system for most of the masses. I’ll continue to recommend Windows to all my non-developer friends till “The year of Desktop Linux” arrives.

Custom Difficulty Gives an Honest Challenge

Zac Szewczyk — Sat, 20 Jul 2013 18:09:50 GMT

“Instead of hurling myself at an insurmountable goal simply because it was named respectably, I came in with a personal best by asking more from my strengths and forgiving my weaknesses.”

It’s an article ostensibly about video games, though it may have just as well been about overcoming barriers by setting aside the often malformed and unrealistic expectations we often place upon both ourselves and our work.

Permalink.

Returning to Skyrim

Ben Overmyer's Site — Sat, 20 Jul 2013 03:00:00 GMT

The last time I posted about Skyrim, it was shortly after release. You can read the first in the series here. At the time, I was playing on the Xbox 360 version. This time around, I've purchased the Legendary Edition for PC. I'm also playing a Destruction mage instead of the heavily armed and armored warrior I focused on in the 360 version.

Besides taking a completely different character route this time around, I'm also focusing much more on quests other than the main line. I own a small house that I've built but not yet furnished, gotten a fair ways through the College of Winterhold quest line, and continue to light up vampires that seem to crop up all the time in areas I'm traveling to.

I heard so many awesome things about mods for the game that I just had to get the PC version. That, and I couldn't take screenshots in the 360 version, which was infuriating for someone who blogs about games. Today, I read an article someone reblogged on Reddit about a mod called Falskaar. Falskaar is unique in that it was produced chiefly by a 19 year old who declined to go to university in order to produce the mod. It took him a full year, and he's aiming to get a job at Bethesda by proving his dedication.

By all accounts, it's a damned good mod. I look forward to installing it when I finish with vanilla Skyrim.

If you're interested in hearing further about my adventures in Skyrim, by all means, let me know in the comments. Otherwise, next week I'll be writing about a topic near and dear to my heart…. sci-fantasy sandbox MMORPGs.

QEMU: MiraBox emulation

kyrofa's blog — Sat, 20 Jul 2013 03:00:00 GMT

As I mentioned in a previous post, I host various websites (including this one in the past) on a MiraBox sitting behind my tv. In that same post I outlined how Globalscale screwed me by mixing releases in the sources.list. I didn’t catch it until I had an unbootable system, and I had to completely rebuild my server which took weeks. I very nearly tossed the whole thing in favor of hosting my websites on a “real computer, made by people who knew what they were doing,” but I reminded myself why I settled on the MiraBox in the first place: I like embedded stuff.

100% CPU with UserEventAgent

Rich Dougherty — Fri, 19 Jul 2013 07:14:00 GMT

List of useful CAPTCHA Decoding Articles

Ben E. C. Boyter — Fri, 19 Jul 2013 02:46:43 GMT

This website ranks quite high in most search engines for the search term “captcha decoding” or some permutation of it. As such here are a collection of useful links if you are looking into doing such a thing. If any more come up I will be sure to update this post.

http://www.boyter.org/decoding-captchas/

Shameless self promotion but this link is why this page ranks so highly. Its an article I wrote some time ago about how to go about decoding a simple CAPTCHA. There is full source code and the principles can be applied to 90% of CAPTCHA’s out there. For the record it only came about because a colleague bet me that I couldn’t decode his websites CAPTCHA which was the one used in the article. Of course I waited till he changed it before publishing.

How to compile vim

Honza Pokorný — Thu, 18 Jul 2013 16:16:00 GMT

… from source when you’re using the homebrew-provided Python.

If you have installed Python via homebrew, your vim will compile fine but when a plugin tries to use Python to do some its work, vim will crash like this:

Not pretty.

Apparently, this is because vim will use the first Python it can find which in our case the homebrew-provided one. You can of course get a pre-compiled version and ignore this. But I like to use the latest version of vim and with the 7.4 beta, I have been doing that a lot lately…

So, what is one to do? We have to fix the PATH. Here is the script that I use to recompile vim. This goes in the root of the vim project.

export PATH=/bin:/usr/sbin:/sbin:/usr/bin

./configure \
        --enable-perlinterp \
        --enable-pythoninterp \
        --enable-rubyinterp \
        --enable-cscope \
        --with-features=huge

make

There and vim is now compiled properly with Python support that won’t make you cry.

Thanks to Steve Losh for pointing me in the right direction on this.

Rules for Fighting Fair

Josh Thompson — Thu, 18 Jul 2013 03:00:00 GMT

When a friend tells me they want to date someone, I ask them why. They always say “she’s pretty, funny, and kind”, or “he is handsome, funny, and cares for me”. Obviously. Have you ever wanted to date someone because they are ugly, boring, and mean?

So, rather than asking more questions where they will wax poetic about the wonderful qualities of their prospective partner, I ask one simple question:

How do they fight?

Anyone can be nice to someone when they are “in love”, or when they feel it is good for them. It takes skill and character to argue fairly, and it will tell you a lot about a person in a very short amount of time. For the same reason you should pay attention to how someone treats waiters, janitors, and others who they don’t have to be nice to.

It reveals a depth of character that you can’t otherwise see.

This list I put down is the rules Kristi and I try to abide by. We don’t always follow this list; but we do try. It dramatically improves the quality of our disagreements, helps us grow to love each other even more, and avoids causing damage to the relationship.

Rules for Fighting Fair:

Don’t yell. If you start yelling, call off the discussion and come back later.
Don’t yell. If you yell, they will dig in and fight harder.
Don’t yell. If you yell, you are causing far more damage in one minute than can be undone in twenty.
Stop fighting and start discussing

People can discuss things with angry tones and mean looks. Tell the person you were arguing with that you don’t want to fight, you want to figure out what’s going on and make it right. A discussion can be productive, a fight cannot be.

Don’t be so blinded by the topic at hand that you cannot listen for what heart issues are operating beneath the surface.

Example 1: Her reaction to your feedback on her driving is not about driving, it’s about a sense of control, and a desire to not feel out of control. She knows how to drive, but feels like her life is out of control, and your feedback makes it feel like one more thing - driving - is out of her control.

Example 2: His procrastination is not about being lazy, but a deep, deep fear of rejection and a sense of perfectionism, which is motivated by a fear of rejection. You can nag about doing something, or you can help him understand why he is equipped to go forth and JFDI.

You cannot talk about “heart issues” if you are yelling and arguing. So stop yelling and arguing. You are now talking in normal voices, and discussing.

Reaffirm long-term goals. (Also known as “keep your eye on the prize”.)

Are you trying to score rhetorical points and tear them down? If so, you are the problem, not them.

Are you trying to love them and you want good things for them? Let them know.

When you’re fighting, it’s easy to think they hate you, and that they are a miserable excuse for a person. Inform them that they are wrong. You do, in fact, love them and are committed to them. (That’s true, right?)

Don’t call them names, or ascribe negative character traits.

They are not stupid, they did something that you need help understanding.

They are not disrespectful, they did something that seemed disrespectful.

Encourage them even in the way you bring up “problems”. Give them the benefit of the doubt.

You bring just as many warped perspectives and screwed up ideas to the table that they do. Don’t put the blame all on them.

Arguments are frustrating. Verbally “pause” the argument, and ask for a hug. Then keep talking. Or shelve the discussion and come back later.

These are Kristi’s additions to the above list:

Don’t interrupt
Don’t yell (Do you see a theme here?)
Don’t make sweeping statements like “never” and “always”
Phrase things like “this is what I’m seeing” or “this is how I feel” instead of “this is what you did”
Don’t say “why did you do that” say “can you help me understand where you’re coming from”
Listen!
Genuinely try to put yourself in their shoes
Give each other the benefit of the doubt
Never hang up on each other
Pause - remind each other that you love each other.

This entire list can be summarized in one rule: When fighting, be respectful and loving.

This is a tall order, for the record. We certainly don’t have it figured out, but we’re working on improving the quality of our fights. Already they are pretty good, and we want them to be better. I would recommend you talk with your significant other regularly about the quality of your arguments. It is time well spent.

moved to new static site generator

zserge's blog — Thu, 18 Jul 2013 03:00:00 GMT

This website has been powered by poole for a long time. I don’t think I have any real reasons to migrate from poole. Do you know there are static site generators written in UNIX Shell? I think it’s a good choice for old-school programmers, who feel uncomfortable with Ruby, Python and even Node.js. All that shell madness started with werc, a nice tool used by suckless and cat-v. Then sw appeared.

Sunshine Coast: Thormanby Islands & Smuggler Cove Kayak Trip

duncanlock.net — Wed, 17 Jul 2013 10:05:32 GMT

A trip report from our Canada Day 2013 long weekend kayak camping trip to Thormanby Islands, Smuggler Cove & Secret Cove, on the sunshine coast.

Figure 1. We started at Welcome Beach on Saturday afternoon, kayaked over to Thormanby for lunch, then up and round to Buccaneer Bay - stunning camp on the dunes, then over to Smugglers Cove on Sunday. Camped there Sunday night, with a trip to Secret Cove in the afternoon, then back to Welcome Beach on Monday morning. (Map screenshot courtesy and copyright Google Maps. Annotations added by me.)

Welcome Beach to Thormanby

On Saturday morning, we packed up our tent & got picked up by Erika from Talaysay Tours, who drove us, with the Kayak on the roof, to Welcome Beach, about 15 mins further up Highway 101, past Sechelt.

We unloaded the Kayak, took it down to the surf and loaded all our gear into it, ready to paddle off into the blue.

Figure 2. Standing on Welcome Beach, looking south-west across Welcome Passage towards the gap between Merry Island on the left & South Thormanby Island on the right.

The first stretch of paddling was about 45 minutes, across the widest part of Welcome Passage. The sea here is very sheltered and calm - and we had stunning weather: hot and sunny, with just enough sea breeze to keep cool. Welcome Passage is quite busy with boat traffic and the water was very murky, full of churned up algae, sea weed and a fair bit of floating lumber. We didn’t spot any marine mammals in Welcome Passage the entire weekend - and not much other sea-life either. It’s a busy & noisy waterway in the summer (by BC standards) - a huge contrast to the relatively pristine waters of Sechelt Inlet, where Seals, Starfish, Sunstars and Sea Cucumbers abound.

Once we’d made it to the other side, we pulled up at a tiny deserted beach about ½ way up the east side of South Thormanby Island, for cider and snacks. The water here was a bit clearer - and we watched Ospreys hunt in the bay in front of us while we rested:

Figure 3. You can see Welcome Beach where we started, in the background, back across Welcome Passage.

Welcome Passage to Buccaneer Bay

After a quick break we paddled off, up the east side of the island, round the top and into Buccaneer Bay. As Welcome Passage narrows the current and swell get slightly stronger - but it was such a calm day it was hardly noticeable. This side of Thormanby is very craggy with step cliffs and deep little bays - topped with characteristically gnarly Arbutus trees.

All along the passage, the high tide line was strongly marked on the cliffs at each side - visible even on the opposite side. This turned out to be a carpet of tiny mussels, almost like fur, clinging to the rocks & completely covering them from the high-water mark down.

Once you reach the top of the passage, the big blue expanse of the Georgia Strait opens in front of you, with the Sunshine Coast on the right and Texada Island in the distance on the left.

The top of South Thormanby ends in a series of craggy fingers of rock, sloping down into the Strait, each with a long deep bay between. Some of these have small houses and private docks in - with, presumably, fabulous views up the coast.

Once you round the corner, the very large sheltered Buccaneer Bay opens up on your left. There were lots of boats moored in and around the islets at the top of the bay, and a few holiday cottages and docks along the shore. These gave way to larger boats as we neared the anchorage at the end of the bay.

Camping at the Gap

We beached the Kayak at the end of the bay, at Buccaneer Bay Provincial Park. This is a sand spit that joins North and South Thormanby Islands together - with space for ~10 tents. It has stunning views - if you face one way, you can see up Buccaneer Bay, to the Sunshine Coast, with the Coastal Mountains in the distance - if you turn around, you can see across Georgia Strait to Vancouver Island on the horizon. Welcome to The Gap:

Figure 4. Standing on the Gap, looking north east, towards the mouth of the bay.

Figure 5. …and looking south west, towards Vancouver Island.

You could easily imagine 17th century pirates anchoring their galleons in the bay and drinking rum around campfires on the beach - an effect heightened when this two masted schooner sailed into the bay a few hours after we arrived:

Figure 6. This beautiful two masted schooner sailed into the bay a few hours after we arrived. As we sat on the beach, reading, propped up on a log, they dropped sail, anchored and the crew rowed ashore in long boats.

We made camp, walked around the beaches, took in the views and had a relaxed dinner. At some point, our neighbours slipped off in one of their kayaks. They returned about an hour later, with the front cockpit full of fish - which they cleaned and gutted in the surf and cooked over a fire. Prior to this, I was quite happy with my stew, but I admit, I was rather envious of their fishing skills.

We were treated to a glorious sunset to round off a pretty perfect day:

Buccaneer Bay to Smuggler Cove

On Sunday morning, we had a lazy brunch on the beach - and watched an Osprey catch theirs in the bay, right in front of us. We eventually packed the camp back into the kayak and headed out, up the east side of North Thormanby island, to check out the beaches we saw on the way in.

There are lots more holiday cottages and lots more boats moored on this side of the bay, especially as you approach the long, sandy, Vaucroft Beach. This is a popular day trip spot for boaters, as it’s very close to Secret Cove, a fairly large marina. The beach itself is light sand, fairly unusual in BC, and could easily pass for the Caribbean, on a sunny day.

Figure 7. There was also a float plane moored up just off Vaucroft Beach.

After passing Vaucroft beach, we headed east, towards the coast and Smuggler Cove. We paddled across the wide mouth of Buccaneer Bay, past the fingers of South Thormanby and across Welcome Passage in the glorious sunshine. Paddling towards the coast, we had great views of the Coastal Mountains ahead of us and the expanse of the Strait on our left the whole way over. We passed quite a few boats buzzing back and forth between Secret Cove & Thormanby, including a water taxi.

The entrance to Smuggler Cove is almost invisible until you get quite close. A small gap between two rocky outcrops, leads you into a little hidden world of sheltered bays and waterways, almost completely separate from the ocean outside. Just inside the entrance in the first large cove, we came across 16 yachts moored up and rafted together - “Millionaires Row”. We later met a very nice couple from one of these yachts - apparently it was a local club meeting up for the weekend.

Figure 8. A panorama of row of yachts rafted up for the weekend at Smuggler Cove. The gap on the left is the entrance to the cove, with the tip of North Thormanby island and Vaucroft Beach visible in the distance

We wound our way deeper into the cove, around islands and moored boats, looking for somewhere to beach - or for signs of the camp site. Eventually we found a small muddy beach right at the southern end of the cove and hauled out. We scouted around and found people camping just up in the woods, along with a pit toilet. We unpacked the kayak and made camp.

Figure 9. Our little tent.

Once we’d got everything set up, we headed back out, for a trip to Secret Cove.

Trip to Secret Cove, for Ice Cream, Real Bathroom

We paddled back out of the cove and right, around Capri Isle and along the coast towards Secret Cove. True to it’s name, Secret Cove is well hidden behind islands and it opens up into a series of long deep bays once you get past the entrance - most of it isn’t visible until you get inside, past Jack Tolmie and Turnagain Islands.

There are several marinas, chandleries, floating bars and tens - possibly hundreds - of docks, moorings and cottages nestled inside Secret Cove’s many deep bays, accommodating hundreds of water craft of all shapes and sizes. From our little kayak, to old log-raft tugs, the occasional trawler, multi-million dollar yachts - and everything in between.

Floating in, under and through this whole… regatta in the sunshine, in our little kayak, was interesting and fun.

Over to the north west side we eventually found the government dock and marina - with a boat fuelling dock, floating restaurant and shop. We tied the kayak to the dock at the back and climbed out. We proceeded to make extensive use of their bathroom facilities, before buying cold drinks, ice cream and After Sun lotion from the shop. We then sat in the shade on the edge of the dock and watched the world go by for a while.

Back to Smuggler Cove, dinner & Beavers

We paddled back to Smuggler Cove, tied up the kayak and explored the trails around the cove a little before dinner.

After dinner, we walked along the forest trail the other way, away from the cove into the woods. A little way in, in the gathering twilight, the trail gave way to a wooden walkway over a shallow lake. The lake turned out to be a wetland habitat created by beavers, who had drowned the bottom of this little forest valley by damming a creek.

Figure 10. Our first Beavers! This is looking away from the dam, down the valley. We took this picture in the morning, when we came back with the camera. That walkway is courtesy of Parks Canada, not the beavers, obviously.

We didn’t know this was here, so it was a nice surprise - and the drowned forest was very atmospheric in the gloaming.

As we approached the edge of the lake, we almost immediately disturbed a beaver - alarmed, it made a loud slap with its broad tail on the water’s surface, dove in and swam away.

As we walked around the lake, we heard two more making their (very load) tail slapping alarm call and swimming off. We just saw the tail end of one of them as it dived off a log.

Homeward Bound: Smuggler Cove to Welcome Beach

We went and checked out the Beavers again in the morning light - hoping to see one this time, but no luck. The lake was buzzing with dragonflies and we saw a frog (or maybe a toad?) basking on the mud at the side of the walkway - just a few of the benefits of beaver dams.

We left Smuggler Cove before lunch, because we needed to be back at Welcome Beach by 2pm, to be picked up by Erika for our ride back into Sechelt. The paddle back was about 7 km, which took us roughly 2 hours.

Paddling back down Welcome Passage, we passed several herons, fishing from the rocks by the shore. We also passed a huge yacht, ploughing it’s way north.

We eventually found the correct beach and hauled out, rested, had lunch and unpacked. Erika arrived at 2pm and we loaded the Kayak and our gear into her jeep and she drove us back to Sechelt.

Sechelt were having their Canada day parade, so after a few diversions, we just made it to the Langdale bus in time - for the start of the trip home.

All in all - an amazing weekend. Shower time!

Logistics & Getting there from Vancouver

We don’t own a car - but getting to the sunshine coast is very easy on public transport - and much cheaper than taking a car on the ferry. Here’s how we did it:

We took the #257 Express Bus from down-town Vancouver to Horseshoe Bay. We normally get on at the stop on West Georgia St., right outside The Bay. You can also catch the #250 from here - which isn’t an express but doesn’t take too much longer. This costs $2.75 per person.

Once we got to Horseshoe Bay, we took the ferry to Langdale. These are fairly frequent, but with occasional gaps, so check the schedule. As a foot passenger, we’ve never had to wait or not been able to get on - we just walk onto the first ferry that turns up. This is $15 per person, including the return trip. If you’re planning to do this often, it might be worth getting a BC Ferries Experience card. You have to pre-load it with at least $60, but you get ~20% off most[1] fares.

Figure 11. Bus from Vancouver to Horseshoe Bay, then Ferry to Langdale, followed by bus to Sechelt. Taxi to Porpoise Bay camp site, stay overnight. Lift to Welcome Beach with Kayak people, then off! Map screenshot courtesy (and copyright) Google Maps. Annotations added by me.

The ferry crossing is a very scenic 45 min trip across Howe Sound. Once we arrived at Langdale, we followed the other foot passengers out, through the foot passenger tunnel to the car parks, then caught the ‘Highway 101’ bus - it’s the only bus from the only bus stop, so you can’t really get this wrong - although there are express and non-express buses, which are quite a bit slower. Anyway, we got off at Sechelt, outside Trail Bay mall (the last stop). This costs $2.25 per person.

Porpoise Bay

We stayed overnight at Porpoise Bay Provincial Park, just outside Sechelt. This park - and Sechelt Inlet that it’s on, is worth a trip on its own - the Inlet has very nice sheltered Kayaking with lots of quiet, empty camping and loads of wildlife.

To get here, we normally catch a Taxi from Trail Bay mall in Sechelt to the park - it’s ~5km out of Sechelt; this costs ~$15, call Sechelt Taxi 604-989-8294 – and BC Parks are ~$11 per night, per group.

For this trip we overnighted here so that we could get a lift to and from Welcome Beach (and rent a Kayak) from Talaysay Tours, who rent Kayaks from the beach at Porpoise Bay, among other locations. They have good equipment and are extremely friendly & helpful.

Footnotes & References

BC Ferries Experience Card Summary: You have to pre-load with $60 at a time and you get ~20% off tickets, although not all routes, see here for more info. For example, rather cynically, you can pay for a Horseshoe Bay to Nanaimo ticket with one but you don’t get any discount. Also there a load of T&C’s, so think about it before getting one. ↩

Adam Wexler: Founder of Insightpool

Sam Solomon — Tue, 16 Jul 2013 03:00:00 GMT

Adam Wexler is the founder and Chief Strategy Officer at Insightpool, the leader in social engagement automation.

Displaying a processes output on a web page with Websockets and Python

Tom Forbes — Mon, 15 Jul 2013 21:40:38 GMT

A few days ago a colleague of mine asked me how you would pipe the standard output of a process into a browser. I hacked around for a few hours and came up with a websockets based solution (using Twisted and Autobahn.ws ) that you can see below ( Your browser needs to support WebSockets, sorry IE9 a...

How I back up my laptop

Honza Pokorný — Mon, 15 Jul 2013 21:20:00 GMT

For the longest time, I was using Time Machine to keep copies of my files. I don’t remember ever wishing I could go back in time and retrieve an older version of a file. What does keep me up at night though is forever losing all of the pictures of our kids because my hard drive failed.

I also don’t particularly like tools like Time Machine, Carbon Copy Cloner or SuperDuper. They are some kind of GUI app that does stuff, and I like my unix tools.

Here are my requirements for a good backup solution:

Incremental - that means don’t overwrite older backups and don’t back up everything every time
Efficient storage - I shouldn’t need 10 TB to keep a few backups of my hard drive
Bootable - if my hard drive fails or laptop gets stolen, I want to be able to back to work quickly

When you do some research into this, you will see mostly suggesting rsync. It can copy your entire drive and does smart, incremental backups. Except it overwrites stuff and you only get to keep the latest copy.

Enter bup. Bup is simply amazing. It’s based on git and it gives you automatic incremental, deduplicated, shared backups. Free and open source.

Backing up huge virtual machines? It only backs up what changed, not the whole file. Multiple copies of the same stuff on your hard drive? Only needs to store one copy. Have a look at their documentation for more information about how it works and what the benefits are.

The way you use bup is by creating a tar archive stream of all your data and sending it to bup on stdin. Bup takes it, chunks, deduplicates it and stores in a git repo.

The canonical example goes like this:

tar -cvf - /etc | bup split -n local-etc

The -n flag just allows you to name your backup.

Next, we have to figure out how to tar up our entire drive. This can be a little tricky because there are some special files which we don’t want to copy over. After much trial, error and googling, I came up with the following list of exclusions. Note that this only applies to OS X.

.Spotlight-*/
.Trashes
/afs/*
/automount/*
/cores/*
/dev/*
/Network/*
/private/tmp/*
/private/var/run/*
/private/var/spool/postfix/*
/private/var/vm/*
/Previous Systems.localized
/tmp/*
/Volumes/*
*/.Trash

Save this to excludes.txt and then use this tar command:

$ tar -cvf - / -X excludes.txt | bup split -n backup

This takes about 1-2h on my system (128GB SSD, 500GB 5400rpm external). Subsequent backups take a lot less time. As far as actual backup goes, we’re done.

How do you restore?

The nice thing about bup is that it stores your backups in a git repository. This means that you can go back in history and decide from which point in time you’d like to restore. Bup allows you to spit out a tar file like this:

$ bup join backup -o backup.tar

This will again take some time and use quite a bit of resources (git will eat your RAM and CPU - a 6GB git process anyone?). Once that is done, you can extract the tar to a drive that can be booted into. This can be the internal drive on a new computer or a GUID-partitioned external drive.

Once extracted, you just have to bless the data to make it bootable:

$ sudo bless -folder /System/Library/CoreServices

Then, you should reboot your Mac while holding down the Option key. This will show you the boot order menu and allow you to specify where you’d like to boot from.

Of course, you should wrap all of this in a script and run it periodically.

The revolution will be downloaded

Zac Szewczyk — Mon, 15 Jul 2013 20:29:00 GMT

Great story from none other than The Verge about the App Store on it’s fifth birthday.

Permalink.

Some Toaster AI improvements

Liza Shulyayeva — Mon, 15 Jul 2013 17:50:13 GMT

I made some more improvements to Toaster yesterday and this morning. Specifically:

Have Toaster look for an enemy tile to place Grenades on

Before, Toaster looked for an empty space on the grid to place whatever tile it was holding. Now, if that tile is a grenade, it looks for an enemy tile to place it on. If it can’t find one, it picks another tile from its queue instead because placing grenades on empty grid spaces is pointless. Right now this will break the game if all three tiles in Toaster’s queue are grenades (because it’ll keep trying them one after the other indefinitely, never actually making a move) and that’s something I’ll be fixing today.

Waking Up Early 2.0

Josh Thompson — Mon, 15 Jul 2013 03:00:00 GMT

A few months ago, I wrote about waking up early. I tracked my progress for almost a month, and most of the days I woke up between 4:45 and 6:00. My “must be up by” time is 7:30a, so waking up more than an hour and a half early counts as a huge win.

From mid-may until June 7, I woke up consistently very early. I had excellent success. The reason, however, was not controlled by me. I woke up early because I went to bed early. My wife teaches kindergarten in Prince George’s County, and had two classes of 25 kids. Her assistant principal, who’s been doing what he does for about 30 years, told Kristi that her kindergarten class had some of the worst-behaved kids he’d ever seen. more

These rough kids (several emotionally disturbed kids, more than a few suspensions for violence, etc.) are why Kristi is teaching where she is teaching, but it is exhausting. This means that my wife would usually go to bed by 10:00 pm. We always go to bed at the same time, so this meant I was going to bed at 10:00. When I’m in bed that early, it is so easy to get up at 5:something.

I’ve figured out how to not hate getting up early; I actually enjoy it. So now the challenge is getting enough sleep so I can get up early.

Don’t wake up early

When I was thinking about waking up early, I lived in a context where the default was going to bed early. Since Kristi’s finished teaching for the summer, our schedules (and bedtime) have developed a lot more flexibility. For the last few weeks, my bedtime has drifted towards midnight or later. I would wake up at 7:00 or so, or if I woke up early, I’d be tired throughout the day. Being tired during the day sucks.

I am shifting my attitude from being one who wakes up early (when it’s easy) to one who goes to bed early. I love getting up early, but until now, I’d not considered my evening ritual. I just coasted through the day until I decided it was time to start getting ready for bed, which takes an undetermined amount of time.

Going to bed early

My action steps for the next two weeks are pretty easy, and it’s pure monitoring. I am not yet trying to change my behavior. I want to set myself up for success (what a trite saying, huh?) but this means having accurate expectations.

Without an accurate understanding of where I am now, my attempt to set correct goals hinges more on luck than good planning. To facilitate this good planning, I’m keeping track of when I go to bed. Self-monitoring generally leads to low-level improvement by itself, so I’m hoping to move in a good direction simply by paying attention to that which I want to change.

Action Steps

I will pay attention to two things every evening.

What time I start going to bed.
What time I actually lay down in bed.

I am tracking what time I start going to bed so I know how long it takes, for the same reason we all know how much time we need to get ready before we leave in the morning. If you have to leave the house at 8:00, you know your alarm has to go off at 7:15, or something like that.

I’m tracking what time I actually lay down in bed first so I can actually quantify the first metric (If I know I start going to bed at 11:15, and wake up at 6:30, that doesn’t really tell me anything) but so I can know how much sleep I’m getting every night, and how I feel in the morning. Different people have different sleep needs, supposedly between seven and eight hours. I would like to better know my own sleep needs.

Your turn

If you’re interested in waking up earlier, do this with me. I’ll post your results along with mine, and you’ll be (mildly) internet famous! You don’t actually need to wake up at any different time than you already do, you just need to chart when you start going to bed, and when you actually go to bed. (It takes a sticky note and a pen.)

Leave a comment here, or shoot me an email. You don’t have to start today (Monday) just sometime this week.

Slowly improving Toaster AI for #1GAM

Liza Shulyayeva — Sun, 14 Jul 2013 20:02:43 GMT

My Interdiction single player AI (named Toaster) has been coming along slowly. It’s still very far from the unbeatable cylon I want it to be, but it at least tries to defend itself by intercepting the player and attempting to build up its own lines.

In Search of a Greater Barrier

Zac Szewczyk — Sun, 14 Jul 2013 14:18:37 GMT

I have always had great trouble starting to write. I seldom found the actual act of writing difficult, only getting started. The same goes for programming: once I had successfully implemented the main functionality I set out to imbue First Crack with, I ceased iterating on the project not for lack of new ideas — with the underlying code functional and working, I wanted to design an accompanying GUI, for example — but instead because I lacked the drive to approach such a monumental task. I was burned out, I suppose, tired after working on the same project for months and months, and stuck in a linkblog rut when it came to writing.

Permalink.

Nothing More than a Theory

Zac Szewczyk — Sun, 14 Jul 2013 13:57:44 GMT

With the minor caveat of having drawn its entire inspiration solely from one of the most unintelligible and idiotic videos I have ever seen, Jon Negroni’s theory that all Pixar movies not only take place within the same world but also serve to establish a connected timeline is nevertheless a very interesting one. Like most conspiracy theories, Jon’s proposition makes use of many seemingly related happenstances and strings them together in to a plausible proposition, which he then offered up as a work-in-progress theory.

Permalink.

When HN gets in the way

Honza Pokorný — Sun, 14 Jul 2013 04:06:00 GMT

Reading stuff online can become addictive. So addictive, in fact, that it can negatively affect your productivity as a programmer. Most of us go to Hacker News or Reddit to get our dose of news. We justify it by saying that it’s research or that we are trying to stay current in the community. Whatever your excuse, you know you have a problem when you check Hacker News every ten minutes just to see if anything new and awesome has been added.

“Close Hacker News and open a f***ing book.” – Steve Losh in this talk.

Maybe you have already gotten over the initial self-denial and you have added some entries to your /etc/hosts file to keep yourself from constantly going to those sites. That’s all well and good but I think we can do better.

You’ve already opened the tab and you are now staring at a blank error page. Why not put something more useful there?

Me, I like to learn new things. There are way too many things I’d like to learn. Why not show a list of things I’d like to learn and allow me to click through to the website?

I have installed nginx on my machine and set up a simple static page with a few links things like Learn You a Haskell for Great Good or Steve Losh’s Learn Vimscript the Hardway. Now every time I go to HN, I see those links and am reminded that I wanted to spend some time learning those things…

Steps

Install nginx. brew install nginx or sudo apt-get install nginx or whatever might apply to you.

Stick this in your nginx.conf:

worker_processes  1;

http {
    include       mime.types;
    default_type  application/octet-stream;

    keepalive_timeout  65;

    server {
        listen       443;
        server_name  news.ycombinator.com;

        ssl                  on;
        ssl_certificate      /usr/local/etc/nginx/server.crt;
        ssl_certificate_key  /usr/local/etc/nginx/server.key;

        location / {
            root   html;
            index  index.html index.htm;
        }
    }

    server {
        listen       80;
        server_name  reddit.com;

        location / {
            root   html;
            index  index.html index.htm;
        }
    }

}

If any of the sites you are blocking are served over SSL, you will need to get a self-signed certificate. This is a one time setup and doesn’t really take that long to do.

$ openssl req -new -x509 -nodes -out server.crt -keyout server.key
$ chmod 600 server.key

Now you just place those two files to the locations referenced in the above nginx.conf file and restart nginx.

And here is how you can make Chrome stop complaining about your self-signed certificate (source).

In the address bar, click the little lock with the X. This will bring up a small information screen. Click the button that says “Certificate Information.”
Click and drag the image to your desktop. It looks like a little certificate.
Double-click it. This will bring up the Keychain Access utility. Enter your password to unlock it.
Be sure you add the certificate to the System keychain, not the login keychain. Click “Always Trust,” even though this doesn’t seem to do anything.
After it has been added, double-click it. You may have to authenticate again. Expand the “Trust” section.
“When using this certificate,” set to “Always Trust”
That’s it! Close Keychain Access and restart Chrome, and your self-signed certificate should be recognized now by the browser.

Conclusion

Hopefully, this will be helpful to you and nudge you every now and then to learn something you’ve been putting off.

Updating the Genome Decoder

John Jacobsen — Sat, 13 Jul 2013 03:00:00 GMT

In our last post we saw that so-called “N-blocks” (regions of the genome for which sequences are not available) were not getting decoded correctly by our decoder.

The solution is to look back into the so-called “file index” which specifies where the N-blocks are, and how long each block is. The modified decoder looks like this:

(defn genome-sequence
  "
  Read a specific sequence, or all sequences in a file concatenated
  together; return it as a lazy seq.
  "
  ([fname]
     (let [sh (sequence-headers fname)]
       (lazy-mapcat (partial genome-sequence fname) sh)))
  ([fname hdr]
     (let [ofs (:dna-offset hdr)
           dna-len (:dna-size hdr)
           byte-len (rounding-up-divide dna-len 4)
           starts-and-lengths (get-buffer-starts-and-lengths ofs 10000 byte-len)]
       (->> (for [[offset length] starts-and-lengths
                  b (read-with-offset fname offset length)]
              (byte-to-base-pairs b))
            (apply concat)
            (take dna-len)
            (map-indexed (fn [i x] (if (is-in-an-n-block i hdr)
                                    :N
                                    x)))))))

The primary modification is the map-indexed bit at the end, which looks up the position of the base pair in the index using the is-in-an-n-block function:

(defn is-in-an-n-block
  ([x hdr]
     (let [{:keys [n-block-starts n-block-sizes]} hdr]
       (is-in-an-n-block x n-block-starts n-block-sizes)))
  ([x n-block-starts n-block-lengths]
     (let [pairs (map (fn [a b] [a (+ a b)])
                      n-block-starts n-block-lengths)]
       (some (fn [[a b]] (< (dec a) x b)) pairs))))

I tested the new decoder against FASTA files of the first two chromosomes of the human genome using the same procedure we used for yeast in my validation post. The N-blocks (and all other sequences) were decoded correctly.

The astute reader will note the use of lazy-mapcat instead of =mapcat:

(defn lazy-mapcat
  "
  Fully lazy version of mapcat.  See:
  http://clojurian.blogspot.com/2012/11/beware-of-mapcat.html
  "
  [f coll]
  (lazy-seq
   (if (not-empty coll)
     (concat
      (f (first coll))
      (lazy-mapcat f (rest coll))))))

A version of genome-sequence which used mapcat instead of lazy-mapcat worked fine for individual chromosomes (file sections), but consistently ran out of memory when processing whole genome files. It took a bit of research and hair-pulling to figure out that there is a rough edge with mapcat operating on large lazy sequences.

Lazy sequences are a strength of Clojure in general – they allow one to process large, or even infinite, sequences of data without running out of memory, by consuming and emitting values only as needed, rather than all at once. Many of the core functions and macros in Clojure operate on sequences lazily (producing lazy sequences as output), including map, for, concat, and so on. mapcat is among these; however, mapcat is apparently not “maximally lazy” when concatenating other lazy seqs, causing excessive memory consumption as explained in this blog post. Using that post’s fully lazy (if slightly slower) version of mapcat fixed my memory leak as well. Though lazy seqs are awesome in many ways, one does have to be careful of gotchas such as this one.

So, in the process of handling this relatively large dataset, we have discovered two rough edges of Clojure, namely with mapcat and count. We shall see if other surprises await us. Meanwhile, the latest code is up on GitHub.

Back to Frequencies

Now that we are armed with a decoder which handles N-blocks correctly, let us return to our original problem: nucleotide frequencies. For yeast, we again have:

jenome.core> (->> yeast genome-sequence frequencies)
{:C 2320576, :A 3766349, :T 3753080, :G 2317100}

Same as last time. For humans,

jenome.core> (->> human genome-sequence frequencies)
{:N 239850802, :T 856055361, :A 854963149, :C 592966724, :G 593325228}

As expected, the GAC numbers are the same as what we had previously; only T and N have changed. The distributions look like so:

Updated nucleotide frequencies

We can see that Chargaff’s Rule obtains now: A/T ratios are equal, as are G/C ratios. (BTW, this rule is intuitively obvious if you consider that in the double-helix structure, As are paired with Ts and Gs are paired with Cs.) Interestingly, the relative abundance of GC pairs in the human genome is higher than it is in yeast.

Timing and Parallelizing

Many of these “queries” on our data take a long time to run (particularly for the human genome). So as not to tie up my REPL and preventing me from doing other (presumably shorter) experiments, I find it helpful to run such tasks inside a little macro (similar to Clojure’s time) which performs the computation in a thread and, when the task is finished, prints the time elapsed, the code that was run, and the result:

(defmacro tib
  "
  tib: Time in the Background
  Run body in background, printing body and showing result when it's done.
  "
  [expr]
  `(future (let [code# '~expr
                 start# (. System (nanoTime))]
             (println "Starting" code#)
             (let [result# ~expr
                   end# (. System (nanoTime))
                   dursec# (/ (double (- end# start#)) (* 1000 1000 1000.0))]
               (println (format "Code: %s\nTime: %.6f seconds\nResult: %s"
                                code#
                                dursec#
                                result#))
               result#))))

For example, our overflowing count runs as follows:

(tib (count (range (* 1000 1000 1000 3))))
Starting (count (range (* 1000 1000 1000 3)))
;; ...
Code: (count (range (* 1000 1000 1000 3)))
Time: 399.204845 seconds
Result: -1294967296

Another tool which has proved useful is:

(defmacro pseq
  "
  Apply threading of funcs in parallel through all sequences specified
  in the index of fname.
  "
  [fname & funcs]
  `(pmap #(->> (genome-sequence ~fname %)
               ~@funcs)
         (sequence-headers ~fname)))

This threads one or more funcs through all the sequences in the file, as mapped out by the file headers. The magic here is pmap, which is map parallelized onto separate threads across all available cores. pseq maxes out the CPU on my quad-core Macbook Pro and gives results significantly faster:

Code: (->> yeast genome-sequence frequencies)
Time: 33.090855 seconds
Result: {:C 2320576, :A 3766349, :T 3753080, :G 2317100}

Code: (apply (partial merge-with +) (pseq yeast frequencies))
Time: 16.056695 seconds
Result: {:C 2320576, :A 3766349, :T 3753080, :G 2317100}

With our updated decoder and these new tools, we can continue our poking and prodding of the genome in subsequent posts.

How to Write a Bug Report

Untrod — Thu, 11 Jul 2013 10:32:00 GMT

Writing good bug reports is the difference between actually seeing your bug get fixed and sending protracted emails over the course of a week convincing a developer that there is, in fact, a bug. By far the most important information you can provide in a bug report are clear reproduction …

Changing Our Development Process

Untrod — Thu, 11 Jul 2013 10:22:00 GMT

This is a post about change management at a start-up.

Kaggle, at just under 20 people, is an interesting size because we are right on the cusp of being able to wing it in terms of process and communication, and needing more formal processes to make sure changes and plans …

About

Ben E. C. Boyter — Thu, 11 Jul 2013 07:02:47 GMT

I’m a software developer by trade who after years of leaving articles and blog posts all over the place has finally gotten around to consolidating them all into this single site.

I am a professional software engineer who has been working in development with a focus on testing for over 15 years. In that time I have played an integral part in developing and implementing testing methodologies for all sorts of projects including,

Decoding CAPTCHA’s

Ben E. C. Boyter — Thu, 11 Jul 2013 06:00:02 GMT

Looking for a practical guide to CAPTCHA decoding? All About CAPTCHA’s. This eBook will teach you how to identify weaknesses and exploit CAPTCHA’s from beginning to end. Buy now using Leanpub

Most people don’t know this but my honors thesis was about using a computer program to read text out of web images. My theory was that if you could get a high level of successful extraction you could use it as another source of data which could be used to improve search engine results. I was even quite successful in doing it, but never really followed my experiments up. My honors adviser Dr Junbin Gao http://csusap.csu.edu.au/~jbgao/ had suggested the following writing my thesis I should write some form of article on what I had learnt. Well I finally got around to doing it. While what follows is not exactly what I was studying it is something I wish had existed when I started looking around.

Getting Our Hands Dirty (with the Human Genome)

John Jacobsen — Wed, 10 Jul 2013 03:00:00 GMT

In the past two posts, we created and validated a decoder for genome data in 2bit format.

Let’s start actually looking at the human and yeast genomes per se. First, if you haven’t downloaded it yet, you’ll need a copy of the human genome data file:

cd /tmp
wget http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.2bit

(Depending on your local bandwidth conditions, this can take quite awhile.)

Again we define convenience vars for the two data files:

(def human "/tmp/hg19.2bit")
(def yeast (as-file (resource "sacCer3.2bit")))

The simplest thing we can do is count base pairs:

jenome.core> (time (->> yeast genome-sequence count))
"Elapsed time: 17577.042 msecs"
12157105
jenome.core> (time (->> human genome-sequence count))
"Elapsed time: 4513537.422 msecs"
-1157806032

WTF?! count has overflowed (if you convert -1157806032 to an unsigned int you get 3137161264, which makes more sense). This, and our running time of 75 minutes, is our first hint of pain associated with handling with such a large dataset.

It’s worth noting that number overflows in Clojure generally raise an ArithmeticException (or silently get promoted to BigIntegers, depending on the operators used) – I emailed the Clojure mailing list about this surprise and a ticket has been made.

The overflow is easily enough remedied with a non-overflowing count (inc' is one of the aforementioned promoting operators):

(defn count' [s]   ;; Regular count overflows to negative int!
  (loop [s s, n 0]
    (if (seq s)
      (recur (rest s)
             (inc' n))
      n)))

Which gives us the unsigned version of our previous answer, in 10% more time:

jenome.core> (time (->> human genome-sequence count'))
"Elapsed time: 4931630.301 msecs"
3137161264
jenome.core> (float (/ 3137161264 12157105))
258.05167

(Update 2/14/2014: Matthew Wampler-Doty came up with a more elegant count':

(defn count' [s] (reduce (fn [x _] (inc x)) 0 s))

which is about 25% faster than my slightly more naïve version.)

We now have our first bit of insight into human vs. yeast genomes: we humans have about 260x more base pairs than yeast do.

The next question is, What are the relative proportions of occurrence of each base pair? Easily answered by the frequencies function:

jenome.core> (->> yeast genome-sequence frequencies)
{:C 2320576, :A 3766349, :T 3753080, :G 2317100}
jenome.core> (->> human genome-sequence frequencies)
{:T 1095906163, :A 854963149, :C 592966724, :G 593325228}
jenome.core>

Those numbers have a lot of digits, so here are some bar charts:

Our first stab at nucleotide frequencies

Though we are playing ignorant data analysts rather than real biologists, this looks a bit fishy right out of the gate. Why so many Ts?

As a sanity check, perhaps we ought to look more closely at the actual data:

jenome.core> (->>
                human
                genome-sequence
                (map name)
                (take 100)
                (apply str))

;=> "TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
;    TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"

That doesn’t look good at all. How are the first 10000 base pairs distributed?

jenome.core> (->>
                human
                genome-sequence
                (take 10000)
                frequencies)
;=> {:T 10000}

How about the next 10,0000?

jenome.core> (->>
                human
                genome-sequence
                (drop 10000)
                (take 10000)
                frequencies)
;=> {:T 2012, :A 2065, :C 3028, :G 2895}

That looks a lot better. Playing around with this shows that exactly the first 10,000 base pairs are Ts.

The astute reader will recall that the file index in our decoder had slots for unknown (“N-block”) sequences. Though we didn’t explore them explicitly, /S. Cerviciae/’s genome had nothing in these slots. It’s time we went back and looked at our human’s file index:

  (->> human
       sequence-headers
       (map (juxt :name :dna-size :n-block-count))
       clojure.pprint/pprint)
;; =>
(["chr1" 249250621 39]
 ["chr2" 243199373 24]
 ["chr3" 198022430 9]
 ["chr4" 191154276 12]
 ["chr5" 180915260 7]
 ["chr6" 171115067 11]
 ["chr7" 159138663 17]
 ["chrX" 155270560 23]
 ["chr8" 146364022 9]
 ;; LOTS more entries...
)

Holy cow, they all have N-blocks. This is only the first section; this Gist shows the entire set of N-blocks for all the sequences. (It also shows that there are many more files in the index than the yeast genome had, and many more than one for each of the 24 human chromosomes – clearly there are many things to learn about this data.)

Moreover, if we look at the N-blocks for the first sequence:

  (->> human
       sequence-headers
       first
       ((juxt :n-block-starts :n-block-sizes))
       (apply interleave)
       (partition 2)
       (map vec)
       clojure.pprint/pprint)

;; Gives:

([0 10000]
 [177417 50000]
 [267719 50000]
 [471368 50000]
 ;; ... total of 39 entries.
)

As expected, our first 10,000 base pairs are actually unknown. The 2-bit file format apparently uses 0’s for the unknowns AND to represent Ts. The rest of the offsets and lengths are in this Gist. (Perhaps someone can explain to me why these are all multiples of 10000!)

All this means that our decoder needs a tweak to give us :N instead of :T when the position of the base pair is inside one of the N-blocks. This we will accomplish in the next post, before we proceed to the study of other properties of the genome.

Before we end, it’s worth noting that, had we been real biologists, we would surely have known about Chargaff’s Rule, which states that A and T ratios should be the same, as are G and C, as born out in our yeast distribution, above.

Though we haven’t gained mastery over too much of the genome yet, it is worth pointing out Clojure’s strengths in the above and previous posts. With comparatively little code we are able to investigate many of the features of these data sets, thanks to the power of the threading macro ->>, higher-order functions such as juxt and map, and sequence handling functions such as interleave, partition, and frequencies. We’ve also processed large data sets “lazily” without needing to fit large amounts of data in memory at once. And we have hardly scratched the surface of Clojure’s tools for parallel computation, though we may make more use of these in coming posts.

Crock Pots are Foolproof, Right?

Josh Thompson — Wed, 10 Jul 2013 03:00:00 GMT

A while back I got together with my good friend Dustin. I had an evening free, wanted to cook, AND hang out with good friends. I wanted to try a really good looking recipe, and watch Django Unchained.

The cooking instructions for the recipe was “cook on low for 7-9 hours”. I did some mental math. If I turn it on as I’m walking out the door to work, at 8:15, and get back by 5:30, that could work. I’ll have to run some errands on my way home, but if I had 10% to the cook time, it can’t be terrible, right?” more

Well… it turns out I was gone more like 10.5 hours, and my crock pot’s low temperature setting is a little higher than expected.

I got home about 40 minutes before Dustin was to arrive, and something didn’t smell quite right. I popped open the crock pot, and saw some very dry, very warm meat. It was 175 degrees. So much for not overdoing it.

We got take-out from Tara Thai. Zero harm, zero disappointment, and we had a great time.

The lesson

The biggest take away for me had nothing to do with cooking. (I already knew that cooking a piece of meat for almost 11 hours is usually a bad idea.)

I could have freaked out when I got home and immediately learned that my dinner plans were ruined. I would have been stressed, and probably a little angry. I wasn’t. This was a learning experience, and I love Thai food, so I learned, and we ate Thai.

My learned lesson was this: A good backup plan allows for one to try hard, and even fail, with very few repercussions. There was nothing to freak out about, because dinner was not ruined. It was simply modified. We went from pot roast to cashew chicken with a phone call.

A few days later I tried the roast again. After it was rescued from the crock pot at an appropriate time, it was delicious.

Failure can be made safe, and therefore stripped of all those annoying negative associations.

Make Domain Users Part of Local Admin Group in OS X

Justin Garrison's Homepage — Wed, 10 Jul 2013 03:00:00 GMT

I came across this and thought it may be helpful for someone. OS X only uses the traditional

Framing the Entry Level iPhone

Zac Szewczyk — Tue, 09 Jul 2013 23:59:19 GMT

“Part of me think that an entry level iPhone will be very much like an iPod touch with an antenna, with hardware that’s capable enough to run all of iOS 7’s features, is better than the any last generation iPhone, but won’t compare to what’s inside Apple’s flagship offering.”

Permalink.

Effecting Change From The Outside

Zac Szewczyk — Tue, 09 Jul 2013 23:13:22 GMT

Marco Arment, writing in response to a Hacker News commenter questioning the effectiveness of Apple punditry changing minds within the corporation:

“I’ve heard a number of times in the last few years that something I wrote was circulated within Apple or brought up in an internal discussion, usually to support one side of a debate. And it’s very unlikely that Marco.org is the only site that Apple employees read.”

That’s pretty awesome.

Permalink.

Glass Teepee

Zac Szewczyk — Tue, 09 Jul 2013 23:12:32 GMT

It’s been a while since I linked to post on Cabin Porn, but this beautiful cabin was just too good to pass up.

Permalink.

Relegated to a Lookalike

Zac Szewczyk — Tue, 09 Jul 2013 22:47:38 GMT

“Copying iOS 7 is going to be a big problem for cheap hardware. iOS 7’s appearance and dynamics require a powerful GPU and advanced, finely tuned, fully hardware-accelerated graphics and animation APIs. This will hurt web imitators most, but it’s also going to be problematic for Android: while high-end Android phones have mostly caught up in GPU performance, and recent Android versions have improved UI acceleration, most Android devices sold are neither high-end nor up-to-date.” - Marco Arment in iOS 7 As Defense. Craig Hockenberry made the same point in episode forty-six of John Gruber’s The Talk Show around minute 35:40.

Permalink.

The Halfway Phone

Zac Szewczyk — Tue, 09 Jul 2013 22:47:33 GMT

My second foray into the world of Apple speculation. In my first, which I titled Apple’s Wildcard, I spoke to the possibility of Tim Cook announcing an iPone 6 and budget iPhone this fall: while I consider neither particularly likely, leaning more towards an iPhone 5S as the continuation of Apple’s apparent tick-tock cycle and disappointment for those waiting on a budget iPhone, I hedged my bets with Tim Cook’s “Can’t innovate, my ass” comment. Since writing that piece though the budget iPhone has remained a surprisingly popular topic, and thus something I feel I should readdress.

Permalink.

We're more than halfway through the #1GAM year! What I've made so far.

Liza Shulyayeva — Tue, 09 Jul 2013 15:42:09 GMT

I looked at my One Game a Month profile just now and realized that we are halfway through the year. That’s six games made so far! I’ve tried to pick projects that will help me learn something new each month. I figured I’d do a quick recap of what I’ve done so far:

a puppet-ipa user type and a new difference engine

The Technical Blog of James on purpleidea.com — Tue, 09 Jul 2013 09:41:54 GMT

A simple hack to add a user type to my puppet-ipa module turned out to cause quite a stir. I’ve just pushed these changes out for your testing:

3 files changed, 1401 insertions(+), 215 deletions(-)

You should now have a highly capable user type, along with some quick examples.

I’ve also done a rewrite of the difference engine, so that it is cleaner and more robust. It now uses function decorators and individual function comparators to help wrangle the data into easily comparable forms. This should make adding future types easier, and less error prone. If you’re not comfortable with ruby, that’s okay, because it’s written in python!

Aswin Natarajan: Techstars Associate

Sam Solomon — Tue, 09 Jul 2013 03:00:00 GMT

Aswin Natarajan is an associate at TechStars, one of the worlds leading startup accelerators He is also the cofounder of Startup Exchange…

Using htop to monitor system processes on the Raspberry Pi

Tafkas Blog — Tue, 09 Jul 2013 03:00:00 GMT

If you work a lot on the command line you are probably familiar with the top utility to see what process is taking the most CPU or memory. There’s a similar utility called htop, which is an advanced, interactive system-monitor utility that can be used as a replacement tool for the default process monitoring command ‘top’ on a Linux ecosystem. This interactive process viewer provides a real-time, dynamic view of what’s happening on your Raspberry Pi system.

If I Were a Recycling Manager, What a Difference I Would Make

The David Brownman Blog — Tue, 09 Jul 2013 03:00:00 GMT

undefined

Read the whole thing.

First five meals from The 4-Hour Chef

Josh Thompson — Mon, 08 Jul 2013 03:00:00 GMT

I don’t know how to cook. Period. My most impressive culinary creations were, until recently, spaghetti and beans-n-rice. I got married about a year ago, and had hoped that I would become inspired to become a world-class chef. After a long time eating Rice-A-Roni, spaghetti, sloppy joes, burgers, and anything that can be prepared in a crock pot, I was looking for a change, and this has been a priority for a while.more

Enter Tim Ferriss’s The 4-Hour Chef. Among many other things in the book, he has a prescribed set of recipes to follow. In each recipe, he builds on skills, tools, and ingredients used in the prior recipe. His aim with each meal is maximum impact in taste and appearance, but minimum effort and cleanup. This resonates with me, because he speaks in terms of Return on Investment (in terms of money, time, and effort.)

Most importantly, once you have the book, you don’t need any other resources. You’ll need some basic tools, but he spells out all the processes the first time he introduces them.

I will record my trip through his book, and identify any hiccups along the way. I hope, in addition to cataloging my own successes and failures, I can inspire one or two of

you to give this a shot.

Lesson One: Osso Buko

The first lesson is braised lamb. What is a braised anything?

Braisingis a combination cooking method using both moist and dry heat; typically the food is first seared at a high temperature and then finished in a covered pot with a variable amount of liquid, resulting in a particular flavor.

For this lesson, we (Tim and I, of course.) skipped the searing. It’s easier this way, and still comes out great.

There are two critical ingredients to Osso Buko. First, the meat. I was supposed to have lamb shanks. Where the heck do you get lamb shanks? I went to a local Giant and poked around their meat department for a while, and could find nothing that looked like what Tim had in his book.

Since I was cooking for three later that evening, I just grabbed meat that said “lamb” on it, and also had visible bone. Turns out I had gotten lamb chops. Oh well.

I had my meat. What was the other critical ingredient? Not an ingredient, per se, but a tool. I had to use a cast-iron dutch oven. I’ve never owned anything cast iron, and there was no cast iron cook wear in my house growing up. My uncle introduced me to it when I lived in his basement after I finished college; he is an excellent cook, and he swears by the stuff. Since he is a trustworthy source, I did not protest much to the idea of getting a cast iron dutch oven. Especially since this dutch oven by Lodge is both a pot and a skillet.

Now that I had my meat and my pot, I put everything in the pot (carrots, lamb, canned whole tomatoes, a little garlic, extra-virgin olive oil, and some white wine) and I stuck it in the oven for two hours. It came out delicious, and tender. Everything was edible, including the carrots and the tomatoes.

Lessons learned: While meals may be simple, it can be a real pain finding the correct ingredients. The chops I got were not at all what I was looking for, but it was the only lamb I could find. If you know where to get good lamb shanks, let me know.

I eventually ended up getting turkey thighs instead of lamb shanks, just so I could have a better idea of how it is supposed to go. It worked out, but I’m not a huge turkey fan, so… I’m going to keep looking for lamb shanks.

Lesson One and a Half: Chuck Roast

The very next page, after the Ossu Buko, was a variation of braising using just a chuck roast, and three different cans of broth. Put everything together in the pot, and bake for 2.5 hours. Seriously. That easy. It was delicious. And there was lots of left overs.

Lesson Two: Scrambled Eggs

I’ve been eating three eggs and bacon for breakfast every day for at least two years. Repetitive, yes, but healthy (in some circles. Unhealthy in others. Guess which camp I am in?) and easy. I don’t scramble them, I just put ‘em sunny side up and mop the yolks with the bacon.

It was easy to transfer to scrambled eggs. Tim outlines three different ways to make scrambled eggs, and they all three have to do with the ratio of egg whites to egg yolks. He recommends a 2:1 ratio of yolks to whites. This would leave me with a ton of whites, so I’ve been using a 1:1. (In his defense, he has a paragraph labeled “What the hell do I do with these extra egg whites?” The answer is either flip the ratio next time around, make crab cakes, or hair conditioner. Yes, hair conditioner…)

I’m stuck in the rut of sunny-side up eggs and bacon, though, so after a few days of playing around with scrambled eggs, I settled back into my old habits.

Tim lists around the world in 44 flavor combinations as suggestions to get a feel for different cuisines With just a few basic spices, you can get from Mexico to India to the Middle East to Greece to Hungary and more.

I experimented with scrambled eggs for a few days, but I just love my sunny-side-up eggs cooked in a little bacon grease. It’s quick and easy, and oh-so-filling.

(My last trip to Giant, they had eggs for the cheap. I bought four-and-a-half DOZEN eggs. It lasted about three weeks. Mm, protein.)

Lesson Three: Coconut Cauliflower Curry Mash

This was my first total failure. I screwed up the ingredient ratios, and found out I didn’t have curry (I thought I did) so I unintentionally steamed a bunch of cauliflower that was too hard to mash, yet still soft enough to eat plain; I had cauliflower leftovers for a few days. The upside is cauliflower steamed with coconut milk is delicious, even if it can’t be mashed up like mashed potatoes. For “total failure”, it was no big loss.

Lesson Four: Union Square Zucchini

This stuff was delicious!

My biggest challenge for this lesson was finding zucchini! The two local Giants that I visited didn’t have ‘em. Once I found out that zucchini is basically a squash, I had better luck finding it. (Cucumbers, on the other hand, are not interchangeable!) I also did not have the Ghee (clarified butter) or chilli pepper. I used red pepper flakes, instead, and some regular butter.

I peeled the outside of the zucchini before slicing it into thin strips- turns out I didn’t have to do it. Skipping that step will save time, and the peeler I was using wasn’t working so well; I got a better peeler. Between not peeling the outside, and having a good peeler, the prep took about 1/3 as long.

Lessons learned: Zucchini are also called squash. After scouring the world looking for some stinking zucchini, I realized I had found it. Several times. And never even knew it. Again, shopping has proven to be the biggest frustration. The good news is, one can get better at shopping for food. Everything else is easy. This was seriously delicious.

Lesson Five: Bittman Chinese Chicken with Bok Choy

I could not find the necessary baby bok choy, so this was actually just Chinese chicken. I had never steamed meat before, but it’s pretty easy. I started with boneless skinless chicken breasts, cut them in half the long way, and lay them on top of a wire rack above steaming water. Put a lid on top, and pull them off fifteen minutes later.

This is easy, in theory, except I didn’t have a wire rack (I commandeered the wire rack from my toaster oven), and I didn’t know when to start the fifteen minute timer. I decided that the water should be boiling before you put the chicken on top of the wire rack, and that is when you start the fifteen minutes.

Take two:

I was able to get the Bok Choy, and made the sauce more than 20 minutes in advance. It still tasted very good, and it presents very well. (If you want to look like a kick-butt chef, talk about “presenting”. It distracts the guests from the taste of the food, and focuses the attention on the look of the food. This can be a good thing.)

Lessons I learned

This post represents many, many hours of work. Between reading and trying to figure out what I needed to do and buy, to actually trying to buy the stuff, to cooking and cleaning, a lot of work happened here. But it was worth it. I’m learning my way around a kitchen.

Since eating is a pretty regular part of my life, it is worth it to me to get good at it.

Even when everything seems perfectly clear, there is still plenty of room for questions. Most questions related to ingredient substitution; I don’t have curry powder, so I’ll try red pepper flakes. No ghee? I’ll go without.

I questioned plenty of the cooking processes. Fifteen minutes of cooking over boiling water. Should the water be boiling when I put the meat on, or do I count heating the water as part of the fifteen minutes? (Thank you, probe thermometers…)

I had issues finding all the food that I needed for the meals. I never shopped for more than one meal at a time, even though this meant lots of trips to the store. At the time, I had plenty of time to go to Giant, so my struggle with batching grocery runs was not overly problematic.

Fear of failure can be overpowering. I didn’t want to mess these up. It helped that my wife, Kristi, would often make a side, like mashed potatoes or microwaved corn. That took some of the pressure of failure off me. All the fear of failure was entirely self-generated. And Tara Thai is right down the street. And they deliver. If it all does totally hit the fan, just order some take out. Consider it an inexpensive and very local cooking class, and you learned something that does not work. Failure is not so bad.

Shopping is an important part of cooking. I never expected shopping to be so hard. I now realize that I must mentally equip myself to go into the store and come out with what I need. There are thousands of choices, and it’s painful walking the entire store looking for one stupid item that you know they have.

Hand and Sew Video

june.kim — Mon, 08 Jul 2013 03:00:00 GMT

Arrays.asList() gives a list with wrong size

Craig Pardey — Mon, 08 Jul 2013 03:00:00 GMT

Try this out for fun.

int[] i = new int[]{1, 2, 3};  
System.out.println(Arrays.asList(i).size());

Integer[] ii = new Integer[]{1, 2, 3};  
System.out.println(Arrays.asList(ii).size());

Output:
1
3

What the hell, Java? This is totally unexpected behaviour!

In this case Java is being a bit pedantic. See, Collections can contain only contain Objects, and an int is not an Object but int[] is an Object, so that’s why you get a list with only 1 element.

Validating the Genome Decoder

John Jacobsen — Sun, 07 Jul 2013 03:00:00 GMT

Today we’ll validate the genome decoder we described yesterday, once again with our friend the yeast Saccharomyces cerevisiae (you may want to enjoy a slice of freshly-baked bread and a stein of Pilsner with this post).

We are aided in this case by the availability of the SacCer3 genome in both 2bit and FASTA formats. We can get the FASTA version in the same place we got the 2bit file:

mkdir /tmp/sacCer3_fasta
cd /tmp/sacCer3_fasta
wget http://hgdownload-test.cse.ucsc.edu/goldenPath/sacCer3/bigZips/\
chromFa.tar.gz
tar xvzf chromFa.tar.gz

There is one FASTA file per sequence, starting something like this:

>chrI
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC
CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG
GCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTAC
CCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTT
ACTACCACTCACCCACCGTTACCCTCCAATTACCCATATCCAACCCACTG
CCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATAC

Back in the REPL, we can now spit out our own copy in the same format (carrying over yeast and other functions and vars from the previous post).

First we need a new directory for the FASTA files we’ll generate:

(.mkdir (clojure.java.io/file "/tmp/decoded"))

Then we convert the keywords in our sequence to strings:

(defn genome-str
  "
  Convert e.g. [:A :G :T :C] to \"AGTC\"
  "
  [s]
  (->> s
       (map name)
       (apply str)))

A simple function will spit out the files, given a seq:

(defn write-seq
  "
  Write a (potentially very long) sequence of lines to a text file
  "
  [filename s]
  (with-open [wrt (clojure.java.io/writer filename)]
    (doseq [x s]
      (.write wrt (str x "\n")))))

And now for the actual converter:

(doseq [{:keys [name dna-offset dna-size]} (sequence-headers yeast)]
  (let [fname (str "/tmp/decoded/" name ".fa")]
    (write-seq fname
               (cons (str ">" name)
                     (->> (genome-sequence yeast dna-offset dna-size)
                          (partition-all 50)
                          (map genome-str))))))

Did it work?

cd /tmp/sacCer3_fasta
for f in *.fa; do diff $f /tmp/decoded/$f; done

No output – it succeeded! This builds more confidence that we didn’t screw anything up in the decoder. (There are also a few other hard-coded unit tests in test_core.clj.)

Comparing file sizes, the FASTA files are about 4 times larger than the original 2bit file. If you tar and compress both versions, the FASTA files are still about 30% larger. It is left as as an exercise to the reader (with some spare hard disk) to do the same comparison with the human genome. (Though larger, the FASTA files would clearly be simpler to work with, and these days 4 GB isn’t too terribly much data; nevertheless, we’ll continue to use the 2bit file and decoder for our explorations.)

Now we are ready to begin playing with the actual data – starting in the next post.

Be vanilla

Steph Ango — Sun, 07 Jul 2013 03:00:00 GMT

The term “vanilla” is often used to describe something ordinary, plain, or standard. In my book, there’s nothing less vanilla than vanilla.

Vanilla beans are the fruit of a rare orchid native to Mexico. Their aroma and flavor comes from a compound called vanillin. Each vanilla flower blooms just one morning out of every year. The orchid can only be naturally pollinated by a small Mexican bee, and if it isn’t pollinated that morning, the flower will wilt. No bean.

Commercially, vanilla is delicately hand-pollinated one flower at a time. The labor involved in vanilla production makes it the second most expensive spice in the world after saffron.

Vanilla flavor has been prized for thousands of years, and can be found in every ice cream shop on Earth. It’s the best-selling flavor in the world.

Vanilla’s universal appeal is why it’s the default. Is your default as good as vanilla?

Apple's Wildcard

Zac Szewczyk — Sat, 06 Jul 2013 17:08:34 GMT

For the most part I try to stay away from Apple speculation: quite simply, I neither know enough about the company’s past and present situation nor do I pay close enough attention to pick up on the subtleties of this practice. Then I read an interesting article speculating about Apple’s Fall hardware announcements, and I decided to give it a try.

Permalink.

A Two Bit Decoder

John Jacobsen — Sat, 06 Jul 2013 03:00:00 GMT

The entire human genome is available as a single .2bit file here (click on “Full Data Set”, then download hg19.2bit). Unlike the stellar signal in His Master’s Voice, the 2bit format is reasonably clearly documented.

We want to write Clojure code to:

Provide base pairs in symbolic (rather than raw binary) form as lazy sequences – i.e., sequences which need not all fit in memory at once, but can be consumed and processed as needed;
Provide “random access” to this data selectively, e.g. by chromosome, rather than always reading through the entire file;
Provide access to metadata encoded in the file.

The functionality to do this is posted in the jenome project on GitHub. In this post, we’ll explore this code a little; in following posts, we’ll do some investigating of the actual genome per se.

Capability (2) is provided, in part, by implementing random-access reads from file fname of len bytes starting at offset:

(ns jenome.rafile
  (:import (java.io RandomAccessFile)))

(defn read-with-offset [fname offset len]
  (let [raf (RandomAccessFile. fname "r")
        bb (byte-array len)]
    (.seek raf offset)
    (.readFully raf bb)
    (.close raf)
    bb))

Armed with this, we can get the .2bit file header:

(defn file-header [fname]
  (let [[sig ver seqcnt resvd] (->> (read-with-offset fname 0 16)
                                    (partition 4)
                                    (map bytes-to-number))]
    (assert (= sig 0x1A412743))
    (assert (= ver 0))
    (assert (= resvd 0))
    seqcnt))

file-header basically just gives us the number of sequences (usually, chromosomes) in the file, doing some sanity checks along the way. bytes-to-number converts an arbitrary sequence of bytes to the appropriate unsigned integer. (For brevity’s sake, I won’t show every utility function in this blog post; the source code on GitHub is reasonably short.)

The next part of the file, as shown in Figure 1, is called the “file index,” and contains a list of sequences contained the rest of the file. It can be read as follows:

(defn file-index [fname seqcnt]
  (loop [i 0
         ofs 16
         ret []]
    (if (< i seqcnt)
      (let [[nlen] (read-with-offset fname ofs 1)
            name (apply str (map char (read-with-offset fname 
                                                        (+ ofs 1) nlen)))
            seq-offset (get32 fname (+ ofs 1 nlen))]
        (recur (inc i) (+ ofs nlen 5) (conj ret [nlen name seq-offset])))
      ret)))

This somewhat imperative code walks through the seqcnt sequence portions of the index, pulling out sequence names and lengths as we go.

It’s here that we introduce a new friend, the yeast Saccharomyces cerevisiae (SacCer3), used since antiquity for making bread and fermented beverages. Relatively small in comparison with the human genome, SacCer3 will be our “unit test” organism. Available online and checked into the resources folder in this repo, the file can be accessed as

(def yeast
   (as-file (resource "sacCer3.2bit")))

(I have imported resource and as-file from clojure.java.io; again, see the source code.)

Our index-reading code yields:

  (let [seqcnt (file-header yeast)]
    (file-index yeast seqcnt))
  ;=>
[[4 "chrI" 191]
 [5 "chrII" 57762]
 [6 "chrIII" 261074]
 [5 "chrIV" 340245]
 [5 "chrIX" 723245]
 [4 "chrV" 833233]
 [5 "chrVI" 977468]
 [6 "chrVII" 1045025]
 [7 "chrVIII" 1317776]
 [4 "chrX" 1458453]
 [5 "chrXI" 1644907]
 [6 "chrXII" 1811627]
 [7 "chrXIII" 2081188]
 [6 "chrXIV" 2312312]
 [5 "chrXV" 2508412]
 [6 "chrXVI" 2781251]
 [4 "chrM" 3018284]]

The apparent consistency of these values give us some initial confidence that we are reading the index correctly. Note, however, the curious fact that chrIX appears between IV and V.

With this encouraging start, we can now attack the sequences proper. These are laid out as shown in Figure 2, with block metadata prepended to the actual DNA sequences:

Sequence Record Layout

The “N blocks” are blocks of unknown sequences with specified offsets and lengths. Masked blocks are blocks which are known repetitions (indicated as lower case a, g, c and t in the text-based ‘FASTA’ file format). We are obviously most interested in dnaSize, the number of base pairs in the sequence, and the actual sequence values themselves.

Unpacking the above data format (except the base pairs per se) makes heavy use of get32, which just returns the unsigned 32-bit integer at the specified file location. This code doesn’t need to be super efficient, since the block headers themselves are quite small. The metadata for the entire file is returned as a sequence of maps.

(defn getblk [fname offset n]
  (let [ret (map #(get32 fname (+ offset (* 4 %))) (range n))
        offset (skip offset n)]
    [ret offset]))


(defn sequence-headers
  "
  Get sequence headers from .2bit file, as documented in
  http://genome.ucsc.edu/FAQ/FAQformat#format7. Returns a list of maps
  with details for each sequence.
  "
  [fname]
  (let [seqcnt (file-header fname)]
    (for [[nlen name ofs] (file-index fname seqcnt)]
      (let [[[dna-size]         ofs] (getblk fname ofs 1)
            [[n-block-count]    ofs] (getblk fname ofs 1)
            [n-block-starts     ofs] (getblk fname ofs n-block-count)
            [n-block-sizes      ofs] (getblk fname ofs n-block-count)
            [[mask-block-count] ofs] (getblk fname ofs 1)
            [mask-block-starts  ofs] (getblk fname ofs mask-block-count)
            [mask-block-sizes   ofs] (getblk fname ofs mask-block-count)
            [[reserved]         ofs] (getblk fname ofs 1)]
        (assert (zero? reserved))
        {:name name
         :nlen nlen
         :dna-size dna-size
         :n-block-count n-block-count
         :n-block-starts n-block-starts
         :n-block-sizes n-block-sizes
         :mask-block-starts mask-block-starts
         :mask-block-sizes mask-block-sizes
         :dna-offset ofs}))))

A few sanity checks are included in test_core.clj to make sure we’re decoding the metadata correctly. Requirement (3) is done!

The final step (Requirement (1)), is to actually get our base pairs (BPs). Since we have to assume the data set is very large (as is the case with the human genome), we cannot read the entire DNA sequence at once. The first part is to break the dna-size base pairs (remember we have 2 bits per BP, or 4 BP/byte), starting at dna-offset. First we obtain the “coordinates” of the sequences we want to read:

(defn get-buffer-starts-and-lengths 
  "
  Return buffer offsets (starting at ofs) required to cleanly read a
  total of m bytes no more than n at a time
  "
  [ofs n m]
  (loop [a ofs
         len n
         ret []]
    (if (>= a (+ m ofs))
      ret
      (recur (+ a n)
             n
             (conj ret [a (min len (- (+ m ofs) a))])))))

;; Example:
(get-buffer-starts-and-lengths 100 200 512)
;=> [[100 200] [300 200] [500 112]]

At long last, having obtained the locations and lengths we want to read from, we can get our sequences out:

(defn genome-sequence
  "
  Read a specific sequence, or all sequences in a file concatenated
  together; return it as a lazy seq.
  "
  ([fname]
     (let [sh (sequence-headers fname)]
       (mapcat #(genome-sequence fname %1 %2)
               (map :dna-offset sh)
               (map :dna-size sh))))
  ([fname ofs dna-len]
     (take dna-len
           (apply concat
                  (let [byte-len (rounding-up-divide dna-len 4)
                        starts-and-lengths (get-buffer-starts-and-lengths
                                              ofs 10000 byte-len)]
                    (for [[offset length] starts-and-lengths
                          :let [buf (read-with-offset fname offset length)]
                          b buf]
                      (byte-to-base-pairs b)))))))

;; Example:
 (->> yeast
      genome-sequence
      (take 30))
;=> (:C :C :A :C :A :C :C :A :C :A :C :C :C :A :C
;    :A :C :A :C :C :C :A :C :A :C :A :C :C :A :C)

This function allows us to choose the entire genome, or that for a given offset and number of base pairs (whether from the metadata for an entire chromosome, or some smaller region, thus satisfying (2)).

The next post will focus on verification of correctness of this code; subsequent posts will begin to explore the characteristics of this data for various genomes, human or otherwise.

How I compress PNG files on this website

duncanlock.net — Sat, 06 Jul 2013 02:02:45 GMT

Compressing Limited Colour PNG images

Most of the .PNG files on this site are the ‘blueprint’ style diagrams, like this one:

Figure 1. This illustration is a large 5.6MB SVG file, mostly because of the very detailed paisley pattern that I used. Exported to PNG - and then compressed using the process below, you can get this down to 118.5kB.

I create these in Inkscape as vector .SVG files & export them to bitmap .PNG files. I then re-compress them, to ensure that the image files that are used on the live website are as small & quick to load as possible.

As these diagrams have a fairly limited colour palette, I can get lots of extra compression by reducing the colour depth of the final .PNG files from the default 32bit (millions of colours) to 8bit (256 colours) - without any loss of visual quality.

This is a two-step process - which can be combined into a single pipeline. The first step is pngnq which quantizes the image, reducing its colour depth. The second step uses advpng to losslessly re-compress this image data to get the smallest possible filesize.

To install these two utilities on ubuntu/debian Linux, run this in a console:

$ sudo apt-get install advancecomp pngnq

The basic idea is to do the following to the file, running it through both utilities, one after the other:

$ pngnq -s1 image.png
$ advpng -z -4 image.png

We can do that in one go by joining the commands together, like this:

$ pngnq -s1 image.png && advpng -z -4 -q image-nq8.png

By default, pngnq adds -nq8 onto the end of the filename. You can change that with the -e parameter, but it doesn’t seem to support not changing the name - i.e. overwriting to original. As an added complication advpng doesn’t support processing from stdin to stdout, so we have to pass it a filename.

If we want to process a whole folder full of files, we can do this in parallel, getting all our machines cores in on the action, using find and xargs. This example uses 4 processes to do 4 files at once:

$ find . -iname "*png" -print0 | xargs -r0 --max-procs=4 -n1 sh -c 'pngnq -s1 "$1" && advpng -z -4 -q "${1%.*}"-nq8.png' -

You can adjust the --max-procs=4 bit to match the number of cores you have - or maybe one less, if you want to process a lot of images and do other things in the meantime.

Results

Using the microscope image at the start of this post as an example, these are the results that we get at each step:

Process Step	Result
1: Original SVG File	5.6 MB
2: Initial PNG Export	409.3 kB
3: Quantized with pngnq	123.6 kB
4: Compressed with advpng	118.5 kB

Process Step

Result

1: Original SVG File

5.6 MB

2: Initial PNG Export

409.3 kB

3: Quantized with pngnq

123.6 kB

4: Compressed with advpng

118.5 kB

This example is a huge SVG file by my standards - the paisley vector clipart I used is very detailed and ~3MB on its own; my normal SVG files are generally under 1024 kB. If we use a more typical SVG file, like the one from my Reddit Bots article (which is 835.2 kB), we still get excellent compression, down to 78.5 kB – just 9% of the original size and less than ⅓ of the initial PNG export size:

Re-compressing all the blueprint style diagrams on this site - which I had previously already re-compressed using PNGOUT - reduced their total file size from 845.9 Kb to 385.2 Kb - a whopping ~55% reduction. Just goes to show that you need to test and adapt techniques to your particular situation - rather than just applying them blindly.

General PNG Compression

You don’t always want to reduce the colour palette - not all images are suitable for this. In that case, you can reduce the process to only one step. You can do this, to process a folder full of PNG files, four at once:

$ find . -iname "*png" -print0 | xargs -0 --max-procs=4 -n 1 advpng -z -4 -q

This just runs each file through advpng to maximally compress the existing image data, losslessly, without changing the colour depth or quality at all.

To make this easier, I created some Thunar Custom Actions that give you the option to do either of these things when you right-click on a PNG file.

Thoughts and Tips from the 2013 Open Data Week

Welcome to Marco Fioretti's website! on Stop at Zona-M — Fri, 05 Jul 2013 16:06:34 GMT

I participated to the 2013 Open Data Week in Marseille to lead a workshop on an idea I had a couple years ago, one that seems to be more and more ready to seriously take off every month:

Exploratory Genomics with Clojure

John Jacobsen — Fri, 05 Jul 2013 03:00:00 GMT

In Stanislaw Lem’s His Master’s Voice, humanity receives a “letter from the stars,” in the form of regularly repeating binary data encoded in a beam of extraterrestrial neutrinos. The protagonists know nothing a priori about the content of the letter. The plot unfolds as the message slowly, as a result of careful study, yields a few (not many) of the signal’s secrets.

What would you do if you received such a dataset? How would you study it? What real world datasets are similarly mysterious?

As most readers will know, every living being contains a “message” of sorts, encoded, not in base 2 (binary), but rather base 4: A, G, C, or T, arranged in paired, sequential molecular strands called DNA (in which every A is paired with a T, every C with a G). From 159,662 base pairs for the smallest known genome, to 3.3 billion BPs for humans, to 149 billion BPs for the largest genome, that of Paris japonica, each organism carries its own unique tome locked in its cells.

In the past ten years, the human genome has been sequenced and made widely available. Though downloadable in a variety of formats, the most compact seems to be the ‘2bit’ format (two bits per base pair): the genome in this format is just under a gigabyte, uncompressed. Plenty of genomes of simpler organisms are available for study as well.

I am not a genomicist or biologist, but am curious about the properties of the “data” stored within us all. In the next few blog posts I intend to investigate genomic data (human or otherwise) using Clojure, a modern Lisp developed for the JVM. Clojure’s strengths are simplicity, concurrency, expressiveness and speed – assets which will be helpful as we tackle a few simple analytical tasks aimed at understanding some of the properties of life’s very own “Big Data.”

How to set JMSXUserID in Websphere MQ using Spring JMS

Craig Pardey — Fri, 05 Jul 2013 03:00:00 GMT

Every time I work with MQ and Spring JMS I want to poke my eyes out with a dull instrument. It’s always a pain in the neck. My most recent challenge was trying to get the JMSXUserID field to flow through to the application on the other side of MQ.

First, I created a MessagePostProcessor to add the JMS header

public class MyMessagePostProcessor implements MessagePostProcessor  
{  
	private String userId;

	@Override  
	public Message postProcessMessage(Message msg) throws JMSException  
	{  
		msg.setStringProperty(JmsConstants.JMS_IBM_MQMD_USERIDENTIFIER, userId);  
		msg.setStringProperty("JMSXUserID", userId);  
		return msg;  
	}  
}

But when I checked the queue with HermesJMS I could see that the JMSXUserID had been overwritten somewhere, so I fired up WireShark and watched for the message and confirmed that the message that was going over the wire already had the JMSXUserID field overwritten. This was a good thing - the issue was in the IBM MQ JMS client code.

qc: quick calculator

Thought Eddies — Fri, 05 Jul 2013 03:00:00 GMT

qc: quick calculator

Language

arnorhs blog - arnorhs.dev — Fri, 05 Jul 2013 03:00:00 GMT

I got into an ironic conversation the other day over the usefulness of having multiple languages in the world. I am of the opinion that languages are redundant and they only exist for being the most usable mechanism we have invented for communication so far.

What Happened to Instapaper?

Zac Szewczyk — Thu, 04 Jul 2013 18:45:51 GMT

I ask this question every time I open the app: What happened to Instapaper? After its sale both Marco and Betaworks seemed so enthusiastic about the popular read later service’s future. Since then two months have gone by without a peep from anyone — not even a point release.

Permalink.

Snapchat: Not Just for Sexting

Zac Szewczyk — Thu, 04 Jul 2013 12:43:35 GMT

I hate the word “sexting” — I really do. It sounds as if a sixth-grader invented it in jest and whose parents, upon overhearing it, decided to apply it as the label for the act of sending lewd pictures on a mobile device. Or maybe the fated decision was left to a lonely man in the poorly-lit corner cubicle, laboring under a flickering fluorescent light: “Texting and sex... ‘Tex’? No, that’s not it. ‘Sex texting’? Too long. Ha, that’s what she said... ‘Stex’? Still no; drat.” Regardless of whoever picked the term though, it stuck, and it stuck to Snapchat.

Permalink.

Simplify, simplify, simplify

Josh Thompson — Thu, 04 Jul 2013 03:00:00 GMT

Kristi and I stumbled upon the realization that we’ve become minimalists. And it is exciting.

We live in a one-bedroom apartment. It is spacious, for a one-bedroom, but compared to anything larger than a one-bedroom apartment, it is small. We managed to pack it full of stuff in no time. more

Then, an unexpected blessing came about. Our neighbors don’t clean their apartment, or put much food away, so they had problems with bugs. We share a wall with them, so we got to share their problem with bugs. The landlord sprayed both of our apartments, and in preparing for that spraying, we had to pile almost all of our possessions in the middle of our living room.

We realized, quickly, that we had a lot of stuff. So we got rid of stuff that we obviously did not need. Then,once we started putting things away, we got rid of more stuff. Then, we stumbled across books and blogs that talk about having even less stuff, in order to free up mental and physical space.

I don’t like putting things away, but I also dislike the apartment being messy. An obvious solution is to have less things to have to keep orderly. If you don’t have things that can be messy, the apartment is less messy. So, for the last few months, we’ve been casually getting rid of things that we don’t use. Here’s a short list:

Cleats that I’ve not used in two years.
Climbing shoes that have holes in the toes.
Ditto with another pair.
An old harness that has a well loved belay loop, that I really shouldn’t use anymore.
Shirts that I don’t like, but don’t hate, so I wear ‘em only when I’m out of everything else.
Shorts that don’t fit right.
Pants that I’ve not worn in a year.
A blazer I bought for $2 at a thrift store and wore once.
Uncomfortable dress shoes.
Another pair of uncomfortable dress shoes.
My old laptop.
Belts that I don’t wear.
My second pair of pajama pants.
All non-skinny ties.
Cups we’ve not used in a year.
A cup-cake baking sheet we’ve never used.
Little nesting bowls we’ve never used.
A spare set of plates someone gave us, but we never use.
Tools that are made redundant by smaller and more compact tools.
Extra power cables.
Little trinkets of crap I never use.
Random pens we never use.

Climbing gear that is either old and heavy, or new(er) and dangerously worn.

Books. So many books. My book collection had become an altar to the intelligence of Josh. If you visit our apartment, you’ll look through our books. (At least I hope you will.) You’ll think “man. He’s smart, if he reads this stuff.” When I look at my books, I think of what a towering intellect I am, because of my books. In reality, I’m probably not going to read most of ‘em. The idea of reading them is way more fun than actually reading them.

I ditched the altar to myself, and cleared out two shelves worth of books. I ditched cook books, books about business, philosophy, economics. All of that. I’m a real person, I’m not going to read 600 pages about Immanuel Kant. Why kid myself?

Do you see the trend?

I got rid of all of them. We went from three crowded bookshelves to three sparse book shelves. We’re going to get rid of more.

I don’t want to be burdened down by things. Every item you own takes up space, both in your home, and in your brain. If you move, so to do your things. They are anchors.

I’ve slowly transitioned from thinking “I will keep this unless I can justify getting rid of it” to “I will get rid of this unless I can justify keeping it”.

This trend is dangerous. I’ve grown to enjoy very much the process of getting rid of things. I view items around the house in a new light. If I could talk with them, I would say “You, there. What do you do for me? Why should I give you space, regular cleaning, and attention? How is my life made better by you? Why are you better than empty space, or the alternative uses for the money and space you require?”

As I’ve de-cluttered, I have been able to check off a number of items from My Epic Quest of Awesome.

I’m another few levels along.

If you could get rid of three things, what would they be? What’s stopping you?

hstore vs. JSON - Which to use in Postgres

CRAIG KERSTIENS — Wed, 03 Jul 2013 23:55:56 GMT

If you’re deciding what to put in Postgres and what not to, consider that Postgres can be a perfectly good schema-less database. Of course as soon as people realized this then the common comes a question, is hstore or JSON better. Which do I use and in what cases. Well first, if you’re not familiar check out some previous material on them:

If you’re already up to date with both of them, but still wondering which to use lets dig in.

hstore

hstore is a key value store directly within your database. Its been a common favorite of mine and has been for some time. hstore gives you flexibility when working with your schema, as you don’t have to define models ahead of time. Though its two big limitations are that 1. it only deals with text and 2. its not a full document store meaning you can’t nest objects.

Though major benefits of hstore include the ability to index on it, robust support for various operators, and of course the obvious of flexibility with your data. Some of the basic operators available include:

Return the value from columnfoo for key bar:

foo->'bar'

Does the specified column foo contain a key bar:

foo?'bar'

Does the specified column foo contain a value of baz for key bar:

foo@>'bar->baz'

Perhaps one of the best parts of hstore is that you can index on it. In particular Postgres gin and gist indexes allow you to index all keys and values within an hstore. A talk by Christophe Pettus of PgExperts actually highlights some performance details of hstore with indexes. To give away the big punchline in several cases hstore with gin/gist beats mongodb in performance.

json

JSON in contrast to hstore is a full document datatype. In addition to nesting objects you have support for more than just text (read numbers). As you insert JSON into Postgres it will automatically ensure its valid JSON and error if its well not. JSON gets a lot better come Postgres 9.3 as well with some built in operators. Though if you need more functionality in it today you should look at PLV8.

Which to Use

So which do you actually want to use in your application? If you’re already using JSON and simply want to store it in your database then the JSON datatype is often the correct pick. However, if you’re just looking for flexibility with your data model then hstore is likely the path you want to take. hstore will give you much of the flexibility you want as well as a good ability to query your data in a performant manner. Of course much of this starts to change in Postgres 9.3.

Girl Scouts, other equal opportunity employers and... software discrimination

Welcome to Marco Fioretti's website! on Stop at Zona-M — Wed, 03 Jul 2013 18:06:14 GMT

Casual browsing (more on this below) just brought me to the website of the Girl Scouts of Southern Nevada (GSSN). As many other organizations of all kinds, in the USA and elsewhere, they are, as clearly stated in their official Application for Employment:

an equal opportunity employer. All applications for employment will be considered without regard to race, religion, color, sex, age, national origin, citizenship, disability or marital status.

My PowerShell Profile

Daniel Little Dev — Wed, 03 Jul 2013 04:00:00 GMT

This is my PowerShell profile, it does a few nice things such as add and commands to the shell. Most importantly though it customizes my…

June trip to the New River Gorge

Josh Thompson — Wed, 03 Jul 2013 03:00:00 GMT

The New River Gorge had beautiful weather this weekend. The forecast for the weekend was, until Friday, near-certain thunderstorms.

Typical of the New, the weather proved unpredictable, and we had glorious sun the entire trip.

I was eager to get out to the New, since my last attempt to get out there was delayed by rather catastrophic car failure. I’ve been out of my already very limited training regimen, so I did not know how I would stack up against the rock, and against the other guys I was climbing with.

It turns out I can still climb, but not nearly as hard as I had hoped. I was fortunate to be climbing with guys who are far stronger than me.

Brian sent Puppy Chow, 12c, and Christian repeated Lactic Acid Bath 12d, and almost onsighted Puppy Chow. Preston onsighted Yowza, 5.12a (for his warmup) and Sean sent a 12a that was way harder than the 12b right next to it. There were many other displays of excellent climbing, but in summary - it was a pretty strong group. I brought up the rear by making at least the first bolt of everything I tried.

It was an awesome trip, despite me not climbing that hard, for two reasons:

I’m motivated to keep training. Motivation is a valuable thing to have, and I’d lost it after almost three weeks of not training, and close to two months of no outdoor trips.
I’m motivated to train smarter. My endurance was terrible - this is not a surprise, given the one-dimensional nature of my training, but I’m not taking it as an excuse. I want to train endurance, just as I train power. A standard route in the new probably has about sixty moves on it, so I will figure out how to approximate sixty moves on my metal door frame.

I had a few other enjoyable learning experiences during my trip. For example, I had never thought about the best way to pack for a climbing trip. I just threw a bunch of stuff in a bag, and spent the rest of my trip rummaging around for items that fell to the bottom of my bag. Next trip I’ll spend less time rummaging, and more time… not rummaging, all thanks to Sean’s good ideas.

I’m launching into a new training “regimen”, and I’m toying with training five days on, two days off.

I’m going to spend the next week fine-tuning my training. These are my tools: Door frame. Chair. Up to 30lbs on a weight belt. Space to campus up, full extension, but nothing to grab and hold that high.

If you guys have any suggestions, let me know. I’ll publish all the suggestions I get soon!

"Working on an app redesign...

Zac Szewczyk — Wed, 03 Jul 2013 00:55:28 GMT

Speaking of app redesigns, Nevan Mrgan tweeted a screenshot of an app he was in the process of redesigning for iOS 7. Unlike Instacast 4’s mockups, this one looks like it will fit right in.

Permalink.

OpenGL Texture Coordinates

Whacky Labs — Tue, 02 Jul 2013 20:58:54 GMT

Let’s talk about OpenGL Texture Coordinates. Whenever we need to render a bitmap image using OpenGL, we need to pass in something called the texture coordinates to the GPU.

I’ll be using flexible pipeline, but the approach can be easily used for fixed pipeline as well, as there is no shader magic involved. We’ll more focusing on calculating the texture coordinates.

For this tutorial I will be shamelessly ripping off this awesome webgl tutorial to render textures to a rotating cube, and tweak it to display a flat square with a texture. Scroll down for the entire code and the live demo link.

Let’s start with basic, rendering entire texture.

Let’s say this is the image I wish to render

Cool Guy

The texture coordinates start at origin top-left of the screen.

Cool Guy

And in OpenGL we render a quad as TRIANGLE_STIP as A->B->C->D

Cool Guy

So, texture coordinates for an entire texture is set as:

var textureCoords = [
 
0.0, 1.0,  //A
1.0, 1.0,  //B
0.0, 0.0,  //C
1.0, 0.0  //D
 
];

Cool Guy

Now if we wish to render a portion of the original texture, we can simply map it to points we wish, keeping in mind the texture coordinates above.

Let’s say we wish to render only the first half of the texture, we can set texture coordinates as:

var textureCoords = [
0.0, 1.0,
0.5, 1.0,
0.0, 0.0,
0.5, 0.0
];

Cool Guy

As you can see we are just rendering half the width. Similarly, we can render only the next half by:

var textureCoords = [
0.5, 1.0,
1.0, 1.0,
0.5, 0.0,
1.0, 0.0
];

Cool Guy

What if we just wish to render the logo on our cool guy’s shirt. Try a few experimenting around, you can find the texture coordinates, just keep in mind the way coordinate-system works for textures.

One way to guess the texture coordinates is assume the range of x-min, x-max and y-min, y-max. Like for above requirement, after few trial-n-errors I calculated the coordinates to be in range:

x-min = 0.1
x-max = 0.43
y-min = 0.4
y-max = 0.57

So, the texture coordinates becomes:

var textureCoords = [
0.1, 0.57,
0.43, 0.57,
0.1, 0.4,
0.43, 0.4
];

Cool Guy

Now, in real life you seldom need to calculate the points yourself. There are plenty of applications that do that for you. One of my favorite is Zwoptex. You just need to drop your images into these sprite-sheet maker apps, and they give you a single texture, with an associated data file, that contains the texture coordinates.

Here’s an older article on converting data from Zwoptex to texture-coordinates.

Another, cool thing you can do with texture coordinates is to repeat them along a given bounds. First you need to set the correct parameters when you bind your texture.

gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_S, gl.REPEAT);
gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_T, gl.REPEAT);

Next, set the texture coordinates values greater than 1.

For example, this set of texture coordinates will repeat the entire texture twice on both X and Y axis.

var textureCoords = [
0.0, 2.0,
2.0, 2.0,
0.0, 0.0,
2.0, 0.0
];

Cool Guy

Yet, another interesting parameters are MIRRORED_REPEAT. It will mirror the repeat.

gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_S, gl.MIRRORED_REPEAT);
gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_T, gl.MIRRORED_REPEAT);

Cool Guy

And, finally we have GL_CLAMP_TO_EDGE, for scenarios where you don’t wish the texture to repeat at all but just extend all the way to the nearest edge.

gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_S, gl.CLAMP_TO_EDGE);
gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_T, gl.CLAMP_TO_EDGE);

Cool Guy

Now is the time for you to play with the code. Get the live demo here (if you’ve webgl enabled browser)

And the code

<html>
 
<head>
<title>Texture Coordinates</title>
<meta http-equiv="content-type" content="text/html; charset=ISO-8859-1">
 
<script type="text/javascript" src="glMatrix-0.9.5.min.js"></script>
<script type="text/javascript" src="webgl-utils.js"></script>
 
<script id="shader-fs" type="x-shader/x-fragment">
    precision mediump float;
 
    varying vec2 vTextureCoord;
 
    uniform sampler2D uSampler;
 
    void main(void) {
        gl_FragColor = texture2D(uSampler, vec2(vTextureCoord.s, vTextureCoord.t));
    }
</script>
 
<script id="shader-vs" type="x-shader/x-vertex">
    attribute vec3 aVertexPosition;
    attribute vec2 aTextureCoord;
 
    uniform mat4 uMVMatrix;
    uniform mat4 uPMatrix;
 
    varying vec2 vTextureCoord;
 
 
    void main(void) {
        gl_Position = uPMatrix * uMVMatrix * vec4(aVertexPosition, 1.0);
        vTextureCoord = aTextureCoord;
    }
</script>
 
 
<script type="text/javascript">
 
    var gl;
 
    function initGL(canvas) {
        try {
            gl = canvas.getContext("experimental-webgl");
            gl.viewportWidth = canvas.width;
            gl.viewportHeight = canvas.height;
        } catch (e) {
        }
        if (!gl) {
            alert("Could not initialise WebGL, sorry :-(");
        }
    }
 
 
    function getShader(gl, id) {
        var shaderScript = document.getElementById(id);
        if (!shaderScript) {
            return null;
        }
 
        var str = "";
        var k = shaderScript.firstChild;
        while (k) {
            if (k.nodeType == 3) {
                str += k.textContent;
            }
            k = k.nextSibling;
        }
 
        var shader;
        if (shaderScript.type == "x-shader/x-fragment") {
            shader = gl.createShader(gl.FRAGMENT_SHADER);
        } else if (shaderScript.type == "x-shader/x-vertex") {
            shader = gl.createShader(gl.VERTEX_SHADER);
        } else {
            return null;
        }
 
        gl.shaderSource(shader, str);
        gl.compileShader(shader);
 
        if (!gl.getShaderParameter(shader, gl.COMPILE_STATUS)) {
            alert(gl.getShaderInfoLog(shader));
            return null;
        }
 
        return shader;
    }
 
 
    var shaderProgram;
 
    function initShaders() {
        var fragmentShader = getShader(gl, "shader-fs");
        var vertexShader = getShader(gl, "shader-vs");
 
        shaderProgram = gl.createProgram();
        gl.attachShader(shaderProgram, vertexShader);
        gl.attachShader(shaderProgram, fragmentShader);
        gl.linkProgram(shaderProgram);
 
        if (!gl.getProgramParameter(shaderProgram, gl.LINK_STATUS)) {
            alert("Could not initialise shaders");
        }
 
        gl.useProgram(shaderProgram);
 
        shaderProgram.vertexPositionAttribute = gl.getAttribLocation(shaderProgram, "aVertexPosition");
        gl.enableVertexAttribArray(shaderProgram.vertexPositionAttribute);
 
        shaderProgram.textureCoordAttribute = gl.getAttribLocation(shaderProgram, "aTextureCoord");
        gl.enableVertexAttribArray(shaderProgram.textureCoordAttribute);
 
        shaderProgram.pMatrixUniform = gl.getUniformLocation(shaderProgram, "uPMatrix");
        shaderProgram.mvMatrixUniform = gl.getUniformLocation(shaderProgram, "uMVMatrix");
        shaderProgram.samplerUniform = gl.getUniformLocation(shaderProgram, "uSampler");
    }
 
    var mvMatrix = mat4.create();
    var mvMatrixStack = [];
    var pMatrix = mat4.create();
 
    function mvPushMatrix() {
        var copy = mat4.create();
        mat4.set(mvMatrix, copy);
        mvMatrixStack.push(copy);
    }
 
    function mvPopMatrix() {
        if (mvMatrixStack.length == 0) {
            throw "Invalid popMatrix!";
        }
        mvMatrix = mvMatrixStack.pop();
    }
 
 
    function setMatrixUniforms() {
        gl.uniformMatrix4fv(shaderProgram.pMatrixUniform, false, pMatrix);
        gl.uniformMatrix4fv(shaderProgram.mvMatrixUniform, false, mvMatrix);
    }
 
 
    function degToRad(degrees) {
        return degrees * Math.PI / 180;
    }
 
    var positionBuffer;
    var textureCoordBuffer;
    
    function initBuffers() {
      positionBuffer = gl.createBuffer();
        gl.bindBuffer(gl.ARRAY_BUFFER, positionBuffer);
        vertices = [
            -1.0, -1.0,  1.0,
             1.0, -1.0,  1.0,
            -1.0,  1.0,  1.0,
            1.0,  1.0,  1.0
        ];
        gl.bufferData(gl.ARRAY_BUFFER, new Float32Array(vertices), gl.STATIC_DRAW);
        positionBuffer.itemSize = 3;
        positionBuffer.numItems = 4;
 
        textureCoordBuffer = gl.createBuffer();
        gl.bindBuffer(gl.ARRAY_BUFFER, textureCoordBuffer);
        var textureCoords = [
          0.0, 1.0,
          1.0, 1.0,
          0.0, 0.0,
          1.0, 0.0
        ];
        gl.bufferData(gl.ARRAY_BUFFER, new Float32Array(textureCoords), gl.STATIC_DRAW);
        textureCoordBuffer.itemSize = 2;
        textureCoordBuffer.numItems = 4;
    }
 
    function handleLoadedTexture(texture) {
        gl.bindTexture(gl.TEXTURE_2D, texture);
        //gl.pixelStorei(gl.UNPACK_FLIP_Y_WEBGL, true);
        gl.texImage2D(gl.TEXTURE_2D, 0, gl.RGBA, gl.RGBA, gl.UNSIGNED_BYTE, texture.image);
        gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_MAG_FILTER, gl.NEAREST);
        gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_MIN_FILTER, gl.NEAREST);
		gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_S, gl.REPEAT);
        gl.texParameteri(gl.TEXTURE_2D, gl.TEXTURE_WRAP_T, gl.REPEAT);
        gl.bindTexture(gl.TEXTURE_2D, null);
    }
 
 
    var neheTexture;
 
    function initTexture() {
        neheTexture = gl.createTexture();
        neheTexture.image = new Image();
        neheTexture.image.onload = function () {
            handleLoadedTexture(neheTexture)
        }
 
        neheTexture.image.src = "images/coolguy.png";
    }
 
    function drawScene() {
        gl.viewport(0, 0, gl.viewportWidth, gl.viewportHeight);
        gl.clear(gl.COLOR_BUFFER_BIT | gl.DEPTH_BUFFER_BIT);
 
        mat4.perspective(45, gl.viewportWidth / gl.viewportHeight, 0.1, 100.0, pMatrix);
 
        mat4.identity(mvMatrix);
 
        mat4.translate(mvMatrix, [0.0, 0.0, -5.0]);
 
        gl.bindBuffer(gl.ARRAY_BUFFER, positionBuffer);
        gl.vertexAttribPointer(shaderProgram.vertexPositionAttribute, positionBuffer.itemSize, gl.FLOAT, false, 0, 0);
 
        gl.bindBuffer(gl.ARRAY_BUFFER, textureCoordBuffer);
        gl.vertexAttribPointer(shaderProgram.textureCoordAttribute, textureCoordBuffer.itemSize, gl.FLOAT, false, 0, 0);
 
        gl.activeTexture(gl.TEXTURE0);
        gl.bindTexture(gl.TEXTURE_2D, neheTexture);
        gl.uniform1i(shaderProgram.samplerUniform, 0);
 
        setMatrixUniforms();
        gl.drawArrays(gl.TRIANGLE_STRIP, 0, positionBuffer.numItems);
    }
 
 
    var lastTime = 0;
 
    function animate() {
        var timeNow = new Date().getTime();
        if (lastTime != 0) {
            var elapsed = timeNow - lastTime;
 
            xRot += (90 * elapsed) / 1000.0;
            yRot += (90 * elapsed) / 1000.0;
            zRot += (90 * elapsed) / 1000.0;
        }
        lastTime = timeNow;
    }
 
 
    function tick() {
        requestAnimFrame(tick);
        drawScene();
   //     animate();
    }
 
 
    function webGLStart() {
        var canvas = document.getElementById("lesson05-canvas");
        initGL(canvas);
        initShaders();
        initBuffers();
        initTexture();
 
        gl.clearColor(0.5, 0.5, 0.5, 1.0);
        gl.enable(gl.DEPTH_TEST);
 
//        drawScene();
        tick();
    }
 
 
</script>
 
 
</head>
 
 
<body onload="webGLStart();">
    <canvas id="lesson05-canvas" style="border: none;" width="500" height="500"></canvas>
</body>
 
</html>

The Story of David's Dark Past

The David Brownman Blog — Tue, 02 Jul 2013 03:00:00 GMT

undefined

Read the whole thing.

Bring it in, Betaworks

Zac Szewczyk — Tue, 02 Jul 2013 00:45:58 GMT

Two days ago Betaworks — creator of the popular iOS game Dots, the company behind Digg’s rise back to fame, and proud owner of Instapaper — opened Digg Reader to the public after greatly accelerating its development following the announcement of Google Reader’s impending demise. Especially for a product upon which work was not schedule to begin until the end of this year, Digg Reader is a very impressive entrant into the RSS reader market.

Permalink.

Bye Instacast

Zac Szewczyk — Mon, 01 Jul 2013 23:08:47 GMT

A few days ago Instacast’s created tweeted some mockups of the app’s next iteration. As a diehard Instacast fan, I was very excited to get a sneak peek at the next version of the popular podcasting app.

Permalink.

Into the Wild

🦉 olshansky 🦁 — Mon, 01 Jul 2013 19:49:59 GMT

Olshansky's review of Into the Wild

Reddit took down my website!

Jason Eckert's Website and Blog — Sun, 30 Jun 2013 03:00:00 GMT

Yup - I woke up Saturday to find the message above when I visited my website. I’ve used Primus (Planet Domain) for the past 8 years as a hosting provider, and I’ve never had any issues whatsoever - including reaching my bandwidth cap.

For starters, I was a little concerned, so I logged into my cpanel and checked out the AWSTATS first:

Holy crap! Did I just get too much traffic this month? I have been doing a lot of linking to my site from twitter for Game On 2.0 at the Ontario Science Centre. So I decided to view the day-by-day bandwidth:

June #1GAM game and board game AI

Liza Shulyayeva — Sat, 29 Jun 2013 23:11:29 GMT

My June One Game a Month project is called Interdiction. It’s a two player board game based on Tic-Tac-Toe, but with a twist. The goal of the game is to get a higher score than your opponent. Placing five of your tiles in a row grants you ten bonus points and usually, but not always, results in a win. However, it’s technically possible for a player to get enough points to win the match even if they aren’t the ones to finish the game with five in a row.

The Future of Computing, The Future of Computer Programmers - An Interview with Yukihiro "Matz" Matsumoto

Fred Wu (@fredwu) — Sat, 29 Jun 2013 15:04:00 GMT

10 Years Ago, in an MMO far, far away

Ben Overmyer's Site — Sat, 29 Jun 2013 03:00:00 GMT

Ten years ago nearly to the day, Star Wars: Galaxies launched to the world. As a remembrance of the adventures I had there, I'm writing now about the game as it was in those days and the community that surrounded it. As you read this, you may wish to listen to the playlist on YouTube that starts with the above video. It's a wonderful collection of the music from the game, familiar audio glitches included.

The features page for the first SWG website

One of the things I remember reading first about Star Wars: Galaxies was an interview with lead world artist John Roy about procedural planet generation, and how he would discover features of the landscape that were new even to the designers. That got me really excited about exploring these worlds that I'd only read about or seen on the big screen. I'm not sure how often this technique is employed in modern MMORPGs. My impression is that the vast majority of current worlds are slowly crafted by hand by artists, which is why we have so many beautiful vistas but so few boring areas to contrast them with. If all we ever see is beauty, we start to tire of it and look for something better.

I miss the rolling hills of Corellia where my first SWG toon “grew up.” Another thing that I truly miss about Star Wars: Galaxies is the wait times at the starports. You could only travel to another planet if you bought a ticket for a starship and waited at a starport for one. They arrived in ten minute intervals, which means frequently large groups of players would congregate at the main starports while waiting to travel to another planet. It made for some great conversations, and new friends.

A starport in Star Wars: Galaxies

Something else I miss about Star Wars: Galaxies was the grind. As a crafter who played before the concept of “practice mode” was introduced, I would sit there and grind out components to level up my skill for hours. When I ran out of materials or empty space in my inventory, I'd make a backpack, shove the extra items in there, and head out to my personal harvesters for more materials. This was before anyone was able to build medium or heavy harvesters, so there were still vast fields of personal harvesters dotting the landscape.

A personal mineral extractor

The grind, at least for SWG crafting, meant long periods of sitting there doing the exact same motions over and over again. This sounds really boring, but frequently after about five minutes of doing this, I would hit a kind of altered state of mind - a vaguely pleasant feeling of just “being.” The only other time I've ever felt that is when practicing Zen meditation, and I sorely miss it.

Before vehicles were introduced, everyone had to walk everywhere. Shuttles and starports were jammed full of players on their way someplace. Player cities didn't exist yet, but there were always massive collections of player houses exactly 1 km outside of every major NPC city. It made those cities feel a lot like real cities - you would always be passing by other players on your way either into the city core for transport, into the suburbs for shopping or socializing, or out into the wilderness for adventuring and hunting. Every city had its own distinctive feel, too, on my home server of Chilastra.

Corellia had some beautiful vistas

Coronet on Corellia was where I first landed, and it's where I spent the first few months of the game. It felt very rugged, like a city on the fringe. Theed, on Naboo, was where the entertainers and image designers hung out. It was definitely a “pretty” city. Mos Eisley was… well, a desert city. Because of all the difficult, unbuildable terrain surrounding Mos Eisley, it wasn't nearly as dense as the others. I think the players more nostalgic for A New Hope landed there. The other cities, like Restuss on Rori and the Imperial Outpost on Talus, had much smaller and more focused populations. Later, when they allowed players to build on some of the more advanced planets like Dantooine and Lok, more interesting communities started springing up.

In the end, Star Wars: Galaxies really was the best MMORPG experience I've ever had. The early months, even with all the bugs, network issues, and missing content (capes!?), are permanently etched in my memory as a wonderful time. Rest in peace, SWG.

Useful Thunar Custom Actions

duncanlock.net — Sat, 29 Jun 2013 00:11:43 GMT

Thunar - XFCE & XUbuntu’s small but perfectly formed file manager - has a simple mechanism that allows you to easily add new commands to the right click menu of files and folders. These are called Custom Actions and are easy to create… here’s how to do it.

Click the Edit menu, then click ‘Configure custom actions…‘. This will take you to the Custom Actions Manager, where you can create, edit or delete your custom actions.

You can enter anything into the command box, including complex bash scripts, names of scripts or executables on the PATH, or the full path and filename of the command you want to run.

On the ‘Appearance Conditions‘ tab, you tell Thunar when you want your item to appear in the right click menu:

Figure 1. Now, when I right click on a text file, I have extra options in my menu.

I’ve included my custom actions below - and you can find more around the web. I’ve only included ones here that aren’t commonly listed elsewhere.

But first, a word about Working Directories & Variables

Working Directory

The current working directory for the a custom action, is the folder the Thunar window that launched the action, is currently displaying. You can test this by creating and running the following custom action:

Test CWD

Description: Prints out the current working directory
Command

pwd | zenity --text-info

File Pattern: *
Appears if selection contains: Directories
Requirements

sudo apt-get install zenity

This means that you can use just filenames without a path in your custom actions to refer to a file in the current folder. This means that you can use the %N variable to process a list of selected files, instead if having to use the %F variable which includes the full pathname - this is handy for renaming just the files, without tampering with the pathname, for example.

Variables

Thunar custom actions can contain variable parameters, that get substituted with the actual value when you run the action. These allow you to refer to the files that are currently selected in Thunar when running your actions, without knowing in advance which ones. The following variables are available:

This…	is replaced at runtime with this…
%f	The path to the first selected file
%F	The paths to all the selected files
%d	Directory containing the file referred to by %f
%D	Directories containing the files referred to by %F
%n	The first selected filename, without the path
%N	All the selected filenames, without paths

This…

is replaced at runtime with this…

The path to the first selected file

The paths to all the selected files

Directory containing the file referred to by %f

Directories containing the files referred to by %F

The first selected filename, without the path

All the selected filenames, without paths

You can see examples of these variables in use below.

My Thunar Custom Actions

To use these yourself, copy and paste these names, descriptions & commands into new actions in your Custom Actions Manager:

Share Folder

Description: Shares the currently selected folder, giving everyone read access.
Command

net usershare add %n %f "" Everyone:R guest_ok=y

File Pattern: *
Appears if selection contains: Directories

Flatten Folder

Description: Moves all files from sub-folders to parent (current) folder, then removes all empty folders inside the current folder.
Command

find . -mindepth 2 -type f -exec mv "{}" . \; && find . -type d -empty -delete

File Pattern: *
Appears if selection contains: Directories

Rename to lower-case

Description: Rename the currently selected files, making the filenames lower-case.
Command

for file in %N; do mv "$file" "$(echo "$file" | tr '[:upper:]' '[:lower:]')"; done

File Pattern: *
Appears if selection contains: All

Slugify Filename

Description: Rename the currently selected files, making the filenames lower-case & replacing spaces with dashes.
Command

for file in %N; do mv "$file" "$(echo "$file" | tr -s ' ' | tr ' A-Z' '-a-z' | tr -s '-' | tr -c '[:alnum:][:cntrl:].' '-')"; done

File Pattern: *
Appears if selection contains: All

Copy Contents to Clipboard

Description: Copies the contents of the selected file to the clipboard.
Command

cat "%F" | xclip -i -selection clipboard

File Pattern: *
Appears if selection contains: Text Files
Requirements

sudo apt-get install xclip

Compare

Description: Compares selected files or folders in Meld
Command

meld %F

File Pattern: *
Appears if selection contains: Directories, Text Files
Requirements: Either get the latest version of meld like this, or install the version in your distributions repository:

sudo apt-get install meld

Compress with Advpng

Description: Runs Advpng on each of the selected PNG Files.
Command

for file in %F; do advpng -z -4 -q "$file"; done

File Pattern: *.png
Appears if selection contains: Image Files
Requirements

sudo apt-get install advancecomp

Quantize with pngnq

Description: Reduce to 8bit colour, by running pngnq on each of the selected PNG Files.
Command

for file in %F; do pngnq -s1 "$file"; done

File Pattern: *.png
Appears if selection contains: Image Files
Requirements

sudo apt-get install pngnq

Optimize with jpegoptim

Description: Losslessly optimize JPEGs, by optimizing the Huffman tables and stripping comments and EXIF metadata from the file.
Command

for file in %F; do jpegoptim --strip-all -of "$file"; done

File Pattern: .jpg;.jpeg
Appears if selection contains: Image Files
Requirements

sudo apt-get install jpegoptim

If you make a mistake, you should get a pay rise

Databases & Life — Fri, 28 Jun 2013 03:00:00 GMT

The following two viewpoints are not consistent:

“Come and work at our company. We are looking for someone with lots of experience. The more experience you have the more you’ll get paid!”
“You made a mistake. You’re fired!”

You can pick up knowledge at university and through reading books. But companies still want experience in addition to knowledge. For me, experience is very much having seen what works, and what doesn’t work, by having done things that work, and done things that don’t work.

Pivoting in Postgres

CRAIG KERSTIENS — Thu, 27 Jun 2013 23:55:56 GMT

Earlier today on an internal Heroku group alias there was a dataclip shared. The dataclip listed off some data grouped by a category, there was a reply a few minutes later with a modification to the query that used the crosstab function to pivot directly in SQL. There were immediately several reactions on the list that went something like this:

While a mostly simple function in Postgres (there are a few rough edges), it really is all too handy. So here it is in action. Taking some data that looks like

row identifier, in this case date
category grouping, in this case OS
value

Given a really basic query that generates some sample data it may look something like this:

SELECT generate_series AS date,
b.desc AS TYPE,
(random() * 10000 + 1)::int AS val
FROM generate_series((now() - '100 days'::interval)::date, now()::date, '1 day'::interval),
(SELECT unnest(ARRAY['OSX', 'Windows', 'Linux']) AS DESC) b;

You get results that look like:

But of course this isn’t overly helpful in comparing day to day overall. You can do so on a OS by OS basis, but its annoying enough as is. The easy solution is to simply use a pivot table on your data. Most people at this point would pull it up into Excel or Google Docs, or you can do it directly in Postgres. To do so you’ll first enable the extension tablefunc:

CREATE EXTENSION tablefunc

Then you’ll use the crosstab function. The function looks something like:

SELECT *
FROM crosstab(
'SELECT row_name, category_grouping, value FROM foo',
'SELECT category_names FROM bar')
AS
ct_result (category_name text, category1 text, category2 text, etc.)

Lets see it an actual action. Given the same query we used to generate fake data we can actually pivot on it now directly in PostgreSQL:

SELECT *
FROM crosstab(
'SELECT
a date,
b.desc AS os,
(random() * 10000 + 1)::int AS value
FROM generate_series((now() - ''100 days''::interval)::date, now()::date, ''1 DAY''::interval) a,
(SELECT unnest(ARRAY[''OSX'', ''Windows'', ''Linux'']) AS DESC) b ORDER BY 1,2
','SELECT unnest(ARRAY[''OSX'', ''Windows'', ''Linux''])'
)
AS ct(date date, OSX int, Windows int, Linux int);

And see some results:

Have fun analyzing your data directly in your DB now. And as always if you have feedback/questions/requests please feel free to drop me a line craig.kerstiens@gmail.com

Datamappify - A New Take on Decoupling Domain, Form and Persistence in Rails

Fred Wu (@fredwu) — Thu, 27 Jun 2013 15:09:00 GMT

To Infinity and Beyond

The David Brownman Blog — Thu, 27 Jun 2013 03:00:00 GMT

undefined

Read the whole thing.

Using nginx with Google’s spdy and pagespeed to test website-speed

zufallsheld — Wed, 26 Jun 2013 21:38:00 GMT

UPDATE: Google no longer supports spdy. Instead it focuses on http/2. This blog-post is no longer up-to-date.

Today I tested nginx with Google’s spdy implementation.I already tested pagespeed separatly in a different post that showed the speed-boost gained from it. Now to add the security for you …

Duplicate Bible verses

Honza Pokorný — Wed, 26 Jun 2013 03:52:00 GMT

The text of the ESV was used.

Number of verses that appear more than once: 235 (i.e. the number of list items below).

Genesis 36:41, 1 Chronicles 1:52
Matthew 8:20, Luke 9:58
2 Kings 19:5, Isaiah 37:5
2 Kings 19:2, Isaiah 37:2
1 Chronicles 16:10, Psalms 105:3
Ezra 2:53, Nehemiah 7:55
2 Samuel 22:46, Psalms 18:45
2 Kings 18:3, 2 Chronicles 29:2
1 Kings 12:11, 2 Chronicles 10:11
2 Kings 19:34, Isaiah 37:35
Ezekiel 40:29, Ezekiel 40:33
Genesis 10:27, 1 Chronicles 1:21
Jeremiah 10:15, Jeremiah 51:18
1 Kings 8:14, 2 Chronicles 6:3
1 Kings 12:6, 2 Chronicles 10:6
2 Samuel 23:19, 1 Chronicles 11:21
Genesis 10:16, 1 Chronicles 1:14
2 Kings 16:4, 2 Chronicles 28:4
1 Kings 12:1, 2 Chronicles 10:1
Psalms 60:8, Psalms 108:9
Genesis 10:2, 1 Chronicles 1:5
1 Chronicles 16:22, Psalms 105:15
2 Kings 22:18, 2 Chronicles 34:26
2 Samuel 23:37, 1 Chronicles 11:39
Job 4:1, Job 15:1, Job 22:1
1 Kings 22:7, 2 Chronicles 18:6
Numbers 29:18, Numbers 29:21, Numbers 29:24, Numbers 29:27, Numbers 29:30, Numbers 29:33
Matthew 26:41, Mark 14:38
Proverbs 18:8, Proverbs 26:22
1 Kings 12:4, 2 Chronicles 10:4
Matthew 26:32, Mark 14:28
Ezra 2:3, Nehemiah 7:8
Genesis 36:37, 1 Chronicles 1:48
2 Kings 18:20, Isaiah 36:5
Genesis 36:34, 1 Chronicles 1:45
Numbers 7:15, Numbers 7:21, Numbers 7:27, Numbers 7:33, Numbers 7:39, Numbers 7:45, Numbers 7:51, Numbers 7:57, Numbers 7:63, Numbers 7:69, Numbers 7:75, Numbers 7:81
1 Kings 8:35, 2 Chronicles 6:26
Ezra 2:51, Nehemiah 7:53
Psalms 59:6, Psalms 59:14
1 Kings 12:17, 2 Chronicles 10:17
2 Kings 21:5, 2 Chronicles 33:5
Leviticus 24:13, Numbers 16:36
Genesis 10:26, 1 Chronicles 1:20
1 Kings 22:18, 2 Chronicles 18:17
2 Kings 14:12, 2 Chronicles 25:22
2 Samuel 8:5, 1 Chronicles 18:5
Luke 20:43, Acts 2:35
Mark 12:40, Luke 20:47
Ezra 2:16, Nehemiah 7:21
2 Kings 20:17, Isaiah 39:6
Job 40:3, Job 42:1
2 Kings 8:18, 2 Chronicles 21:6
Proverbs 14:12, Proverbs 16:25
1 Chronicles 16:24, Psalms 96:3
Exodus 40:1, Leviticus 5:14, Leviticus 6:1, Leviticus 6:8, Leviticus 6:19, Leviticus 6:24, Leviticus 7:22, Leviticus 7:28, Leviticus 8:1, Leviticus 12:1, Leviticus 14:1, Leviticus 20:1, Leviticus 23:1, Leviticus 24:1, Leviticus 27:1, Numbers 4:21, Numbers 5:1, Numbers 6:22, Numbers 9:9, Numbers 10:1, Numbers 13:1, Numbers 15:1, Numbers 15:17, Numbers 17:1, Numbers 26:52, Numbers 28:1, Numbers 31:1, Numbers 34:1, Numbers 34:16
1 Kings 8:17, 2 Chronicles 6:7
Numbers 29:16, Numbers 29:25
2 Samuel 22:9, Psalms 18:8
Judges 17:6, Judges 21:25
Matthew 24:19, Mark 13:17
Job 27:1, Job 29:1
Ezekiel 40:34, Ezekiel 40:37
Psalms 42:11, Psalms 43:5
Jeremiah 6:14, Jeremiah 8:11
Genesis 36:42, 1 Chronicles 1:53
1 Kings 22:13, 2 Chronicles 18:12
1 Kings 12:12, 2 Chronicles 10:12
Ezra 2:43, Nehemiah 7:46
1 Kings 22:29, 2 Chronicles 18:28
2 Kings 19:26, Isaiah 37:27
Ezra 2:27, Nehemiah 7:31
2 Kings 23:32, 2 Kings 23:37
1 Kings 22:9, 2 Chronicles 18:8
2 Kings 18:13, Isaiah 36:1
Matthew 6:27, Luke 12:25
Psalms 107:6, Psalms 107:13, Psalms 107:19, Psalms 107:28
1 Kings 8:31, 2 Chronicles 6:22
Leviticus 2:3, Leviticus 2:10
2 Samuel 22:31, Psalms 18:30
1 Kings 10:6, 2 Chronicles 9:5
Matthew 24:46, Luke 12:43
Matthew 7:8, Luke 11:10
Matthew 24:18, Mark 13:16
Ezra 2:58, Nehemiah 7:60
Leviticus 3:10, Leviticus 3:15
Exodus 16:11, Exodus 31:12, Numbers 25:10, Numbers 27:6
2 Samuel 7:17, 1 Chronicles 17:15
Matthew 12:41, Luke 11:32
1 Kings 22:25, 2 Chronicles 18:24
Proverbs 22:3, Proverbs 27:12
2 Samuel 23:38, 1 Chronicles 11:40
Genesis 10:13, 1 Chronicles 1:11
Jeremiah 29:30, Jeremiah 35:12
2 Kings 18:23, Isaiah 36:8
Matthew 12:27, Luke 11:19
2 Kings 19:30, Isaiah 37:31
Exodus 13:1, Exodus 25:1, Exodus 30:11, Exodus 30:17, Exodus 30:22, Exodus 31:1, Numbers 15:37, Numbers 31:25
Numbers 7:25, Numbers 7:31, Numbers 7:37, Numbers 7:43, Numbers 7:49, Numbers 7:55, Numbers 7:61, Numbers 7:67, Numbers 7:73, Numbers 7:79
Ezra 2:7, Nehemiah 7:12
1 Corinthians 1:3, 2 Corinthians 1:2, Ephesians 1:2, Philippians 1:2, 2 Thessalonians 1:2, Philemon 1:3
Jeremiah 10:16, Jeremiah 51:19
Numbers 7:16, Numbers 7:22, Numbers 7:28, Numbers 7:34, Numbers 7:40, Numbers 7:46, Numbers 7:52, Numbers 7:58, Numbers 7:64, Numbers 7:70, Numbers 7:76, Numbers 7:82
1 Kings 10:14, 2 Chronicles 9:13
2 Kings 19:11, Isaiah 37:11
2 Samuel 22:10, Psalms 18:9
1 Chronicles 16:14, Psalms 105:7
2 Samuel 8:7, 1 Chronicles 18:7
Psalms 67:3, Psalms 67:5
2 Samuel 23:14, 1 Chronicles 11:16
Matthew 11:6, Luke 7:23
1 Kings 8:18, 2 Chronicles 6:8
Genesis 10:29, 1 Chronicles 1:23
Isaiah 35:10, Isaiah 51:11
2 Kings 19:10, Isaiah 37:10
1 Kings 7:25, 2 Chronicles 4:4
Matthew 24:35, Mark 13:31, Luke 21:33
Ezra 2:37, Nehemiah 7:40
Matthew 12:30, Luke 11:23
2 Kings 22:15, 2 Chronicles 34:23
1 Chronicles 16:21, Psalms 105:14
2 Kings 25:2, Jeremiah 52:5
Psalms 57:5, Psalms 57:11, Psalms 108:5
1 Chronicles 16:20, Psalms 105:13
1 Kings 12:19, 2 Chronicles 10:19
Revelation 2:29, Revelation 3:6, Revelation 3:13
Genesis 10:3, 1 Chronicles 1:6
2 Samuel 22:19, Psalms 18:18
Mark 10:18, Luke 18:19
Psalms 107:8, Psalms 107:15, Psalms 107:21, Psalms 107:31
Matthew 24:32, Mark 13:28
Ezra 2:9, Nehemiah 7:14
Exodus 14:1, Numbers 7:4
2 Samuel 22:30, Psalms 18:29
1 Kings 8:12, 2 Chronicles 6:1
Genesis 10:6, 1 Chronicles 1:8
2 Samuel 10:9, 1 Chronicles 19:10
1 Kings 8:15, 2 Chronicles 6:4
Matthew 11:9, Luke 7:26
Matthew 24:34, Mark 13:30
1 Kings 10:23, 2 Chronicles 9:22
Genesis 46:11, 1 Chronicles 6:1
Mark 10:15, Luke 18:17
2 Samuel 22:34, Psalms 18:33
Song of Solomon 2:7, Song of Solomon 3:5
1 Samuel 31:1, 1 Chronicles 10:1
1 Kings 22:17, 2 Chronicles 18:16
2 Kings 19:13, Isaiah 37:13
1 Kings 12:9, 2 Chronicles 10:9
1 Kings 8:24, 2 Chronicles 6:15
2 Samuel 22:6, Psalms 18:5
Jeremiah 16:1, Ezekiel 6:1, Ezekiel 7:1, Ezekiel 12:1, Ezekiel 13:1, Ezekiel 17:1, Ezekiel 18:1, Ezekiel 21:1, Ezekiel 23:1, Ezekiel 24:15, Ezekiel 25:1, Ezekiel 27:1, Ezekiel 28:1, Ezekiel 28:20, Ezekiel 30:1, Ezekiel 33:1, Ezekiel 33:23, Ezekiel 34:1, Ezekiel 35:1, Ezekiel 36:16, Ezekiel 37:15, Ezekiel 38:1
Genesis 10:15, 1 Chronicles 1:13
1 Kings 15:16, 1 Kings 15:32
Jeremiah 7:1, Jeremiah 11:1, Jeremiah 18:1, Jeremiah 30:1
Leviticus 13:1, Leviticus 14:33, Leviticus 15:1, Numbers 2:1, Numbers 4:1, Numbers 4:17
1 Chronicles 16:8, Psalms 105:1
1 Samuel 31:2, 1 Chronicles 10:2
1 Kings 7:23, 2 Chronicles 4:2
2 Samuel 22:4, Psalms 18:3
Ezra 2:38, Nehemiah 7:41
Jeremiah 32:26, Jeremiah 33:19, Jeremiah 33:23
Ezra 2:23, Nehemiah 7:27
Matthew 11:10, Luke 7:27
2 Kings 19:7, Isaiah 37:7
Matthew 26:46, Mark 14:42
2 Samuel 7:4, 1 Chronicles 17:3
Job 11:1, Job 20:1
2 Kings 24:19, Jeremiah 52:2
2 Kings 19:33, Isaiah 37:34
Ezra 2:39, Nehemiah 7:42
Matthew 7:3, Luke 6:41
2 Samuel 22:40, Psalms 18:39
Ezekiel 11:14, Ezekiel 12:17, Ezekiel 12:21, Ezekiel 12:26, Ezekiel 14:2, Ezekiel 14:12, Ezekiel 15:1, Ezekiel 20:2, Ezekiel 20:45, Ezekiel 21:8, Ezekiel 22:17, Ezekiel 22:23, Zechariah 6:9
1 Kings 8:36, 2 Chronicles 6:27
1 Kings 19:10, 1 Kings 19:14
Numbers 29:28, Numbers 29:38
Proverbs 6:11, Proverbs 24:34
2 Kings 19:1, Isaiah 37:1
1 Kings 22:34, 2 Chronicles 18:33
Jeremiah 10:14, Jeremiah 51:17
Psalms 60:9, Psalms 108:10
Genesis 36:35, 1 Chronicles 1:46
1 Kings 22:28, 2 Chronicles 18:27
Exodus 20:6, Deuteronomy 5:10
Ezra 2:34, Nehemiah 7:36
2 Kings 25:3, Jeremiah 52:6
Matthew 25:21, Matthew 25:23
Leviticus 4:1, Leviticus 17:1, Leviticus 18:1, Leviticus 19:1, Leviticus 21:16, Leviticus 22:1, Leviticus 22:17, Leviticus 22:26, Leviticus 23:9, Leviticus 23:23, Leviticus 23:26, Leviticus 23:33, Numbers 3:5, Numbers 3:11, Numbers 3:44, Numbers 5:5, Numbers 5:11, Numbers 6:1, Numbers 8:5, Numbers 8:23, Numbers 16:23, Numbers 18:25, Numbers 25:16, Numbers 35:9
Job 6:1, Job 9:1, Job 12:1, Job 16:1, Job 19:1, Job 21:1, Job 23:1, Job 26:1
Psalms 60:12, Psalms 108:13
2 Kings 25:29, Jeremiah 52:33
2 Kings 8:20, 2 Chronicles 21:8
2 Kings 18:19, Isaiah 36:4
Numbers 14:26, Numbers 16:20
1 Kings 22:11, 2 Chronicles 18:10
Song of Solomon 2:6, Song of Solomon 8:3
Genesis 10:14, 1 Chronicles 1:12
1 Chronicles 3:7, 1 Chronicles 14:6
Ezra 2:64, Nehemiah 7:66
2 Samuel 23:23, 1 Chronicles 11:25
2 Kings 15:3, 2 Chronicles 26:4
2 Samuel 22:35, Psalms 18:34
Ezra 2:4, Nehemiah 7:9
Job 8:1, Job 18:1, Job 25:1
1 Kings 22:16, 2 Chronicles 18:15
Matthew 24:47, Luke 12:44
1 Chronicles 16:34, Psalms 118:1, Psalms 118:29
Mark 15:2, Luke 23:3
Job 38:1, Job 40:6
1 Kings 22:5, 2 Chronicles 18:4
Proverbs 6:10, Proverbs 24:33
2 Kings 19:12, Isaiah 37:12
1 Chronicles 16:16, Psalms 105:9
2 Kings 25:20, Jeremiah 52:26
Ezra 2:32, Nehemiah 7:35
2 Kings 18:24, Isaiah 36:9
1 Kings 10:27, 2 Chronicles 9:27
Exodus 25:33, Exodus 37:19
Numbers 7:14, Numbers 7:20, Numbers 7:26, Numbers 7:32, Numbers 7:38, Numbers 7:44, Numbers 7:50, Numbers 7:56, Numbers 7:62, Numbers 7:68, Numbers 7:74, Numbers 7:80
Psalms 46:7, Psalms 46:11
Jeremiah 13:8, Jeremiah 18:5, Jeremiah 24:4, Ezekiel 17:11
Genesis 10:28, 1 Chronicles 1:22
1 Chronicles 16:11, Psalms 105:4
Genesis 10:17, 1 Chronicles 1:15
Genesis 36:33, 1 Chronicles 1:44
Matthew 17:21, Matthew 18:11, Matthew 23:14, Mark 7:16, Mark 9:44, Mark 9:46, Mark 11:26, Mark 15:28, Luke 17:36, Luke 23:17, John 5:4, Acts 8:37, Acts 15:34, Acts 24:7, Acts 28:29, Romans 16:24
Ezra 2:31, Nehemiah 7:34
Matthew 26:30, Mark 14:26
Leviticus 19:30, Leviticus 26:2
Genesis 36:36, 1 Chronicles 1:47
Numbers 16:44, Numbers 20:7
Proverbs 21:9, Proverbs 25:24
Philippians 4:23, Philemon 1:25
2 Samuel 22:20, Psalms 18:19
Matthew 13:42, Matthew 13:50

Bible verses by length

Honza Pokorný — Wed, 26 Jun 2013 03:44:00 GMT

Text used: ESV. From shortest to longest.

John 11:35, Job 3:2, Numbers 31:33, Numbers 31:44, Luke 20:30, Numbers 31:34, 1 Thessalonians 5:16, 1 Chronicles 1:25, Joshua 15:29, 1 Chronicles 1:1, Numbers 31:45, Joshua 15:52, Nehemiah 10:26, Acts 15:18, Numbers 31:46, Deuteronomy 2:17, Joshua 19:43, 1 Chronicles 1:26, 1 Chronicles 4:29, 1 Chronicles 8:22, 1 Chronicles 8:31, Nehemiah 10:15, Luke 17:32, Genesis 10:28, Genesis 25:14, Genesis 36:42, Exodus 20:15, Joshua 15:24, Joshua 15:26, Joshua 15:42, Joshua 15:50, Joshua 18:23, Joshua 19:36, 1 Chronicles 1:22, 1 Chronicles 1:53, 1 Chronicles 8:15, 1 Chronicles 8:19, 1 Chronicles 8:23, 1 Chronicles 12:26, 2 Chronicles 11:8, Ezra 2:29, Nehemiah 10:13, 1 Thessalonians 5:17, Genesis 8:15, Genesis 10:27, Exodus 20:13, Joshua 15:23, Joshua 15:43, 1 Chronicles 1:21, 1 Chronicles 3:7, 1 Chronicles 14:6, Ezra 2:5, Ezra 2:10, Ezra 2:15, Nehemiah 7:10, Nehemiah 7:20, Nehemiah 10:17, Nehemiah 10:18, Nehemiah 11:33, 1 Thessalonians 5:25, Exodus 13:1, Exodus 25:1, Exodus 30:11, Exodus 30:17, Exodus 30:22, Exodus 31:1, Numbers 15:37, Numbers 31:25, Deuteronomy 5:17, Joshua 15:22, Joshua 18:25, Joshua 18:27, Joshua 19:20, 1 Chronicles 8:4, Ezra 2:8, Ezra 2:11, Ezra 2:17, Ezra 2:18, Ezra 2:20, Ezra 2:32, Nehemiah 7:13, Nehemiah 7:16, Nehemiah 7:23, Nehemiah 7:25, Nehemiah 7:35, Nehemiah 10:11, Nehemiah 10:16, Nehemiah 10:27, Nehemiah 11:32, John 6:48, Genesis 23:14, Genesis 36:41, Genesis 46:23, Leviticus 11:15, Numbers 4:48, Deuteronomy 3:15, Deuteronomy 14:14, Joshua 15:30, Joshua 15:39, Joshua 15:58, Joshua 19:4, Joshua 19:37, 1 Chronicles 1:2, 1 Chronicles 1:27, 1 Chronicles 1:52, 1 Chronicles 4:30, 1 Chronicles 14:5, 2 Chronicles 11:7, Ezra 2:7, Ezra 2:9, Ezra 2:19, Ezra 2:22, Ezra 2:27, Nehemiah 7:12, Nehemiah 7:14, Nehemiah 7:15, Nehemiah 7:22, Nehemiah 7:24, Nehemiah 7:31, Nehemiah 10:19, Nehemiah 10:22, Nehemiah 11:34, Nehemiah 12:4, Mark 4:14, Deuteronomy 2:2, Joshua 15:38, Joshua 15:40, Joshua 15:56, Joshua 18:26, Joshua 19:3, 1 Chronicles 1:24, 2 Chronicles 11:9, Ezra 2:12, Ezra 2:23, Ezra 2:24, Ezra 2:30, Ezra 2:34, Ezra 2:37, Ezra 2:39, Nehemiah 7:17, Nehemiah 7:27, Nehemiah 7:36, Nehemiah 7:40, Nehemiah 7:42, Nehemiah 10:5, Nehemiah 10:24, Nehemiah 12:5, Job 40:1, 2 Corinthians 13:13, 1 Thessalonians 5:19, Hebrews 13:25, Genesis 26:6, Exodus 6:10, Deuteronomy 5:19, 1 Chronicles 1:3, 1 Chronicles 8:20, Ezra 2:3, Ezra 2:13, Ezra 2:14, Ezra 2:35, Ezra 10:35, Ezra 10:39, Nehemiah 7:8, Nehemiah 7:18, Nehemiah 7:19, Nehemiah 7:38, Nehemiah 10:6, Nehemiah 10:21, Nehemiah 10:23, Nehemiah 12:2, Matthew 9:7, John 10:30, 1 Thessalonians 5:20, Exodus 16:11, Exodus 31:12, Numbers 25:10, Numbers 27:6, Joshua 15:55, 1 Chronicles 12:11, Ezra 2:21, Ezra 2:38, Ezra 10:36, Ezra 10:37, Nehemiah 7:41, Nehemiah 10:2, Nehemiah 10:7, Nehemiah 10:20, Nehemiah 10:25, Nehemiah 12:3, Nehemiah 12:6, Job 6:1, Job 9:1, Job 12:1, Job 16:1, Job 19:1, Job 21:1, Job 23:1, Job 26:1, Isaiah 8:5, Jeremiah 21:3, Exodus 14:1, Numbers 7:4, Joshua 4:15, Joshua 15:37, Joshua 19:19, Joshua 19:42, Joshua 19:44, 1 Chronicles 2:8, 1 Chronicles 7:27, 1 Chronicles 8:5, 1 Chronicles 8:24, Ezra 2:4, Nehemiah 7:9, Nehemiah 10:3, Nehemiah 10:4, Job 35:1, Romans 2:11, Hebrews 13:1, Numbers 26:8, Deuteronomy 14:11, Joshua 15:31, Joshua 15:53, Joshua 20:1, 1 Chronicles 1:4, 1 Chronicles 3:14, Ezra 10:40, Ezra 10:41, Ezra 10:42, Nehemiah 7:28, Nehemiah 10:12, Nehemiah 12:33, Job 34:1, Isaiah 7:10, Luke 15:3, Genesis 23:5, Numbers 1:46, Joshua 18:22, 1 Chronicles 12:12, Ezra 2:28, Ezra 10:38, Nehemiah 7:32, Nehemiah 7:33, Job 36:1, Luke 20:32, Luke 24:8, 1 Corinthians 15:30, 1 Thessalonians 2:20, Exodus 20:14, Joshua 19:45, 2 Samuel 5:15, 1 Kings 5:2, 1 Chronicles 6:53, Nehemiah 7:30, Matthew 13:9, Matthew 22:27, Mark 14:50, Luke 9:55, John 10:42, 1 Timothy 4:11, Exodus 1:2, Exodus 1:3, Exodus 1:4, Exodus 40:1, Leviticus 5:14, Leviticus 6:1, Leviticus 6:8, Leviticus 6:19, Leviticus 6:24, Leviticus 7:22, Leviticus 7:28, Leviticus 8:1, Leviticus 12:1, Leviticus 14:1, Leviticus 20:1, Leviticus 23:1, Leviticus 24:1, Leviticus 27:1, Numbers 4:21, Numbers 5:1, Numbers 6:22, Numbers 6:24, Numbers 9:9, Numbers 10:1, Numbers 13:1, Numbers 15:1, Numbers 15:17, Numbers 17:1, Numbers 26:52, Numbers 27:15, Numbers 28:1, Numbers 31:1, Numbers 32:35, Numbers 34:1, Numbers 34:16, Joshua 15:35, 2 Samuel 5:16, 1 Chronicles 3:6, 1 Chronicles 8:14, 1 Chronicles 8:26, 2 Chronicles 11:6, Ezra 2:26, Psalms 18:1, Isaiah 3:21, Isaiah 37:15, Jeremiah 16:1, Ezekiel 6:1, Ezekiel 7:1, Ezekiel 12:1, Ezekiel 13:1, Ezekiel 17:1, Ezekiel 18:1, Ezekiel 21:1, Ezekiel 23:1, Ezekiel 24:15, Ezekiel 25:1, Ezekiel 27:1, Ezekiel 28:1, Ezekiel 28:20, Ezekiel 30:1, Ezekiel 33:1, Ezekiel 33:23, Ezekiel 34:1, Ezekiel 35:1, Ezekiel 36:16, Ezekiel 37:15, Ezekiel 38:1, Matthew 24:25, 1 Thessalonians 5:22, 2 Timothy 4:9, 2 Timothy 4:12, Hebrews 12:29, Genesis 21:24, Genesis 25:5, Leviticus 11:14, Numbers 4:44, Numbers 7:16, Numbers 7:22, Numbers 7:28, Numbers 7:34, Numbers 7:40, Numbers 7:46, Numbers 7:52, Numbers 7:58, Numbers 7:64, Numbers 7:70, Numbers 7:76, Numbers 7:82, Deuteronomy 14:13, Joshua 15:34, 2 Samuel 23:25, 1 Kings 1:46, 1 Chronicles 14:7, Ezra 10:32, Nehemiah 12:20, Matthew 6:11, Matthew 10:12, Mark 4:3, Luke 11:3, John 1:2, Acts 13:30, Ephesians 4:5, 1 John 5:7, Genesis 49:18, Numbers 26:11, Joshua 15:27, 1 Chronicles 1:30, 1 Chronicles 2:15, 1 Chronicles 8:17, 1 Chronicles 12:10, Ezra 2:31, Nehemiah 7:34, Psalms 25:1, Psalms 109:1, Ecclesiastes 4:7, Jeremiah 25:21, Luke 22:62, Luke 24:48, John 7:53, Acts 17:33, 1 Timothy 5:3, 1 John 4:19, Jude 1:22, Genesis 26:23, Numbers 2:4, Numbers 2:6, Numbers 2:8, Numbers 2:11, Numbers 2:13, Numbers 2:15, Numbers 2:19, Numbers 2:21, Numbers 2:23, Numbers 2:26, Numbers 2:28, Numbers 2:30, Deuteronomy 14:3, Joshua 15:28, 1 Samuel 30:28, 1 Samuel 30:30, 2 Samuel 23:35, 2 Samuel 23:38, 1 Kings 4:18, 1 Chronicles 11:40, 1 Chronicles 24:28, Nehemiah 11:29, Esther 9:8, Matthew 7:1, Luke 24:43, John 4:4, John 5:41, Acts 8:8, Acts 19:7, Romans 3:16, 2 Corinthians 5:7, 2 Corinthians 13:12, Ephesians 5:30, Hebrews 6:3, Revelation 13:9, Genesis 24:34, Leviticus 4:1, Leviticus 10:8, Leviticus 17:1, Leviticus 18:1, Leviticus 19:1, Leviticus 21:16, Leviticus 22:1, Leviticus 22:17, Leviticus 22:26, Leviticus 23:9, Leviticus 23:23, Leviticus 23:26, Leviticus 23:33, Numbers 1:14, Numbers 1:48, Numbers 3:5, Numbers 3:11, Numbers 3:44, Numbers 5:5, Numbers 5:11, Numbers 6:1, Numbers 8:1, Numbers 8:5, Numbers 8:23, Numbers 16:23, Numbers 16:44, Numbers 18:25, Numbers 20:7, Numbers 25:16, Numbers 28:29, Numbers 29:10, Numbers 35:9, Deuteronomy 5:18, Deuteronomy 14:20, Joshua 19:5, 1 Samuel 15:10, 1 Chronicles 2:5, 1 Chronicles 9:37, 1 Chronicles 12:13, Ezra 2:41, Nehemiah 7:44, Nehemiah 11:8, Nehemiah 12:15, Job 40:3, Job 42:1, Psalms 66:1, Ezekiel 11:14, Ezekiel 12:17, Ezekiel 12:21, Ezekiel 12:26, Ezekiel 14:2, Ezekiel 14:12, Ezekiel 15:1, Ezekiel 20:2, Ezekiel 20:45, Ezekiel 21:8, Ezekiel 22:17, Ezekiel 22:23, Zechariah 6:9, Matthew 13:18, Mark 6:42, Luke 2:30, Luke 9:56, Acts 18:16, Romans 3:15, 1 Corinthians 10:3, 1 Corinthians 16:14, 1 Timothy 2:13, Genesis 9:28, Genesis 30:28, Genesis 35:28, Leviticus 24:13, Numbers 1:9, Numbers 1:13, Numbers 4:36, Numbers 16:36, 1 Samuel 18:9, 1 Kings 17:2, 2 Kings 10:28, 1 Chronicles 24:29, Ezra 2:33, Nehemiah 7:37, Psalms 92:8, Jeremiah 13:8, Jeremiah 18:5, Jeremiah 24:4, Jeremiah 29:24, Ezekiel 17:11, Matthew 14:18, Mark 3:19, Acts 23:25, 1 Corinthians 4:16, Galatians 1:24, Ephesians 4:27, Ephesians 5:7, Revelation 2:28, Genesis 10:17, Genesis 43:1, Exodus 7:8, Exodus 15:18, Exodus 20:1, Numbers 1:15, Deuteronomy 32:48, Joshua 13:18, Judges 10:5, 1 Kings 4:1, 1 Kings 4:14, 1 Kings 17:8, 1 Chronicles 1:15, 1 Chronicles 2:14, 1 Chronicles 3:8, 1 Chronicles 8:2, 1 Chronicles 11:27, Nehemiah 11:35, Song of Solomon 1:1, Isaiah 2:18, Jeremiah 32:26, Jeremiah 33:19, Jeremiah 33:23, Ezekiel 16:1, Ezekiel 21:18, Matthew 3:8, Matthew 11:15, Mark 3:15, Mark 9:49, Mark 13:18, Luke 22:68, Luke 24:42, John 8:1, John 15:23, 1 Corinthians 11:1, Genesis 11:30, Leviticus 10:20, Joshua 15:45, 2 Samuel 23:39, 1 Kings 6:28, 1 Chronicles 1:28, 1 Chronicles 8:3, 1 Chronicles 23:15, 1 Chronicles 23:16, 1 Chronicles 23:18, Ezra 2:64, Nehemiah 7:26, Nehemiah 7:66, Nehemiah 7:68, Nehemiah 11:28, Nehemiah 12:19, Psalms 130:1, Proverbs 27:5, Ecclesiastes 3:9, Lamentations 3:31, Daniel 4:28, Zechariah 1:20, Matthew 12:16, John 3:30, John 19:1, Acts 7:50, Romans 1:22, Galatians 5:9, Genesis 19:18, Genesis 29:11, Genesis 35:24, Exodus 16:30, Exodus 16:36, Exodus 20:3, Exodus 33:18, Numbers 1:8, Numbers 31:37, Joshua 15:49, Judges 9:22, 2 Samuel 23:28, 1 Chronicles 2:12, 1 Chronicles 6:25, 1 Chronicles 6:46, Ezra 10:34, Nehemiah 7:56, Nehemiah 12:34, Psalms 56:3, Psalms 61:1, Jeremiah 2:1, Matthew 12:21, Matthew 22:38, Matthew 23:38, Mark 15:13, Luke 1:47, Luke 21:18, Acts 27:26, Romans 1:31, Romans 16:6, Romans 16:8, 1 Corinthians 15:26, 1 Corinthians 16:23, Galatians 6:5, 1 Thessalonians 5:26, James 1:16, Genesis 25:15, Exodus 28:13, Numbers 1:7, Numbers 1:11, Numbers 1:12, Numbers 16:4, Numbers 27:5, Deuteronomy 5:7, Ruth 4:21, 1 Kings 6:11, 1 Chronicles 11:37, 1 Chronicles 24:8, Ezra 2:16, Nehemiah 7:21, Isaiah 38:4, Jeremiah 48:22, Habakkuk 1:1, Matthew 22:14, Luke 1:37, Luke 14:6, Luke 19:34, Luke 23:16, John 11:36, John 12:45, John 16:31, Acts 27:37, Romans 3:11, Genesis 5:23, Genesis 15:20, Genesis 25:31, Genesis 30:5, Genesis 36:28, Exodus 22:18, Leviticus 13:1, Leviticus 14:33, Leviticus 15:1, Leviticus 21:13, Numbers 2:1, Numbers 4:1, Numbers 4:17, Numbers 29:4, Deuteronomy 27:11, Joshua 19:21, Judges 20:29, 1 Chronicles 6:41, 1 Chronicles 11:29, 1 Chronicles 11:41, 1 Chronicles 23:7, Ezra 10:20, Nehemiah 7:69, Nehemiah 11:18, Nehemiah 12:13, Job 8:1, Job 18:1, Job 25:1, Psalms 23:1, Psalms 49:2, Psalms 137:2, Psalms 139:1, Isaiah 40:1, Ezekiel 28:11, Mark 4:23, Mark 13:36, Mark 14:46, Luke 4:19, Luke 20:43, John 3:24, John 7:2, John 7:5, John 7:9, John 14:4, John 20:28, Acts 2:35, Romans 3:17, 1 Corinthians 3:23, 1 Corinthians 9:4, 1 Corinthians 10:14, 1 Timothy 5:15, Revelation 2:25, Genesis 28:10, Exodus 2:25, Exodus 20:8, Exodus 25:5, Numbers 29:15, Deuteronomy 5:30, Joshua 15:33, Judges 12:8, 1 Kings 4:17, 1 Kings 6:14, 1 Chronicles 2:20, 1 Chronicles 6:42, 1 Chronicles 6:43, 1 Chronicles 7:39, 1 Chronicles 9:10, 1 Chronicles 11:47, Ezra 7:4, Esther 4:15, Job 42:13, Job 42:17, Psalms 89:52, Psalms 119:3, Jeremiah 29:30, Jeremiah 32:13, Jeremiah 35:12, Zechariah 1:2, Matthew 12:8, Matthew 23:32, Luke 1:46, Luke 9:15, Luke 19:1, Luke 21:19, John 4:41, John 4:43, Romans 15:33, 1 Corinthians 16:8, 2 Corinthians 2:8, 2 Corinthians 4:12, Philippians 4:14, Colossians 2:21, Genesis 10:23, Genesis 30:10, Exodus 12:45, Exodus 38:13, Leviticus 14:56, Numbers 25:17, Judges 12:10, Ruth 4:19, 2 Samuel 12:2, 2 Samuel 20:26, 1 Chronicles 5:5, 1 Chronicles 6:5, 1 Chronicles 12:9, 1 Chronicles 24:10, 1 Chronicles 24:11, Ezra 2:54, Ezra 2:66, Ezra 7:2, Nehemiah 11:26, Nehemiah 12:14, Nehemiah 12:16, Nehemiah 12:18, Nehemiah 12:21, Esther 4:12, Job 4:1, Job 15:1, Job 17:15, Job 22:1, Job 35:4, Psalms 38:22, Psalms 114:3, Psalms 116:11, Psalms 146:1, Proverbs 6:7, Song of Solomon 7:10, Jeremiah 1:4, Ezekiel 22:1, Hosea 4:17, Matthew 14:10, Matthew 19:15, Mark 5:32, Mark 9:40, Mark 11:22, Luke 21:17, John 1:24, John 20:10, Acts 11:25, Romans 3:18, 1 Corinthians 8:3, 1 Corinthians 13:9, 2 Corinthians 3:12, 2 Corinthians 9:15, 2 Corinthians 10:17, Galatians 1:5, Ephesians 2:1, Philippians 1:3, 1 Thessalonians 5:21, 1 John 5:21, 2 John 1:13, Genesis 6:8, Genesis 10:15, Genesis 22:22, Genesis 24:26, Genesis 33:16, Exodus 6:21, Exodus 12:47, Numbers 1:25, Numbers 1:39, Numbers 18:14, 2 Samuel 23:27, 2 Samuel 23:31, 1 Kings 22:47, 1 Chronicles 1:13, 1 Chronicles 4:7, 1 Chronicles 4:34, 1 Chronicles 11:33, 1 Chronicles 11:36, 1 Chronicles 24:9, 2 Chronicles 8:3, Job 11:1, Job 20:1, Job 29:15, Psalms 16:1, Psalms 38:18, Psalms 55:16, Psalms 87:1, Song of Solomon 2:1, Isaiah 3:19, Jeremiah 7:1, Jeremiah 11:1, Jeremiah 18:1, Jeremiah 30:1, Hosea 8:2, Zechariah 4:8, Malachi 2:1, Matthew 7:20, Matthew 11:26, Matthew 11:30, Matthew 23:11, Mark 15:30, Luke 6:36, Luke 7:35, Luke 7:48, John 4:3, John 10:31, Acts 7:47, Acts 12:24, Acts 20:33, Romans 8:8, 1 Corinthians 1:22, 1 Corinthians 12:20, Ephesians 4:20, Genesis 10:6, Genesis 30:12, Genesis 46:11, Genesis 46:14, Numbers 1:6, Numbers 13:15, Numbers 21:31, Numbers 26:14, Numbers 28:30, Numbers 31:43, Deuteronomy 5:13, Ruth 3:5, Ruth 4:22, 1 Samuel 7:15, 1 Kings 4:16, 1 Kings 9:17, 1 Chronicles 1:8, 1 Chronicles 2:11, 1 Chronicles 2:38, 1 Chronicles 3:11, 1 Chronicles 4:28, 1 Chronicles 6:1, 1 Chronicles 6:8, 1 Chronicles 6:12, 1 Chronicles 6:16, 1 Chronicles 6:51, 1 Chronicles 7:38, 1 Chronicles 8:16, 1 Chronicles 8:25, 1 Chronicles 12:35, Nehemiah 11:27, Job 27:1, Job 29:1, Psalms 25:22, Psalms 108:2, Psalms 119:113, Psalms 132:3, Proverbs 1:10, Isaiah 10:8, Isaiah 27:2, Jeremiah 22:29, Jeremiah 48:23, Lamentations 3:46, Zechariah 7:4, Matthew 25:2, Mark 3:30, Mark 6:9, Luke 4:30, Luke 5:38, Luke 21:13, Luke 24:16, John 4:26, Acts 14:7, Acts 16:8, 1 Corinthians 16:21, 1 Corinthians 16:24, Galatians 5:8, Ephesians 4:23, James 1:9, 1 Peter 5:11, Revelation 22:21, Genesis 7:24, Genesis 9:8, Genesis 11:18, Genesis 11:20, Genesis 21:28, Genesis 30:34, Exodus 13:4, Exodus 15:3, Exodus 19:25, Exodus 20:9, Exodus 35:7, Leviticus 14:55, Leviticus 25:1, Numbers 1:27, Numbers 1:41, Numbers 7:14, Numbers 7:20, Numbers 7:26, Numbers 7:32, Numbers 7:38, Numbers 7:44, Numbers 7:50, Numbers 7:56, Numbers 7:62, Numbers 7:68, Numbers 7:74, Numbers 7:80, Deuteronomy 24:2, Joshua 12:12, Joshua 12:13, Joshua 12:14, Joshua 12:19, Joshua 15:48, 1 Kings 9:14, 2 Kings 21:10, 1 Chronicles 24:12, Job 10:4, Psalms 35:12, Psalms 77:5, Psalms 100:1, Psalms 102:1, Psalms 124:5, Proverbs 24:26, Lamentations 3:50, Lamentations 3:54, Ezekiel 12:8, Zechariah 8:1, Matthew 3:2, Matthew 8:7, Matthew 20:16, Mark 2:28, Mark 8:37, Mark 10:3, Mark 14:52, Luke 3:6, Luke 15:11, Luke 19:25, Luke 23:21, John 9:1, John 14:15, John 17:17, Romans 3:14, 1 Corinthians 7:6, Philippians 2:14, Philippians 3:16, Colossians 3:6, 1 Thessalonians 5:28, 1 Peter 3:2, Genesis 6:10, Genesis 11:16, Genesis 26:30, Genesis 26:35, Genesis 31:45, Exodus 25:38, Numbers 1:21, Numbers 1:23, Numbers 26:46, Numbers 33:43, Deuteronomy 3:29, Deuteronomy 18:13, Joshua 1:10, Joshua 15:25, Joshua 15:61, 1 Kings 3:10, 1 Chronicles 1:54, 1 Chronicles 2:2, 1 Chronicles 2:37, 1 Chronicles 6:26, 1 Chronicles 6:27, 1 Chronicles 7:37, 1 Chronicles 21:9, 1 Chronicles 24:14, Ezra 7:3, Nehemiah 2:11, Job 31:4, Psalms 113:6, Psalms 114:2, Psalms 119:12, Psalms 119:163, Ecclesiastes 4:5, Jeremiah 32:6, Jonah 4:4, Matthew 5:2, Matthew 16:15, Mark 11:19, Mark 13:37, Luke 4:44, Luke 24:53, John 11:14, John 11:18, John 14:14, John 15:14, Acts 7:1, Acts 18:1, Acts 21:9, Romans 6:7, Galatians 4:11, Ephesians 2:9, Ephesians 5:10, Philippians 1:21, 2 Timothy 4:22, 1 Peter 2:3, Jude 1:2, Genesis 5:6, Genesis 5:9, Genesis 5:18, Genesis 6:22, Genesis 7:5, Genesis 9:29, Genesis 10:13, Genesis 10:16, Genesis 11:14, Genesis 11:22, Genesis 11:24, Genesis 17:3, Leviticus 11:18, Numbers 1:31, Numbers 1:33, Numbers 13:8, Numbers 13:12, Numbers 14:26, Numbers 16:6, Numbers 16:20, Numbers 19:1, Numbers 33:27, Numbers 33:56, Deuteronomy 2:18, Joshua 11:18, 2 Samuel 23:36, 1 Kings 7:43, 1 Chronicles 1:11, 1 Chronicles 1:14, 1 Chronicles 1:16, 1 Chronicles 2:36, 1 Chronicles 3:12, 1 Chronicles 3:13, 1 Chronicles 6:23, 1 Chronicles 6:45, 1 Chronicles 7:26, 1 Chronicles 12:36, 1 Chronicles 27:31, Nehemiah 10:8, Esther 5:7, Esther 9:9, Psalms 102:27, Psalms 109:8, Psalms 115:2, Psalms 119:68, Proverbs 27:17, Isaiah 14:28, Ezekiel 27:20, Ezekiel 43:1, Zephaniah 2:1, Zephaniah 2:12, Haggai 1:7, Matthew 10:30, Matthew 14:32, Matthew 20:33, Matthew 22:26, Matthew 22:45, Matthew 24:13, Matthew 25:4, Matthew 27:36, Mark 8:21, Mark 14:17, Mark 15:3, Luke 5:28, Luke 18:26, Luke 18:37, Luke 20:4, Luke 20:40, Luke 20:44, Luke 22:5, John 2:21, John 3:9, John 4:30, John 6:20, John 7:29, John 8:15, John 9:38, Acts 13:37, Romans 9:12, 1 Corinthians 9:3, Ephesians 3:14, Colossians 1:8, 1 Thessalonians 4:18, Genesis 5:28, Genesis 25:1, Genesis 34:18, Genesis 36:1, Exodus 6:22, Exodus 21:25, Exodus 28:31, Numbers 1:17, Numbers 1:29, Numbers 1:35, Numbers 1:37, Numbers 1:43, Numbers 13:5, Numbers 32:34, Numbers 33:13, Numbers 33:21, Numbers 33:28, Deuteronomy 3:23, Deuteronomy 5:2, Joshua 12:15, Joshua 12:17, Joshua 12:18, Joshua 12:24, 1 Samuel 17:56, 2 Samuel 6:4, 2 Samuel 23:26, 1 Kings 7:13, 1 Kings 14:1, 2 Kings 19:5, 1 Chronicles 6:11, 1 Chronicles 6:40, 1 Chronicles 6:52, 1 Chronicles 11:32, 2 Chronicles 30:20, Esther 8:16, Job 7:18, Job 9:29, Job 34:3, Psalms 34:20, Psalms 48:12, Psalms 63:8, Psalms 72:20, Psalms 130:8, Proverbs 8:15, Proverbs 24:8, Isaiah 28:26, Isaiah 37:5, Isaiah 57:21, Jeremiah 7:8, Jeremiah 13:3, Jeremiah 16:20, Lamentations 3:13, Lamentations 3:34, Ezekiel 7:17, Hosea 6:8, Nahum 2:6, Zechariah 3:6, Matthew 4:20, Matthew 7:10, Matthew 11:6, Matthew 12:9, Matthew 15:35, Matthew 22:1, Matthew 23:2, Mark 14:59, Mark 15:25, Luke 3:10, Luke 5:16, Luke 7:23, John 7:43, John 11:5, John 11:23, John 16:9, Acts 11:3, Acts 11:4, Romans 2:6, Romans 3:10, Galatians 1:21, Galatians 4:10, 1 Thessalonians 2:11, 1 Timothy 2:11, 1 Timothy 4:5, 1 Peter 4:9, Genesis 10:3, Genesis 37:19, Genesis 41:37, Genesis 50:12, Exodus 6:2, Exodus 22:19, Leviticus 11:17, Numbers 13:7, Numbers 13:9, Numbers 13:10, Numbers 13:13, Numbers 26:51, Numbers 33:42, Numbers 33:45, Deuteronomy 6:4, Deuteronomy 28:17, Joshua 12:11, Joshua 12:16, Joshua 12:21, Judges 11:4, 2 Samuel 23:30, 2 Kings 11:21, 1 Chronicles 1:6, 1 Chronicles 2:39, 1 Chronicles 6:6, 1 Chronicles 6:7, 1 Chronicles 6:9, 1 Chronicles 6:13, 1 Chronicles 8:11, 1 Chronicles 8:35, 1 Chronicles 9:6, 2 Chronicles 4:15, 2 Chronicles 11:19, Nehemiah 11:10, Nehemiah 12:17, Job 16:20, Job 27:9, Job 41:27, Psalms 5:1, Psalms 29:7, Psalms 44:4, Psalms 52:4, Psalms 76:1, Psalms 84:1, Psalms 106:12, Psalms 107:5, Psalms 119:13, Psalms 119:44, Psalms 120:7, Psalms 126:3, Jeremiah 48:4, Lamentations 3:21, Ezekiel 41:23, Amos 6:9, Zechariah 7:8, Matthew 15:15, Matthew 23:1, Matthew 24:8, Mark 3:12, Mark 15:37, Luke 8:53, Luke 11:12, Luke 18:21, Luke 24:2, John 1:4, John 1:6, John 3:15, John 6:34, John 8:8, Acts 12:2, Romans 7:22, 1 Corinthians 15:5, 2 Corinthians 11:11, Ephesians 5:1, Ephesians 5:22, Philippians 4:13, 1 Thessalonians 5:24, 2 Thessalonians 3:18, Hebrews 6:14, Genesis 36:4, Genesis 44:6, Genesis 46:13, Exodus 17:8, Exodus 23:32, Exodus 29:8, Exodus 40:14, Leviticus 21:19, Numbers 13:6, Numbers 13:14, Numbers 28:21, Numbers 34:21, Deuteronomy 12:4, Deuteronomy 14:16, Deuteronomy 22:10, Deuteronomy 28:5, Joshua 12:10, Ruth 4:20, 1 Samuel 26:4, 1 Kings 12:22, 1 Kings 22:44, 1 Chronicles 2:43, 1 Chronicles 2:48, 1 Chronicles 4:25, 1 Chronicles 6:18, 1 Chronicles 6:30, 1 Chronicles 8:18, 1 Chronicles 9:41, 1 Chronicles 11:28, 1 Chronicles 11:38, 1 Chronicles 11:43, 1 Chronicles 23:23, 1 Chronicles 29:26, 2 Chronicles 15:1, Ezra 2:67, Esther 8:4, Esther 9:7, Job 5:7, Job 10:6, Job 36:24, Job 38:10, Psalms 31:14, Psalms 65:2, Psalms 71:21, Psalms 109:9, Psalms 113:5, Psalms 119:60, Psalms 119:137, Psalms 137:4, Psalms 148:9, Proverbs 3:35, Proverbs 6:4, Proverbs 8:5, Proverbs 8:33, Isaiah 43:11, Jeremiah 15:12, Jeremiah 30:22, Jeremiah 34:12, Jeremiah 46:3, Lamentations 3:10, Lamentations 3:28, Lamentations 3:45, Lamentations 3:49, Ezekiel 16:35, Ezekiel 27:2, Ezekiel 34:9, Daniel 6:21, Zechariah 14:6, Matthew 9:19, Matthew 25:7, Matthew 26:46, Matthew 27:28, Mark 2:11, Mark 6:44, Mark 14:42, Luke 2:3, Luke 2:28, Luke 17:5, Luke 20:23, Luke 22:28, John 5:40, John 7:13, John 8:30, John 8:45, John 9:23, John 9:33, John 18:27, Acts 3:9, Acts 14:28, Acts 23:13, Romans 3:6, Romans 9:13, 1 Corinthians 3:6, 1 Corinthians 11:8, 1 Corinthians 14:32, 1 Corinthians 14:40, 1 Corinthians 15:7, 1 Corinthians 15:33, 2 Corinthians 3:16, 2 Corinthians 7:16, Ephesians 1:8, Colossians 1:14, Philemon 1:12, Hebrews 7:22, James 1:8, Genesis 5:12, Genesis 5:15, Genesis 10:24, Genesis 10:26, Genesis 12:9, Genesis 19:23, Genesis 24:57, Genesis 32:1, Genesis 36:27, Exodus 4:13, Exodus 9:2, Exodus 22:22, Exodus 39:22, Numbers 16:8, Numbers 17:11, Numbers 21:10, Numbers 31:15, Numbers 33:10, Numbers 33:18, Numbers 33:26, Joshua 19:18, 1 Chronicles 1:18, 1 Chronicles 1:20, 1 Chronicles 2:40, 1 Chronicles 2:45, 1 Chronicles 6:2, 1 Chronicles 6:4, 1 Chronicles 6:14, 2 Chronicles 17:18, Job 1:22, Job 5:16, Job 13:2, Job 13:24, Job 13:25, Psalms 2:1, Psalms 2:11, Psalms 8:7, Psalms 20:9, Psalms 22:3, Psalms 35:2, Psalms 38:5, Psalms 48:7, Psalms 49:9, Psalms 90:13, Psalms 102:16, Psalms 117:1, Psalms 118:2, Psalms 119:57, Psalms 119:94, Psalms 126:5, Psalms 135:10, Psalms 147:3, Psalms 148:12, Proverbs 1:17, Proverbs 10:12, Proverbs 18:23, Ecclesiastes 12:8, Isaiah 48:22, Jeremiah 32:38, Lamentations 3:12, Lamentations 3:41, Ezekiel 34:7, Obadiah 1:6, Zechariah 1:18, Zechariah 8:18, Matthew 10:9, Matthew 22:36, Mark 1:33, Mark 4:9, Luke 4:7, Luke 8:11, Luke 12:35, Luke 22:57, John 6:4, John 8:36, John 13:28, John 14:18, Acts 20:5, Romans 11:29, 1 Corinthians 3:21, 1 Corinthians 11:9, 1 Corinthians 12:19, 2 Corinthians 5:3, Philippians 2:18, Colossians 2:9, Colossians 4:14, 2 Timothy 2:3, Titus 2:6, 3 John 1:1, Genesis 5:8, Genesis 5:21, Genesis 23:12, Genesis 27:8, Genesis 37:6, Genesis 46:19, Exodus 6:17, Exodus 8:30, Exodus 10:18, Exodus 12:1, Exodus 23:3, Exodus 23:14, Leviticus 11:1, Numbers 6:8, Numbers 33:22, Numbers 33:25, Numbers 33:29, Numbers 33:34, Numbers 33:39, Deuteronomy 18:11, Deuteronomy 31:1, Joshua 23:11, 1 Samuel 3:4, 2 Samuel 17:26, 2 Samuel 23:32, 2 Samuel 24:19, 1 Kings 12:29, 2 Kings 1:1, 2 Kings 16:16, 1 Chronicles 1:37, 1 Chronicles 8:21, 1 Chronicles 8:30, 1 Chronicles 12:7, 1 Chronicles 12:25, 1 Chronicles 24:13, 1 Chronicles 24:15, 1 Chronicles 25:11, 2 Chronicles 4:14, 2 Chronicles 4:21, 2 Chronicles 17:15, Ezra 2:25, Nehemiah 7:47, Job 1:2, Job 9:14, Job 9:21, Job 11:5, Job 12:11, Job 32:7, Psalms 2:6, Psalms 7:10, Psalms 20:8, Psalms 38:17, Psalms 77:1, Psalms 84:12, Psalms 103:14, Psalms 106:19, Psalms 106:36, Psalms 114:4, Psalms 115:14, Psalms 116:9, Psalms 118:23, Psalms 119:81, Psalms 119:105, Psalms 119:140, Psalms 119:162, Psalms 147:12, Psalms 148:2, Proverbs 1:1, Proverbs 7:11, Proverbs 8:16, Proverbs 26:18, Proverbs 31:13, Isaiah 42:18, Ezekiel 16:2, Ezekiel 24:20, Daniel 10:2, Daniel 12:12, Jonah 4:1, Micah 3:10, Matthew 9:26, Matthew 12:6, Matthew 21:6, Matthew 24:16, Mark 1:18, Mark 8:30, Luke 1:75, Luke 2:31, Luke 14:2, Luke 18:12, Luke 19:6, Luke 19:10, Luke 21:2, Luke 22:9, Luke 23:24, John 6:16, John 6:43, John 6:55, John 9:10, John 15:1, John 18:24, John 19:22, Acts 2:16, Acts 13:39, 1 Corinthians 4:18, 1 Corinthians 12:4, 1 Corinthians 12:5, 2 Corinthians 11:19, Ephesians 5:21, Philippians 4:4, Philippians 4:20, 1 Thessalonians 3:8, 2 Thessalonians 3:13, 1 Timothy 6:6, Hebrews 3:9, 2 John 1:11, 3 John 1:14, Genesis 5:11, Genesis 5:14, Genesis 5:20, Genesis 11:12, Genesis 35:25, Genesis 42:17, Genesis 43:13, Exodus 21:23, Exodus 28:19, Leviticus 13:14, Numbers 33:30, Numbers 33:41, Deuteronomy 32:12, Deuteronomy 33:6, Joshua 19:28, 1 Samuel 17:14, 1 Kings 4:32, 1 Kings 6:4, 1 Kings 13:15, 1 Kings 22:1, 1 Chronicles 4:24, 1 Chronicles 6:47, 1 Chronicles 7:6, 1 Chronicles 24:7, 1 Chronicles 24:16, 1 Chronicles 24:17, 1 Chronicles 25:10, 1 Chronicles 25:17, Ezra 8:32, Nehemiah 7:29, Job 6:13, Job 6:19, Job 22:15, Job 26:6, Job 28:23, Job 30:29, Job 33:2, Job 36:25, Psalms 4:5, Psalms 6:9, Psalms 22:17, Psalms 25:4, Psalms 44:6, Psalms 48:4, Psalms 69:1, Psalms 87:3, Psalms 102:5, Psalms 115:3, Psalms 119:4, Psalms 119:139, Psalms 121:2, Proverbs 7:17, Proverbs 24:1, Ecclesiastes 1:12, Song of Solomon 1:17, Jeremiah 37:6, Jeremiah 48:14, Lamentations 3:8, Lamentations 3:23, Lamentations 3:35, Lamentations 3:53, Amos 3:3, Matthew 5:8, Matthew 6:17, Matthew 10:6, Matthew 11:13, Matthew 15:16, Matthew 24:28, Matthew 27:16, Mark 1:36, Mark 6:40, Mark 13:10, Mark 13:23, Mark 15:18, Luke 1:60, Luke 11:35, Luke 12:57, Luke 20:22, John 6:18, John 7:49, Acts 14:24, Acts 15:37, Acts 21:15, Acts 24:6, Acts 28:12, Romans 1:6, Romans 3:23, 1 Corinthians 13:10, Galatians 2:15, Galatians 4:16, Galatians 4:26, Galatians 4:28, Ephesians 3:15, Philippians 4:23, Titus 2:1, Philemon 1:25, Hebrews 10:21, Genesis 1:1, Genesis 1:3, Genesis 5:24, Genesis 5:25, Genesis 5:31, Genesis 10:12, Genesis 11:1, Genesis 15:19, Genesis 30:21, Genesis 31:17, Genesis 33:20, Genesis 36:36, Genesis 46:24, Genesis 48:8, Genesis 49:21, Exodus 14:6, Exodus 20:16, Exodus 21:1, Exodus 34:17, Exodus 39:12, Leviticus 7:1, Leviticus 13:35, Numbers 11:30, Numbers 33:20, Numbers 33:35, Joshua 2:8, Joshua 4:2, Joshua 19:25, 2 Samuel 7:4, 1 Kings 7:44, 1 Chronicles 1:47, 1 Chronicles 4:16, 1 Chronicles 6:38, 1 Chronicles 7:36, 1 Chronicles 8:27, 1 Chronicles 14:13, 1 Chronicles 17:3, 1 Chronicles 24:21, 1 Chronicles 24:24, 1 Chronicles 25:13, 1 Chronicles 27:17, 2 Chronicles 4:10, Ezra 2:44, Ezra 2:49, Esther 4:9, Job 18:9, Job 18:16, Job 24:2, Job 26:5, Job 29:20, Job 33:11, Job 34:7, Job 41:33, Psalms 26:2, Psalms 38:21, Psalms 39:7, Psalms 47:3, Psalms 50:2, Psalms 50:13, Psalms 66:2, Psalms 99:3, Psalms 102:7, Psalms 109:5, Psalms 116:10, Psalms 119:97, Psalms 119:164, Psalms 119:167, Psalms 120:1, Psalms 126:4, Psalms 134:2, Proverbs 11:16, Proverbs 30:27, Song of Solomon 7:3, Jeremiah 43:8, Jeremiah 49:25, Lamentations 3:27, Ezekiel 3:2, Ezekiel 18:5, Daniel 1:21, Daniel 5:30, Hosea 8:3, Joel 2:6, Malachi 1:1, Matthew 5:5, Matthew 5:7, Matthew 18:5, Matthew 19:2, Matthew 19:30, Matthew 20:27, Matthew 24:11, Matthew 27:39, Mark 1:43, Mark 5:17, Luke 6:28, Luke 19:41, Luke 23:52, Luke 24:45, John 5:8, John 5:33, John 11:29, John 11:53, John 12:39, Acts 4:20, Acts 9:23, Romans 12:21, Romans 16:22, 1 Corinthians 10:26, 1 Corinthians 12:14, 1 Corinthians 14:38, Galatians 1:20, Colossians 1:19, Colossians 4:4, 1 Thessalonians 4:7, Philemon 1:4, Hebrews 3:11, Hebrews 11:2, 1 Peter 1:16, 1 John 3:13, Genesis 7:12, Genesis 30:19, Genesis 36:3, Genesis 43:10, Genesis 46:9, Exodus 10:29, Exodus 28:18, Leviticus 24:17, Numbers 26:22, Numbers 31:53, Numbers 33:19, Numbers 33:31, Deuteronomy 4:24, Deuteronomy 14:17, Deuteronomy 14:18, Joshua 15:57, Joshua 21:15, 2 Samuel 22:24, 2 Kings 20:16, 1 Chronicles 3:17, 1 Chronicles 4:1, 1 Chronicles 6:58, 1 Chronicles 11:30, 1 Chronicles 15:23, 2 Chronicles 9:30, 2 Chronicles 11:2, Nehemiah 7:49, Nehemiah 7:51, Esther 7:1, Job 6:16, Job 9:30, Job 12:19, Job 21:24, Job 30:9, Job 36:28, Job 38:1, Job 38:6, Job 40:6, Psalms 3:1, Psalms 30:8, Psalms 47:8, Psalms 54:2, Psalms 73:21, Psalms 74:5, Psalms 75:2, Psalms 77:13, Psalms 82:6, Psalms 115:4, Psalms 115:5, Psalms 115:6, Psalms 116:5, Psalms 119:8, Psalms 119:47, Psalms 122:3, Psalms 128:4, Psalms 144:4, Proverbs 1:14, Proverbs 4:2, Proverbs 4:15, Proverbs 22:25, Proverbs 23:15, Proverbs 29:8, Ecclesiastes 2:25, Isaiah 12:3, Isaiah 23:6, Jeremiah 5:20, Jeremiah 5:30, Jeremiah 13:15, Jeremiah 45:2, Lamentations 3:29, Lamentations 3:40, Ezekiel 1:6, Ezekiel 11:4, Ezekiel 19:1, Daniel 6:9, Matthew 25:17, Matthew 25:39, Mark 1:12, Mark 9:6, Mark 10:31, Mark 10:36, Mark 14:39, Luke 1:73, Luke 3:20, Luke 8:9, Luke 17:30, Luke 18:6, Luke 19:19, John 2:2, John 7:46, John 10:14, John 13:17, John 17:16, Acts 2:13, Romans 6:2, Romans 8:14, Romans 11:35, Romans 12:15, 1 Corinthians 1:15, 1 Corinthians 11:31, 1 Corinthians 14:18, 2 Corinthians 3:8, Galatians 5:25, Colossians 3:19, 2 Thessalonians 3:15, Hebrews 13:8, James 4:10, James 5:2, 1 Peter 3:19, 1 John 2:25, Genesis 10:4, Genesis 10:22, Genesis 11:32, Genesis 19:7, Genesis 41:20, Genesis 49:19, Exodus 7:25, Exodus 39:11, Exodus 40:28, Leviticus 11:19, Numbers 21:12, Numbers 26:60, Numbers 33:24, Deuteronomy 1:29, Deuteronomy 19:7, Deuteronomy 22:11, Joshua 12:20, Judges 5:29, 1 Chronicles 1:7, 1 Chronicles 1:35, 1 Chronicles 2:19, 1 Chronicles 2:41, 1 Chronicles 6:20, 1 Chronicles 6:28, 1 Chronicles 6:34, 1 Chronicles 6:35, 1 Chronicles 7:19, 1 Chronicles 9:5, 1 Chronicles 24:18, 1 Chronicles 25:12, 1 Chronicles 25:15, 1 Chronicles 25:16, 1 Chronicles 25:18, 1 Chronicles 26:9, 2 Chronicles 24:4, Ezra 2:46, Ezra 2:47, Ezra 2:48, Ezra 2:53, Nehemiah 7:50, Nehemiah 7:55, Nehemiah 7:58, Job 5:10, Job 7:14, Job 20:13, Job 21:2, Job 21:26, Job 41:22, Job 41:24, Job 42:6, Psalms 16:5, Psalms 34:14, Psalms 37:31, Psalms 50:17, Psalms 55:5, Psalms 72:11, Psalms 73:22, Psalms 88:2, Psalms 90:1, Psalms 94:1, Psalms 94:5, Psalms 102:9, Psalms 105:26, Psalms 114:6, Psalms 115:15, Psalms 119:5, Psalms 119:89, Psalms 119:100, Psalms 119:147, Psalms 129:4, Psalms 129:5, Psalms 130:4, Psalms 132:4, Psalms 139:22, Psalms 147:16, Proverbs 1:30, Proverbs 6:6, Proverbs 6:21, Proverbs 6:28, Proverbs 7:14, Proverbs 9:5, Proverbs 16:26, Proverbs 23:3, Proverbs 23:20, Proverbs 30:7, Proverbs 31:12, Song of Solomon 2:11, Isaiah 35:3, Isaiah 44:27, Jeremiah 50:22, Lamentations 5:18, Ezekiel 22:8, Ezekiel 44:21, Hosea 12:5, Habakkuk 3:1, Zechariah 6:2, Matthew 5:4, Matthew 6:13, Matthew 6:21, Matthew 8:23, Matthew 10:4, Matthew 10:36, Matthew 12:17, Matthew 25:12, Matthew 26:20, Mark 3:33, Mark 6:12, Mark 9:16, Mark 10:44, Luke 1:70, Luke 4:15, Luke 12:34, Luke 18:36, Luke 18:38, John 4:16, John 7:47, John 9:12, John 19:8, Romans 2:23, Romans 14:12, 1 Corinthians 1:29, 1 Corinthians 7:23, 2 Corinthians 2:6, 2 Corinthians 6:13, 2 Corinthians 11:18, 2 Corinthians 13:6, Galatians 3:20, Galatians 5:12, Colossians 3:18, 1 Timothy 1:8, 2 Timothy 4:19, Hebrews 11:20, Genesis 1:13, Genesis 1:23, Genesis 5:17, Genesis 17:26, Genesis 24:66, Genesis 27:24, Genesis 44:25, Genesis 46:33, Genesis 49:16, Exodus 1:13, Exodus 1:21, Exodus 21:24, Exodus 36:27, Exodus 39:35, Leviticus 13:18, Leviticus 16:25, Numbers 21:19, Numbers 25:12, Numbers 31:38, Deuteronomy 4:44, Deuteronomy 11:26, Deuteronomy 15:1, Deuteronomy 24:12, Joshua 3:2, Judges 5:1, Judges 8:29, Judges 11:14, 2 Samuel 22:33, 2 Samuel 23:33, 1 Kings 3:16, 1 Chronicles 1:31, 1 Chronicles 1:34, 1 Chronicles 3:23, 1 Chronicles 6:37, 1 Chronicles 7:34, 1 Chronicles 16:14, 1 Chronicles 23:12, 1 Chronicles 23:20, 2 Chronicles 30:4, Ezra 2:56, Nehemiah 5:6, Job 8:5, Job 8:14, Job 10:14, Job 12:2, Job 13:5, Job 13:10, Job 21:27, Job 23:16, Job 27:23, Job 32:18, Job 36:31, Job 37:1, Job 40:18, Psalms 10:10, Psalms 18:47, Psalms 30:10, Psalms 33:20, Psalms 37:5, Psalms 51:3, Psalms 67:7, Psalms 71:12, Psalms 76:4, Psalms 77:7, Psalms 79:7, Psalms 81:4, Psalms 86:3, Psalms 87:7, Psalms 103:2, Psalms 105:7, Psalms 116:12, Psalms 118:25, Psalms 119:114, Psalms 119:141, Psalms 120:6, Psalms 121:4, Psalms 121:6, Psalms 122:2, Psalms 128:6, Psalms 130:5, Psalms 148:10, Proverbs 9:1, Proverbs 29:5, Song of Solomon 1:9, Isaiah 2:15, Jeremiah 6:5, Jeremiah 18:19, Lamentations 3:6, Lamentations 3:36, Lamentations 3:55, Lamentations 3:59, Lamentations 5:10, Lamentations 5:11, Ezekiel 13:4, Hosea 1:8, Joel 1:1, Matthew 2:17, Matthew 15:25, Matthew 18:2, Matthew 24:4, Matthew 24:20, Matthew 25:13, Matthew 26:32, Matthew 26:66, Matthew 28:17, Mark 3:3, Mark 5:11, Mark 10:50, Mark 14:28, Luke 6:31, Luke 19:36, Luke 20:7, Luke 23:9, Luke 23:20, John 1:11, John 3:7, John 5:42, John 9:5, John 10:2, Acts 2:32, Acts 8:4, Acts 10:13, Acts 10:40, Acts 27:36, Romans 9:2, Romans 12:14, Romans 14:16, Romans 16:3, 1 Corinthians 10:24, 1 Corinthians 15:56, Galatians 3:26, Ephesians 5:16, Ephesians 6:1, Colossians 3:7, 1 Thessalonians 1:4, 1 Timothy 4:9, 1 Timothy 5:6, 1 Peter 2:22, Genesis 1:19, Genesis 3:4, Genesis 5:27, Genesis 24:39, Genesis 31:22, Genesis 31:47, Genesis 36:8, Genesis 38:3, Genesis 42:3, Exodus 15:12, Exodus 17:13, Exodus 22:28, Exodus 37:4, Exodus 38:16, Leviticus 4:19, Leviticus 6:29, Leviticus 13:29, Numbers 26:25, Numbers 31:39, Numbers 32:37, Numbers 33:33, Numbers 36:10, Deuteronomy 28:34, Joshua 12:22, Joshua 13:20, Joshua 15:51, 1 Samuel 8:1, 1 Samuel 10:13, 1 Samuel 10:17, 1 Samuel 19:19, 1 Samuel 25:38, 2 Samuel 22:13, 1 Kings 14:30, 1 Chronicles 7:1, 1 Chronicles 7:18, 1 Chronicles 11:35, 1 Chronicles 11:45, 1 Chronicles 25:19, 1 Chronicles 26:3, 2 Chronicles 28:16, Ezra 2:45, Ezra 2:50, Ezra 2:51, Ezra 2:52, Nehemiah 7:48, Nehemiah 7:53, Nehemiah 7:54, Job 4:15, Job 10:10, Job 13:6, Job 15:26, Job 21:23, Job 33:1, Job 34:16, Job 41:16, Psalms 6:3, Psalms 18:23, Psalms 22:12, Psalms 37:27, Psalms 51:9, Psalms 51:15, Psalms 64:7, Psalms 73:1, Psalms 78:68, Psalms 78:70, Psalms 84:9, Psalms 85:3, Psalms 86:6, Psalms 86:7, Psalms 86:10, Psalms 89:31, Psalms 90:3, Psalms 92:6, Psalms 94:4, Psalms 103:3, Psalms 104:4, Psalms 104:23, Psalms 109:22, Psalms 119:29, Psalms 119:59, Psalms 119:102, Psalms 119:146, Psalms 119:175, Psalms 122:7, Psalms 139:5, Psalms 148:3, Proverbs 8:20, Proverbs 9:13, Proverbs 20:18, Proverbs 22:28, Proverbs 23:2, Proverbs 23:18, Proverbs 23:19, Proverbs 23:32, Proverbs 31:17, Song of Solomon 1:11, Isaiah 3:22, Isaiah 3:23, Isaiah 7:21, Isaiah 8:16, Isaiah 28:8, Jeremiah 25:23, Jeremiah 31:26, Jeremiah 38:8, Lamentations 3:57, Ezekiel 23:13, Daniel 3:9, Haggai 2:11, Zechariah 5:1, Matthew 20:29, Matthew 22:35, Matthew 26:16, Mark 1:1, Mark 1:42, Mark 11:30, Mark 15:5, Luke 1:23, Luke 9:30, Luke 12:23, Luke 13:10, Luke 17:9, Luke 22:29, John 1:44, John 2:5, John 4:8, John 6:49, John 7:24, John 10:26, John 10:27, Acts 10:26, Acts 16:2, Romans 4:22, 1 Corinthians 1:6, Galatians 5:18, Ephesians 1:23, Ephesians 5:15, Philippians 2:29, 2 Timothy 4:15, Hebrews 4:9, James 2:17, 1 Peter 5:7, Revelation 14:5, Genesis 10:29, Genesis 13:2, Genesis 22:21, Genesis 25:7, Genesis 31:6, Genesis 42:26, Exodus 6:28, Exodus 8:14, Exodus 14:14, Exodus 21:12, Exodus 36:28, Exodus 37:24, Leviticus 1:6, Leviticus 14:54, Numbers 6:26, Numbers 12:7, Numbers 14:20, Numbers 16:43, Numbers 22:39, Numbers 33:23, Deuteronomy 1:34, Deuteronomy 5:20, Deuteronomy 22:18, Deuteronomy 25:12, Deuteronomy 32:40, Joshua 4:17, Joshua 19:2, Joshua 21:14, Joshua 24:28, Judges 9:12, 2 Samuel 13:21, 2 Samuel 20:25, 2 Samuel 22:29, 1 Kings 21:28, 1 Chronicles 1:23, 1 Chronicles 4:5, 1 Chronicles 6:21, 1 Chronicles 6:73, 1 Chronicles 6:75, 1 Chronicles 11:34, 1 Chronicles 16:22, 1 Chronicles 21:7, 1 Chronicles 25:14, 1 Chronicles 29:13, 2 Chronicles 29:33, Job 3:7, Job 6:12, Job 7:12, Job 12:12, Job 12:17, Job 13:7, Job 21:32, Job 22:25, Job 38:2, Job 38:28, Job 41:2, Psalms 8:9, Psalms 11:3, Psalms 30:6, Psalms 48:3, Psalms 49:8, Psalms 54:1, Psalms 56:11, Psalms 69:11, Psalms 78:11, Psalms 80:3, Psalms 83:6, Psalms 83:10, Psalms 91:16, Psalms 95:3, Psalms 97:3, Psalms 99:5, Psalms 102:11, Psalms 103:9, Psalms 104:27, Psalms 105:15, Psalms 105:34, Psalms 105:42, Psalms 106:34, Psalms 106:37, Psalms 107:37, Psalms 116:15, Psalms 118:8, Psalms 119:20, Psalms 119:38, Psalms 119:39, Psalms 119:55, Psalms 119:70, Psalms 119:126, Psalms 119:129, Psalms 119:151, Psalms 120:2, Psalms 121:1, Psalms 121:7, Psalms 147:15, Psalms 150:3, Proverbs 2:11, Proverbs 7:19, Proverbs 8:1, Proverbs 8:4, Proverbs 24:10, Proverbs 26:14, Proverbs 31:29, Ecclesiastes 8:2, Song of Solomon 2:16, Isaiah 2:5, Isaiah 18:1, Isaiah 23:14, Isaiah 44:1, Jeremiah 5:2, Jeremiah 8:18, Jeremiah 10:1, Jeremiah 42:7, Lamentations 3:2, Lamentations 3:20, Ezekiel 42:18, Ezekiel 45:10, Daniel 2:33, Habakkuk 3:5, Matthew 4:2, Matthew 20:11, Matthew 26:72, Mark 7:20, Mark 9:48, Mark 11:6, Mark 12:11, Mark 14:57, Luke 1:40, Luke 2:50, Luke 6:5, Luke 6:46, Luke 8:54, Luke 11:25, Luke 14:30, Luke 22:65, Luke 23:37, Luke 23:54, John 1:16, John 4:37, John 7:48, John 9:36, John 12:30, John 13:13, John 14:25, Acts 5:18, Acts 7:28, Acts 10:8, Acts 18:20, Acts 19:41, Romans 4:21, Romans 15:10, 1 Corinthians 4:20, 1 Corinthians 6:8, 1 Corinthians 6:17, 1 Corinthians 10:2, 1 Corinthians 10:32, 1 Corinthians 11:30, 1 Corinthians 15:8, 2 Corinthians 4:9, Galatians 6:2, Philippians 1:24, Philippians 2:21, Philippians 2:24, Philippians 4:2, Colossians 2:3, 2 Timothy 1:11, Hebrews 3:19, Revelation 9:12, Genesis 2:25, Genesis 5:5, Genesis 9:4, Genesis 9:20, Genesis 27:2, Genesis 32:27, Genesis 34:31, Genesis 36:11, Genesis 38:27, Genesis 49:12, Exodus 29:45, Leviticus 22:31, Numbers 12:13, Numbers 20:25, Numbers 21:17, Numbers 22:9, Numbers 26:34, Numbers 33:32, Deuteronomy 22:13, Deuteronomy 23:22, Deuteronomy 25:4, Deuteronomy 29:14, Joshua 6:27, Joshua 15:44, Joshua 19:30, Ruth 4:18, 1 Samuel 9:15, 1 Samuel 17:29, 1 Samuel 30:27, 2 Samuel 1:27, 2 Samuel 11:18, 2 Samuel 13:38, 1 Kings 2:18, 1 Kings 9:18, 1 Kings 21:17, 1 Chronicles 2:30, 1 Chronicles 3:18, 1 Chronicles 4:35, 1 Chronicles 6:36, 1 Chronicles 7:32, 1 Chronicles 9:36, 1 Chronicles 15:4, 1 Chronicles 16:11, 1 Chronicles 24:22, 1 Chronicles 24:27, 1 Chronicles 25:20, 2 Chronicles 24:3, Ezra 2:36, Ezra 8:14, Nehemiah 10:10, Nehemiah 12:32, Job 3:22, Job 5:2, Job 11:9, Job 15:17, Job 17:13, Job 18:3, Job 21:5, Job 21:6, Job 22:5, Job 26:11, Job 33:33, Job 34:15, Job 34:35, Job 36:20, Job 37:8, Job 39:29, Job 40:24, Psalms 3:5, Psalms 25:21, Psalms 26:6, Psalms 34:13, Psalms 54:4, Psalms 56:10, Psalms 61:3, Psalms 70:3, Psalms 71:5, Psalms 85:13, Psalms 92:5, Psalms 95:11, Psalms 99:2, Psalms 103:21, Psalms 105:4, Psalms 105:23, Psalms 106:35, Psalms 113:8, Psalms 119:15, Psalms 119:24, Psalms 119:35, Psalms 119:36, Psalms 119:142, Psalms 119:166, Psalms 119:174, Psalms 128:1, Psalms 132:2, Psalms 148:8, Proverbs 1:16, Proverbs 4:26, Proverbs 5:5, Proverbs 6:14, Proverbs 18:9, Proverbs 20:26, Proverbs 23:4, Proverbs 23:16, Proverbs 23:26, Proverbs 30:24, Song of Solomon 2:2, Song of Solomon 3:9, Song of Solomon 6:7, Isaiah 1:22, Isaiah 22:20, Lamentations 3:42, Lamentations 3:56, Lamentations 3:60, Ezekiel 3:16, Ezekiel 27:28, Hosea 13:12, Zephaniah 3:1, Matthew 10:31, Matthew 14:1, Matthew 15:7, Matthew 23:24, Matthew 24:47, Matthew 26:6, Mark 10:9, Mark 12:3, Luke 1:54, Luke 2:5, Luke 2:18, Luke 10:5, Luke 11:54, Luke 12:44, Luke 20:45, John 1:37, John 4:31, John 6:47, John 6:67, John 8:32, John 15:17, Acts 8:2, Acts 9:43, Acts 11:7, Acts 19:11, Acts 23:4, Acts 24:3, Romans 5:4, 1 Corinthians 2:3, 1 Corinthians 6:20, 1 Corinthians 12:27, 1 Corinthians 16:13, 2 Corinthians 3:4, 2 Corinthians 10:9, Galatians 5:23, Ephesians 5:13, Colossians 3:3, 1 Timothy 4:2, Hebrews 10:3, 1 John 5:8, Revelation 6:17, Revelation 16:20, Genesis 19:36, Genesis 21:34, Genesis 23:7, Genesis 25:2, Genesis 39:16, Genesis 41:47, Genesis 49:14, Exodus 1:6, Exodus 1:8, Exodus 21:17, Exodus 23:10, Exodus 25:13, Exodus 38:6, Exodus 39:36, Exodus 40:26, Leviticus 9:11, Leviticus 11:16, Leviticus 11:20, Leviticus 20:8, Leviticus 25:43, Numbers 3:14, Numbers 14:32, Numbers 24:5, Numbers 33:17, Numbers 33:46, Deuteronomy 4:4, Deuteronomy 14:4, Deuteronomy 14:15, Deuteronomy 19:16, Joshua 18:24, Joshua 19:7, Joshua 19:46, Judges 2:13, 2 Samuel 22:2, 2 Samuel 23:2, 1 Kings 3:19, 1 Chronicles 5:19, 1 Chronicles 6:81, 1 Chronicles 7:31, 1 Chronicles 7:35, 1 Chronicles 12:5, 1 Chronicles 12:6, 1 Chronicles 12:27, 1 Chronicles 21:25, 1 Chronicles 24:26, 2 Chronicles 12:14, Ezra 1:10, Ezra 4:18, Nehemiah 7:52, Job 3:11, Job 9:6, Job 9:18, Job 14:1, Job 15:12, Job 15:18, Job 18:11, Job 28:6, Job 29:8, Job 29:21, Job 33:16, Job 34:2, Job 34:26, Job 36:22, Job 37:14, Job 38:40, Job 39:23, Job 41:14, Job 41:19, Psalms 25:11, Psalms 25:18, Psalms 30:2, Psalms 37:29, Psalms 46:1, Psalms 49:1, Psalms 57:8, Psalms 66:8, Psalms 66:17, Psalms 71:1, Psalms 71:7, Psalms 75:5, Psalms 77:4, Psalms 77:12, Psalms 97:4, Psalms 104:22, Psalms 105:21, Psalms 105:29, Psalms 106:46, Psalms 107:24, Psalms 115:9, Psalms 118:6, Psalms 119:52, Psalms 119:54, Psalms 119:67, Psalms 119:127, Psalms 119:131, Psalms 119:134, Psalms 119:170, Psalms 119:171, Psalms 120:4, Psalms 124:8, Psalms 129:3, Psalms 134:3, Psalms 136:20, Proverbs 1:2, Proverbs 2:15, Proverbs 3:8, Proverbs 3:17, Proverbs 5:14, Proverbs 5:17, Proverbs 7:1, Proverbs 9:17, Proverbs 23:27, Proverbs 23:30, Proverbs 31:1, Ecclesiastes 1:1, Ecclesiastes 11:7, Song of Solomon 2:6, Song of Solomon 4:7, Song of Solomon 8:3, Isaiah 3:25, Isaiah 10:21, Isaiah 13:1, Jeremiah 23:23, Jeremiah 48:3, Lamentations 3:17, Lamentations 3:58, Lamentations 5:14, Ezekiel 16:32, Ezekiel 19:13, Ezekiel 23:2, Ezekiel 28:3, Ezekiel 44:26, Daniel 5:27, Hosea 13:11, Zechariah 2:7, Matthew 5:41, Matthew 6:12, Matthew 8:1, Matthew 8:30, Matthew 13:37, Matthew 14:17, Matthew 17:11, Matthew 22:19, Matthew 22:40, Matthew 27:59, Mark 2:3, Mark 9:27, Luke 2:6, Luke 13:20, Luke 18:28, Luke 20:3, Luke 24:34, John 1:8, John 1:35, John 4:19, John 6:6, John 6:36, John 7:21, John 12:33, John 16:11, Acts 8:29, Acts 11:27, Acts 19:14, Acts 20:8, Acts 21:17, Romans 1:15, Romans 10:13, Romans 11:5, 1 Corinthians 6:14, 1 Corinthians 7:20, 1 Corinthians 9:26, 1 Corinthians 10:15, 1 Corinthians 10:22, 1 Corinthians 13:6, 1 Corinthians 15:18, 1 Corinthians 15:55, 2 Corinthians 2:1, Galatians 3:25, Galatians 5:7, Ephesians 4:3, Hebrews 10:15, Hebrews 10:31, 1 John 4:11, Revelation 2:15, Revelation 21:26, Genesis 16:16, Genesis 17:22, Genesis 18:17, Genesis 40:23, Genesis 42:14, Genesis 43:20, Exodus 12:40, Exodus 21:15, Exodus 31:4, Exodus 34:8, Leviticus 8:6, Numbers 6:25, Numbers 13:25, Numbers 35:13, Deuteronomy 1:32, Deuteronomy 4:41, Deuteronomy 6:6, Deuteronomy 30:15, Joshua 19:6, Joshua 24:21, Judges 12:13, 1 Samuel 2:7, 1 Samuel 10:15, 1 Samuel 25:4, 2 Samuel 22:48, 1 Kings 4:8, 1 Kings 4:9, 1 Kings 18:11, 1 Kings 21:12, 1 Chronicles 1:39, 1 Chronicles 3:20, 1 Chronicles 5:4, 1 Chronicles 6:68, 1 Chronicles 15:9, 1 Chronicles 25:25, Job 3:1, Job 5:18, Job 12:21, Job 14:4, Job 14:11, Job 16:16, Job 19:2, Job 19:14, Job 20:2, Job 20:4, Job 21:7, Job 21:9, Job 22:21, Job 23:4, Job 30:14, Job 31:24, Job 32:10, Job 33:31, Job 34:8, Job 41:3, Psalms 17:5, Psalms 18:16, Psalms 18:32, Psalms 20:4, Psalms 22:28, Psalms 25:16, Psalms 27:7, Psalms 33:21, Psalms 47:7, Psalms 51:2, Psalms 68:14, Psalms 69:25, Psalms 70:1, Psalms 73:23, Psalms 77:20, Psalms 78:23, Psalms 80:11, Psalms 82:7, Psalms 88:1, Psalms 88:16, Psalms 89:22, Psalms 89:25, Psalms 94:11, Psalms 96:1, Psalms 102:22, Psalms 104:34, Psalms 109:27, Psalms 118:14, Psalms 118:22, Psalms 119:18, Psalms 119:25, Psalms 119:26, Psalms 119:31, Psalms 130:3, Psalms 131:3, Psalms 136:18, Psalms 140:1, Psalms 141:10, Psalms 145:17, Psalms 147:2, Psalms 147:6, Psalms 147:19, Psalms 150:6, Proverbs 3:22, Proverbs 3:31, Proverbs 5:2, Proverbs 8:18, Proverbs 8:35, Proverbs 15:1, Proverbs 15:22, Proverbs 16:31, Proverbs 18:16, Proverbs 20:12, Proverbs 21:4, Proverbs 24:32, Proverbs 30:3, Proverbs 30:18, Isaiah 10:31, Isaiah 14:18, Isaiah 28:23, Isaiah 30:4, Isaiah 43:15, Isaiah 43:18, Jeremiah 5:16, Jeremiah 13:5, Jeremiah 17:17, Jeremiah 48:6, Lamentations 3:1, Lamentations 3:15, Lamentations 3:33, Lamentations 5:3, Ezekiel 11:25, Hosea 4:11, Hosea 13:5, Jonah 3:1, Haggai 1:5, Matthew 13:51, Matthew 14:34, Matthew 25:5, Matthew 26:67, Matthew 26:68, Mark 1:25, Mark 3:16, Mark 5:10, Mark 14:29, Luke 9:2, Luke 9:4, Luke 9:40, Luke 11:40, Luke 17:17, Luke 18:27, Luke 19:45, Luke 21:22, Luke 23:6, Luke 24:52, John 3:35, John 4:49, John 5:22, John 5:46, John 7:44, John 8:17, John 12:10, John 13:22, Acts 2:44, Acts 5:33, Acts 7:15, Acts 13:18, Acts 13:52, Acts 21:36, Acts 24:13, Acts 28:24, Romans 14:7, 1 Corinthians 15:11, 1 Corinthians 15:16, Galatians 1:2, Galatians 3:4, Galatians 3:7, Ephesians 2:18, Ephesians 6:10, Philippians 2:5, Colossians 3:23, 1 Timothy 2:3, 1 Timothy 3:9, 1 Timothy 6:8, Titus 3:6, Philemon 1:24, Hebrews 6:15, Hebrews 10:6, 1 John 1:4, 1 John 4:8, Revelation 9:8, Revelation 22:4, Genesis 4:13, Genesis 7:10, Genesis 13:13, Genesis 15:21, Genesis 17:18, Genesis 19:6, Genesis 23:1, Genesis 27:44, Genesis 31:2, Genesis 36:26, Genesis 38:4, Genesis 40:22, Genesis 42:31, Genesis 49:20, Exodus 7:6, Exodus 26:15, Exodus 26:28, Exodus 37:28, Exodus 40:11, Leviticus 22:28, Leviticus 24:18, Leviticus 27:4, Numbers 4:40, Numbers 5:16, Numbers 26:16, Numbers 28:16, Numbers 28:22, Numbers 29:5, Numbers 31:31, Numbers 34:20, Deuteronomy 16:22, Deuteronomy 32:31, Deuteronomy 32:33, Deuteronomy 33:22, Joshua 9:2, Joshua 10:16, Joshua 15:59, Judges 9:10, Judges 15:20, Judges 20:44, 1 Samuel 1:12, 1 Samuel 8:13, 1 Samuel 15:31, 1 Samuel 18:24, 1 Samuel 30:31, 2 Samuel 22:17, 2 Samuel 22:32, 2 Samuel 22:46, 2 Kings 14:12, 2 Kings 25:2, 1 Chronicles 3:16, 1 Chronicles 4:36, 1 Chronicles 5:12, 1 Chronicles 6:17, 1 Chronicles 6:24, 1 Chronicles 6:69, 1 Chronicles 8:9, 1 Chronicles 15:5, 1 Chronicles 15:7, 1 Chronicles 16:9, 1 Chronicles 23:8, 1 Chronicles 24:25, 1 Chronicles 25:21, 1 Chronicles 25:22, 1 Chronicles 25:23, 1 Chronicles 25:27, 2 Chronicles 2:13, 2 Chronicles 25:22, Nehemiah 3:22, Nehemiah 7:62, Nehemiah 10:14, Nehemiah 12:11, Esther 9:6, Job 4:14, Job 5:8, Job 7:15, Job 8:3, Job 10:5, Job 11:4, Job 12:13, Job 16:2, Job 16:17, Job 18:6, Job 19:18, Job 21:3, Job 32:17, Job 33:10, Job 34:18, Job 38:38, Job 41:21, Psalms 18:45, Psalms 22:4, Psalms 33:9, Psalms 33:13, Psalms 34:3, Psalms 35:9, Psalms 35:22, Psalms 40:8, Psalms 40:13, Psalms 52:6, Psalms 55:13, Psalms 67:6, Psalms 69:18, Psalms 76:6, Psalms 78:18, Psalms 81:2, Psalms 85:7, Psalms 86:1, Psalms 88:3, Psalms 89:13, Psalms 90:12, Psalms 92:3, Psalms 93:2, Psalms 94:6, Psalms 102:14, Psalms 102:23, Psalms 104:21, Psalms 105:2, Psalms 105:17, Psalms 106:30, Psalms 107:29, Psalms 109:3, Psalms 109:26, Psalms 116:14, Psalms 116:18, Psalms 118:3, Psalms 118:9, Psalms 118:13, Psalms 119:82, Psalms 123:1, Psalms 124:6, Psalms 132:1, Psalms 133:1, Psalms 137:5, Psalms 139:23, Psalms 140:2, Psalms 142:2, Psalms 145:2, Psalms 145:16, Proverbs 2:18, Proverbs 4:20, Proverbs 4:21, Proverbs 6:8, Proverbs 6:12, Proverbs 6:17, Proverbs 7:20, Proverbs 8:14, Proverbs 14:23, Proverbs 16:3, Proverbs 17:17, Proverbs 18:6, Proverbs 18:7, Proverbs 20:9, Proverbs 23:25, Proverbs 24:2, Ecclesiastes 7:22, Isaiah 14:15, Isaiah 16:13, Isaiah 24:7, Isaiah 32:12, Isaiah 38:2, Isaiah 41:6, Jeremiah 6:30, Jeremiah 8:20, Jeremiah 13:24, Jeremiah 14:11, Jeremiah 52:5, Lamentations 3:5, Lamentations 3:16, Lamentations 3:38, Lamentations 3:47, Lamentations 3:61, Lamentations 3:65, Lamentations 5:8, Ezekiel 28:21, Amos 5:4, Jonah 2:1, Haggai 1:3, Zechariah 11:1, Matthew 2:10, Matthew 4:14, Matthew 4:22, Matthew 9:1, Matthew 9:31, Matthew 11:4, Matthew 11:14, Matthew 13:1, Matthew 15:1, Matthew 15:38, Matthew 22:20, Matthew 24:35, Matthew 28:4, Mark 5:6, Mark 6:32, Mark 8:9, Mark 10:10, Mark 11:12, Mark 12:22, Mark 13:31, Luke 5:32, Luke 7:18, Luke 8:31, Luke 10:26, Luke 12:31, Luke 14:25, Luke 15:5, Luke 20:12, Luke 21:33, Luke 24:40, John 4:2, John 5:3, John 5:5, John 6:8, John 10:19, John 10:23, John 10:37, John 10:39, John 17:7, Romans 4:8, Romans 7:10, Romans 12:7, Romans 12:11, Romans 15:2, 1 Corinthians 1:14, 1 Corinthians 5:13, 1 Corinthians 11:20, 2 Corinthians 6:5, 2 Corinthians 12:4, Galatians 6:11, Ephesians 6:7, Philippians 4:22, Colossians 1:17, Colossians 2:6, 1 Thessalonians 4:5, Titus 2:4, James 4:16, 1 Peter 1:9, 1 Peter 3:13, Revelation 11:14, Genesis 13:5, Genesis 23:3, Genesis 25:32, Genesis 35:21, Genesis 36:38, Exodus 18:17, Exodus 25:8, Exodus 35:32, Exodus 36:20, Exodus 38:29, Leviticus 3:12, Leviticus 13:40, Leviticus 25:13, Numbers 9:2, Numbers 19:15, Numbers 21:21, Numbers 26:28, Numbers 26:43, Numbers 32:36, Numbers 33:12, Numbers 34:22, Deuteronomy 1:9, Deuteronomy 18:17, Deuteronomy 32:9, 1 Samuel 1:25, 1 Samuel 15:5, 1 Samuel 20:39, 2 Samuel 14:23, 1 Kings 2:14, 2 Kings 6:7, 1 Chronicles 7:25, 1 Chronicles 12:24, 1 Chronicles 15:6, 1 Chronicles 16:13, 1 Chronicles 25:26, 1 Chronicles 25:28, 2 Chronicles 34:19, Ezra 10:28, Nehemiah 7:39, Nehemiah 11:6, Job 3:15, Job 8:17, Job 9:33, Job 9:35, Job 12:18, Job 13:14, Job 18:12, Job 19:9, Job 22:19, Job 26:9, Job 29:4, Job 31:30, Job 34:21, Job 36:14, Job 36:27, Job 41:29, Psalms 2:10, Psalms 7:3, Psalms 9:17, Psalms 10:12, Psalms 13:6, Psalms 14:6, Psalms 18:27, Psalms 18:31, Psalms 19:2, Psalms 19:3, Psalms 37:26, Psalms 39:9, Psalms 47:1, Psalms 48:6, Psalms 50:9, Psalms 55:8, Psalms 56:2, Psalms 60:9, Psalms 67:3, Psalms 67:5, Psalms 68:29, Psalms 71:14, Psalms 73:10, Psalms 73:18, Psalms 73:19, Psalms 74:6, Psalms 78:47, Psalms 81:1, Psalms 83:16, Psalms 85:6, Psalms 89:35, Psalms 94:8, Psalms 95:5, Psalms 97:11, Psalms 100:2, Psalms 103:7, Psalms 104:26, Psalms 105:39, Psalms 106:13, Psalms 106:21, Psalms 108:10, Psalms 109:4, Psalms 109:23, Psalms 114:5, Psalms 115:8, Psalms 118:10, Psalms 119:14, Psalms 119:16, Psalms 119:19, Psalms 119:30, Psalms 119:45, Psalms 119:62, Psalms 119:156, Psalms 122:6, Psalms 135:18, Psalms 143:9, Psalms 148:4, Psalms 149:5, Proverbs 2:12, Proverbs 2:14, Proverbs 7:3, Proverbs 7:13, Proverbs 9:6, Proverbs 9:15, Proverbs 11:17, Proverbs 15:7, Proverbs 16:18, Proverbs 18:13, Proverbs 20:14, Proverbs 23:14, Proverbs 25:11, Proverbs 26:19, Proverbs 29:12, Proverbs 31:19, Ecclesiastes 6:11, Ecclesiastes 10:6, Song of Solomon 1:12, Song of Solomon 5:10, Song of Solomon 5:11, Isaiah 24:12, Isaiah 39:5, Jeremiah 14:1, Jeremiah 41:4, Lamentations 5:5, Lamentations 5:7, Lamentations 5:16, Ezekiel 7:25, Ezekiel 14:1, Ezekiel 24:26, Daniel 2:36, Hosea 10:7, Jonah 1:1, Matthew 5:27, Matthew 5:48, Matthew 6:9, Matthew 6:10, Matthew 8:6, Matthew 17:7, Matthew 17:16, Matthew 21:4, Matthew 21:18, Matthew 22:33, Matthew 22:39, Matthew 24:37, Matthew 24:40, Matthew 25:3, Matthew 27:30, Matthew 28:3, Mark 1:37, Mark 3:24, Mark 4:40, Mark 5:28, Mark 7:23, Mark 13:5, Mark 15:38, Mark 15:47, Luke 1:57, Luke 2:33, Luke 3:38, Luke 7:50, Luke 9:21, Luke 9:46, Luke 10:18, Luke 22:43, Luke 23:36, Luke 23:42, John 9:13, John 12:8, John 15:9, John 17:18, John 21:21, Acts 2:8, Acts 7:18, Acts 10:5, Acts 10:12, Acts 11:10, Acts 15:41, Acts 19:5, Acts 23:26, Romans 7:17, Romans 12:12, Romans 12:18, 1 Corinthians 15:22, 1 Corinthians 15:25, 2 Corinthians 6:11, 2 Corinthians 11:30, Ephesians 4:26, Philippians 3:7, Philippians 4:5, Philippians 4:16, 1 Thessalonians 4:2, 1 Timothy 5:12, Hebrews 3:7, Hebrews 4:5, Hebrews 7:7, Hebrews 12:12, 1 Peter 2:17, 1 John 3:3, Genesis 5:32, Genesis 10:8, Genesis 11:26, Genesis 21:5, Genesis 27:26, Genesis 30:11, Genesis 37:12, Genesis 38:6, Genesis 42:8, Exodus 23:6, Exodus 25:16, Exodus 30:5, Exodus 35:12, Exodus 40:27, Leviticus 26:11, Numbers 7:6, Numbers 8:6, Numbers 20:9, Numbers 26:18, Numbers 26:27, Numbers 32:10, Numbers 33:5, Deuteronomy 1:18, Deuteronomy 11:7, Deuteronomy 32:34, Deuteronomy 32:45, Joshua 7:10, Joshua 8:23, Joshua 10:15, Joshua 19:35, Ruth 1:10, 1 Samuel 1:10, 1 Samuel 2:4, 1 Samuel 2:12, 1 Samuel 8:17, 1 Samuel 20:4, 2 Samuel 6:1, 2 Samuel 22:6, 2 Samuel 22:11, 1 Kings 8:3, 2 Kings 13:22, 1 Chronicles 1:10, 1 Chronicles 2:27, 1 Chronicles 4:11, 1 Chronicles 6:79, 1 Chronicles 7:12, 1 Chronicles 15:19, 1 Chronicles 16:16, 1 Chronicles 21:1, 2 Chronicles 5:4, 2 Chronicles 7:4, 2 Chronicles 9:28, Ezra 2:6, Ezra 8:6, Nehemiah 7:11, Job 9:7, Job 9:26, Job 13:17, Job 13:22, Job 16:18, Job 17:11, Job 18:7, Job 18:10, Job 18:18, Job 19:11, Job 25:2, Job 27:16, Job 28:2, Job 28:22, Job 30:7, Job 30:17, Job 30:30, Job 31:10, Job 33:20, Job 33:22, Job 33:29, Job 38:8, Psalms 2:3, Psalms 2:4, Psalms 17:12, Psalms 18:5, Psalms 19:12, Psalms 22:11, Psalms 35:16, Psalms 37:32, Psalms 38:8, Psalms 44:21, Psalms 47:5, Psalms 49:12, Psalms 57:2, Psalms 59:15, Psalms 62:5, Psalms 73:4, Psalms 73:8, Psalms 73:17, Psalms 78:3, Psalms 78:25, Psalms 83:7, Psalms 83:13, Psalms 94:3, Psalms 101:4, Psalms 102:3, Psalms 103:6, Psalms 103:18, Psalms 105:9, Psalms 105:22, Psalms 105:30, Psalms 106:11, Psalms 106:33, Psalms 107:7, Psalms 108:12, Psalms 116:6, Psalms 118:20, Psalms 118:21, Psalms 119:49, Psalms 119:56, Psalms 119:135, Psalms 119:153, Psalms 119:173, Psalms 121:5, Psalms 132:7, Psalms 135:12, Psalms 135:16, Psalms 149:7, Proverbs 2:19, Proverbs 5:9, Proverbs 6:13, Proverbs 7:6, Proverbs 7:9, Proverbs 7:27, Proverbs 8:17, Proverbs 8:32, Proverbs 10:22, Proverbs 13:21, Proverbs 14:9, Proverbs 14:10, Proverbs 14:34, Proverbs 15:12, Proverbs 16:9, Proverbs 21:14, Proverbs 21:30, Proverbs 22:20, Proverbs 23:12, Proverbs 24:3, Proverbs 30:28, Ecclesiastes 1:3, Ecclesiastes 2:2, Ecclesiastes 3:20, Song of Solomon 1:13, Isaiah 9:8, Isaiah 14:5, Isaiah 26:4, Isaiah 40:18, Isaiah 44:10, Jeremiah 4:21, Jeremiah 10:17, Jeremiah 25:19, Jeremiah 28:17, Jeremiah 29:5, Jeremiah 29:13, Jeremiah 46:7, Lamentations 3:51, Lamentations 3:64, Lamentations 5:1, Lamentations 5:4, Ezekiel 7:5, Hosea 12:7, Matthew 5:9, Matthew 10:7, Matthew 17:8, Matthew 20:24, Matthew 21:39, Matthew 22:22, Matthew 23:7, Matthew 24:48, Matthew 27:18, Mark 7:8, Mark 9:32, Mark 10:20, Mark 11:16, Mark 12:8, Mark 12:27, Mark 15:23, Luke 1:12, Luke 2:42, Luke 12:41, Luke 19:18, Luke 20:39, Luke 21:35, Luke 22:21, Luke 23:1, Luke 24:3, John 7:20, John 12:22, John 12:41, John 16:1, John 17:10, Acts 9:9, Acts 13:49, Acts 19:20, Romans 2:17, Romans 12:9, Romans 12:13, Romans 16:9, 2 Corinthians 5:2, Galatians 2:19, Galatians 3:27, 2 Thessalonians 2:17, 1 Timothy 5:7, 2 Timothy 3:17, Hebrews 11:18, James 1:3, James 2:15, James 2:24, 2 John 1:2, Genesis 3:9, Genesis 4:24, Genesis 9:21, Genesis 10:14, Genesis 15:6, Genesis 15:8, Genesis 21:11, Genesis 30:7, Genesis 34:6, Genesis 35:13, Genesis 36:22, Genesis 42:10, Genesis 47:10, Genesis 49:2, Genesis 49:5, Genesis 49:32, Genesis 50:19, Exodus 10:27, Exodus 30:19, Leviticus 18:22, Leviticus 26:3, Numbers 10:13, Numbers 12:9, Numbers 23:28, Numbers 26:7, Numbers 31:40, Deuteronomy 12:24, Deuteronomy 14:19, 1 Samuel 19:14, 1 Samuel 23:29, 2 Samuel 15:9, 2 Samuel 22:14, 1 Kings 13:19, 2 Kings 9:4, 1 Chronicles 1:12, 1 Chronicles 1:49, 1 Chronicles 2:47, 1 Chronicles 2:51, 1 Chronicles 4:26, 1 Chronicles 6:22, 1 Chronicles 6:59, 1 Chronicles 16:20, 2 Chronicles 14:2, 2 Chronicles 31:9, Ezra 2:58, Nehemiah 7:60, Job 6:21, Job 6:28, Job 9:31, Job 13:13, Job 13:21, Job 16:3, Job 16:7, Job 18:2, Job 18:8, Job 24:21, Job 31:5, Job 35:10, Job 39:30, Job 40:9, Job 40:20, Job 41:7, Job 41:15, Psalms 1:4, Psalms 7:11, Psalms 10:16, Psalms 16:2, Psalms 22:13, Psalms 26:7, Psalms 33:15, Psalms 33:22, Psalms 36:9, Psalms 37:12, Psalms 40:1, Psalms 44:15, Psalms 55:7, Psalms 60:11, Psalms 62:1, Psalms 69:10, Psalms 72:9, Psalms 73:14, Psalms 76:2, Psalms 78:41, Psalms 83:14, Psalms 84:8, Psalms 89:9, Psalms 89:23, Psalms 94:2, Psalms 98:8, Psalms 105:13, Psalms 105:16, Psalms 105:27, Psalms 105:43, Psalms 106:15, Psalms 106:22, Psalms 107:33, Psalms 107:42, Psalms 111:2, Psalms 113:4, Psalms 115:13, Psalms 119:28, Psalms 119:61, Psalms 119:101, Psalms 119:106, Psalms 119:109, Psalms 119:122, Psalms 129:1, Psalms 135:19, Psalms 136:19, Psalms 145:9, Psalms 147:9, Proverbs 3:2, Proverbs 3:4, Proverbs 4:17, Proverbs 4:24, Proverbs 5:12, Proverbs 5:15, Proverbs 5:18, Proverbs 10:14, Proverbs 13:15, Proverbs 16:27, Proverbs 17:23, Proverbs 21:23, Proverbs 21:25, Proverbs 22:26, Proverbs 23:11, Proverbs 26:28, Proverbs 30:6, Proverbs 30:21, Ecclesiastes 2:4, Ecclesiastes 2:6, Isaiah 1:19, Isaiah 2:9, Isaiah 2:14, Isaiah 3:13, Isaiah 13:7, Isaiah 14:7, Isaiah 26:6, Isaiah 46:8, Isaiah 49:14, Jeremiah 6:2, Jeremiah 17:7, Jeremiah 30:4, Lamentations 3:4, Lamentations 3:18, Lamentations 3:19, Ezekiel 43:4, Daniel 1:14, Daniel 5:28, Joel 2:15, Amos 7:3, Habakkuk 3:15, Matthew 13:53, Matthew 14:7, Matthew 21:37, Matthew 22:15, Matthew 23:20, Matthew 24:18, Matthew 25:33, Matthew 26:1, Matthew 26:30, Matthew 27:8, Matthew 27:10, Mark 5:8, Mark 6:39, Mark 10:6, Mark 13:16, Mark 14:26, Mark 16:13, Luke 1:34, Luke 2:19, Luke 3:18, Luke 11:16, Luke 13:3, Luke 15:26, Luke 23:10, Luke 24:37, John 1:34, John 6:59, John 10:13, John 11:3, John 12:14, John 13:24, John 15:3, John 19:16, Acts 3:19, Acts 20:12, Acts 20:27, Acts 21:23, Acts 22:1, Acts 26:8, Acts 26:27, Romans 7:24, Romans 8:25, Romans 10:17, Romans 14:18, Romans 15:17, 1 Corinthians 4:2, 1 Corinthians 16:4, 1 Corinthians 16:16, 2 Corinthians 5:9, 2 Corinthians 12:17, 2 Corinthians 13:8, Colossians 1:15, Colossians 3:21, 1 Timothy 5:2, 2 Timothy 2:5, Hebrews 9:18, 1 John 5:17, Genesis 2:12, Genesis 9:14, Genesis 22:15, Genesis 25:28, Genesis 33:6, Genesis 36:33, Genesis 43:17, Genesis 46:16, Exodus 2:4, Exodus 4:17, Exodus 15:5, Exodus 15:24, Exodus 16:17, Exodus 22:12, Exodus 25:4, Exodus 35:6, Exodus 37:23, Leviticus 12:3, Leviticus 19:30, Leviticus 26:2, Leviticus 27:13, Numbers 11:9, Numbers 25:9, Numbers 26:47, Numbers 31:11, Numbers 33:15, Deuteronomy 3:9, Deuteronomy 23:12, Deuteronomy 25:17, Deuteronomy 33:14, Joshua 10:43, Judges 3:11, Judges 8:17, Judges 9:14, Judges 17:1, 1 Samuel 13:23, 1 Samuel 17:21, 1 Samuel 22:21, 1 Samuel 25:12, 2 Samuel 5:18, 2 Samuel 6:23, 2 Samuel 15:33, 2 Samuel 22:35, 1 Chronicles 1:44, 1 Chronicles 1:51, 1 Chronicles 9:24, 1 Chronicles 15:10, 1 Chronicles 16:21, 1 Chronicles 25:29, 1 Chronicles 25:30, 1 Chronicles 26:23, 2 Chronicles 35:19, Ezra 2:60, Ezra 8:9, Ezra 10:21, Nehemiah 5:19, Esther 4:17, Job 3:25, Job 3:26, Job 5:3, Job 6:8, Job 7:7, Job 7:10, Job 9:25, Job 13:8, Job 13:11, Job 13:18, Job 13:20, Job 14:8, Job 15:19, Job 16:14, Job 18:17, Job 22:11, Job 30:19, Job 31:6, Job 31:17, Job 32:4, Job 32:15, Job 32:20, Job 33:32, Job 37:18, Job 38:9, Job 38:31, Job 39:19, Job 41:8, Psalms 3:8, Psalms 6:1, Psalms 18:34, Psalms 22:7, Psalms 25:9, Psalms 25:17, Psalms 26:4, Psalms 26:5, Psalms 31:16, Psalms 34:2, Psalms 36:12, Psalms 37:1, Psalms 38:1, Psalms 38:2, Psalms 39:10, Psalms 42:1, Psalms 46:7, Psalms 46:11, Psalms 47:4, Psalms 48:14, Psalms 59:8, Psalms 59:9, Psalms 64:3, Psalms 65:3, Psalms 66:9, Psalms 66:10, Psalms 66:11, Psalms 68:32, Psalms 71:8, Psalms 73:6, Psalms 74:15, Psalms 77:3, Psalms 78:29, Psalms 78:59, Psalms 78:66, Psalms 80:9, Psalms 81:3, Psalms 82:8, Psalms 83:5, Psalms 88:13, Psalms 89:20, Psalms 89:30, Psalms 94:19, Psalms 105:14, Psalms 105:19, Psalms 106:18, Psalms 106:24, Psalms 106:25, Psalms 106:44, Psalms 107:4, Psalms 107:16, Psalms 112:6, Psalms 113:2, Psalms 115:17, Psalms 116:13, Psalms 118:17, Psalms 119:50, Psalms 119:51, Psalms 119:103, Psalms 119:121, Psalms 119:154, Psalms 119:155, Psalms 122:9, Psalms 124:1, Psalms 127:4, Psalms 136:8, Psalms 136:24, Psalms 143:4, Psalms 145:11, Proverbs 1:29, Proverbs 2:4, Proverbs 2:13, Proverbs 3:7, Proverbs 3:21, Proverbs 3:34, Proverbs 5:4, Proverbs 5:8, Proverbs 6:27, Proverbs 6:32, Proverbs 8:2, Proverbs 8:12, Proverbs 10:4, Proverbs 10:21, Proverbs 11:2, Proverbs 12:19, Proverbs 12:21, Proverbs 14:13, Proverbs 14:18, Proverbs 17:13, Proverbs 20:24, Proverbs 26:11, Proverbs 27:15, Proverbs 27:19, Proverbs 29:25, Proverbs 30:22, Proverbs 31:10, Proverbs 31:14, Song of Solomon 6:3, Isaiah 3:4, Isaiah 43:27, Isaiah 44:4, Isaiah 45:15, Isaiah 55:6, Isaiah 60:8, Jeremiah 17:15, Lamentations 3:37, Lamentations 5:6, Lamentations 5:20, Ezekiel 43:16, Hosea 7:8, Joel 2:18, Haggai 2:8, Zechariah 1:5, Matthew 4:19, Matthew 5:3, Matthew 10:24, Matthew 13:58, Matthew 16:16, Matthew 21:22, Matthew 23:36, Matthew 26:9, Matthew 26:43, Matthew 26:54, Mark 8:5, Mark 8:26, Mark 13:33, Luke 1:55, Luke 2:2, Luke 3:13, Luke 6:16, Luke 6:24, Luke 13:5, Luke 15:1, Luke 21:29, Luke 22:12, John 1:9, John 1:20, John 2:13, John 4:32, John 9:14, John 9:26, John 11:7, John 12:20, John 13:6, John 14:1, Acts 4:28, Acts 7:53, Acts 8:17, Acts 9:16, Acts 12:22, Acts 13:32, Acts 15:13, Acts 15:15, Acts 19:23, Acts 21:22, Romans 11:27, Romans 14:19, Romans 16:27, 1 Corinthians 1:3, 1 Corinthians 3:9, 1 Corinthians 6:6, 1 Corinthians 10:10, 1 Corinthians 12:7, 1 Corinthians 14:14, 2 Corinthians 1:2, 2 Corinthians 11:14, Galatians 1:3, Galatians 1:19, Galatians 4:31, Ephesians 1:2, Ephesians 1:16, Philippians 1:2, Philippians 1:4, Colossians 3:20, 2 Thessalonians 1:2, 2 Timothy 2:13, 2 Timothy 3:7, Titus 2:11, Titus 3:4, Philemon 1:3, Philemon 1:23, Hebrews 5:8, Hebrews 5:10, James 1:2, James 1:22, Genesis 32:31, Genesis 36:23, Genesis 41:22, Genesis 44:19, Exodus 4:2, Exodus 12:26, Exodus 26:22, Exodus 33:14, Exodus 35:18, Exodus 36:7, Exodus 39:27, Exodus 40:25, Leviticus 5:19, Leviticus 7:27, Leviticus 13:38, Numbers 9:4, Numbers 26:17, Numbers 33:11, Deuteronomy 1:12, Deuteronomy 1:46, Deuteronomy 6:9, Deuteronomy 11:20, Deuteronomy 28:16, Deuteronomy 28:42, Deuteronomy 32:23, Joshua 12:9, Joshua 15:62, Judges 3:14, Judges 8:30, Judges 16:22, Judges 20:11, 1 Samuel 25:43, 2 Samuel 1:8, 2 Samuel 11:5, 2 Samuel 22:10, 2 Samuel 22:15, 2 Samuel 22:37, 1 Kings 2:10, 1 Kings 7:11, 1 Chronicles 2:6, 1 Chronicles 2:17, 1 Chronicles 9:30, 1 Chronicles 9:40, 1 Chronicles 10:6, 1 Chronicles 14:9, 1 Chronicles 22:16, 2 Chronicles 3:2, 2 Chronicles 11:5, Ezra 10:4, Ezra 10:24, Ezra 10:31, Job 3:12, Job 4:8, Job 4:13, Job 7:13, Job 9:8, Job 10:19, Job 13:1, Job 13:4, Job 13:12, Job 13:16, Job 19:23, Job 21:4, Job 21:25, Job 22:10, Job 24:10, Job 25:3, Job 27:4, Job 27:18, Job 28:8, Job 29:9, Job 29:22, Job 30:8, Job 33:17, Job 34:4, Job 34:5, Job 36:8, Job 38:30, Job 41:4, Job 42:5, Psalms 5:5, Psalms 17:8, Psalms 17:9, Psalms 18:9, Psalms 18:28, Psalms 18:36, Psalms 28:6, Psalms 29:6, Psalms 33:1, Psalms 34:11, Psalms 34:18, Psalms 35:11, Psalms 37:2, Psalms 37:13, Psalms 49:7, Psalms 50:6, Psalms 50:10, Psalms 51:10, Psalms 55:2, Psalms 60:12, Psalms 61:6, Psalms 66:19, Psalms 69:8, Psalms 73:11, Psalms 73:12, Psalms 76:8, Psalms 78:9, Psalms 78:33, Psalms 78:64, Psalms 80:7, Psalms 81:14, Psalms 83:1, Psalms 89:41, Psalms 89:44, Psalms 91:10, Psalms 92:14, Psalms 104:5, Psalms 105:12, Psalms 105:18, Psalms 105:20, Psalms 106:2, Psalms 107:2, Psalms 108:13, Psalms 112:7, Psalms 116:1, Psalms 118:4, Psalms 119:53, Psalms 119:63, Psalms 119:65, Psalms 119:93, Psalms 119:95, Psalms 119:107, Psalms 119:172, Psalms 121:3, Psalms 122:1, Psalms 135:15, Psalms 139:10, Psalms 148:7, Psalms 149:8, Proverbs 1:20, Proverbs 2:8, Proverbs 3:16, Proverbs 3:30, Proverbs 7:8, Proverbs 15:20, Proverbs 15:31, Proverbs 16:33, Proverbs 23:10, Proverbs 24:7, Proverbs 24:23, Proverbs 25:25, Proverbs 26:5, Proverbs 27:1, Proverbs 30:31, Proverbs 31:8, Proverbs 31:20, Ecclesiastes 11:1, Isaiah 10:5, Isaiah 28:3, Isaiah 32:8, Isaiah 41:3, Isaiah 43:21, Jeremiah 48:25, Lamentations 3:25, Lamentations 3:26, Lamentations 5:12, Ezekiel 37:20, Hosea 2:20, Hosea 4:8, Amos 8:1, Zechariah 4:4, Matthew 8:25, Matthew 9:34, Matthew 10:38, Matthew 13:7, Matthew 13:16, Matthew 17:3, Matthew 21:17, Matthew 26:4, Matthew 27:25, Matthew 27:50, Mark 3:35, Mark 5:12, Mark 6:43, Mark 7:12, Mark 7:30, Mark 8:13, Luke 1:16, Luke 1:50, Luke 1:61, Luke 12:14, Luke 14:16, Luke 15:23, Luke 16:20, Luke 17:13, Luke 20:41, John 5:31, John 7:11, John 7:16, John 10:20, John 16:12, Acts 9:6, Acts 10:27, Acts 14:25, Acts 15:26, Acts 15:31, Acts 16:30, Acts 26:21, Acts 27:32, Romans 3:1, Romans 6:20, Romans 7:16, Romans 9:14, 1 Corinthians 10:12, 1 Corinthians 15:36, 2 Corinthians 1:18, 2 Corinthians 3:15, Ephesians 4:6, Ephesians 5:12, Ephesians 6:3, Titus 3:11, Hebrews 7:24, Hebrews 10:24, Hebrews 10:35, 1 John 2:26, Jude 1:19, Revelation 2:29, Revelation 3:6, Revelation 3:13, Revelation 3:19, Revelation 8:6, Genesis 2:1, Genesis 9:9, Genesis 24:6, Genesis 29:17, Genesis 30:4, Genesis 30:17, Genesis 36:19, Genesis 43:4, Genesis 50:1, Exodus 24:15, Exodus 36:16, Leviticus 11:23, Leviticus 18:2, Leviticus 24:19, Numbers 3:37, Numbers 24:22, Numbers 26:36, Numbers 31:22, Deuteronomy 9:24, Deuteronomy 11:5, Deuteronomy 27:14, Deuteronomy 32:3, Joshua 12:23, Joshua 16:4, Judges 10:3, Ruth 4:16, 1 Samuel 6:1, 2 Samuel 16:20, 1 Kings 1:22, 1 Kings 12:19, 1 Kings 15:16, 1 Kings 15:32, 2 Kings 4:11, 1 Chronicles 2:9, 1 Chronicles 4:8, 1 Chronicles 5:15, 1 Chronicles 8:37, 1 Chronicles 15:8, 1 Chronicles 16:23, 1 Chronicles 16:27, 1 Chronicles 17:12, 1 Chronicles 21:14, 1 Chronicles 25:24, 1 Chronicles 29:21, 1 Chronicles 29:22, 2 Chronicles 9:17, 2 Chronicles 10:19, 2 Chronicles 12:4, 2 Chronicles 13:16, Ezra 8:7, Ezra 8:11, Job 3:17, Job 6:25, Job 8:21, Job 9:34, Job 11:13, Job 13:28, Job 14:10, Job 15:10, Job 19:4, Job 19:6, Job 20:16, Job 21:10, Job 21:11, Job 22:8, Job 22:22, Job 25:6, Job 27:3, Job 28:7, Job 28:16, Job 28:27, Job 29:5, Job 33:14, Job 34:22, Job 35:2, Job 35:13, Job 36:6, Job 38:21, Job 39:18, Psalms 3:2, Psalms 3:4, Psalms 18:10, Psalms 20:2, Psalms 22:18, Psalms 24:2, Psalms 34:9, Psalms 38:6, Psalms 40:15, Psalms 41:5, Psalms 44:25, Psalms 50:19, Psalms 51:18, Psalms 59:2, Psalms 66:14, Psalms 68:19, Psalms 72:18, Psalms 75:9, Psalms 78:22, Psalms 78:48, Psalms 78:61, Psalms 78:67, Psalms 84:7, Psalms 88:6, Psalms 89:18, Psalms 91:8, Psalms 97:12, Psalms 106:20, Psalms 107:23, Psalms 107:27, Psalms 107:40, Psalms 113:7, Psalms 115:10, Psalms 119:17, Psalms 119:22, Psalms 119:77, Psalms 119:79, Psalms 119:112, Psalms 122:5, Psalms 122:8, Psalms 132:6, Psalms 132:13, Psalms 132:18, Psalms 135:5, Psalms 135:20, Psalms 136:2, Psalms 136:25, Psalms 139:6, Psalms 147:7, Psalms 150:4, Proverbs 1:4, Proverbs 3:6, Proverbs 6:18, Proverbs 7:25, Proverbs 8:7, Proverbs 8:23, Proverbs 8:31, Proverbs 10:16, Proverbs 14:5, Proverbs 14:30, Proverbs 16:10, Proverbs 16:14, Proverbs 18:14, Proverbs 18:22, Proverbs 19:29, Proverbs 22:2, Proverbs 22:23, Proverbs 24:20, Proverbs 25:23, Proverbs 30:11, Proverbs 30:13, Ecclesiastes 9:8, Ecclesiastes 10:18, Song of Solomon 2:4, Isaiah 2:16, Isaiah 47:4, Isaiah 50:3, Jeremiah 4:15, Jeremiah 10:8, Jeremiah 21:11, Lamentations 3:3, Lamentations 3:24, Lamentations 3:62, Lamentations 3:63, Lamentations 5:19, Ezekiel 35:2, Ezekiel 40:8, Daniel 4:4, Hosea 11:1, Hosea 13:7, Hosea 13:9, Joel 1:8, Joel 3:20, Habakkuk 2:12, Zechariah 3:3, Zechariah 4:13, Matthew 1:22, Matthew 5:14, Matthew 15:10, Matthew 18:20, Matthew 18:30, Matthew 23:10, Matthew 24:41, Matthew 25:28, Matthew 26:11, Luke 1:4, Luke 1:14, Luke 1:56, Luke 2:47, Luke 7:5, Luke 14:20, Luke 19:32, Luke 20:38, Luke 23:38, John 1:5, John 3:33, John 5:47, John 6:28, John 7:34, John 11:22, John 15:12, John 15:18, John 21:10, Acts 2:1, Acts 5:29, Acts 10:6, Acts 13:40, Acts 20:14, Acts 22:21, Acts 28:5, Romans 1:3, Romans 3:28, Romans 7:12, 1 Corinthians 14:29, 2 Corinthians 11:1, 2 Corinthians 11:5, Galatians 2:18, Galatians 6:18, Philippians 1:5, Philippians 3:11, Colossians 1:21, Colossians 4:2, 2 Timothy 1:17, Hebrews 7:10, Hebrews 9:20, Hebrews 11:36, Hebrews 13:14, 1 Peter 1:15, 1 John 2:20, Revelation 3:22, Genesis 4:6, Genesis 22:4, Genesis 29:22, Genesis 30:22, Genesis 30:23, Genesis 33:12, Genesis 40:6, Genesis 41:1, Genesis 41:9, Exodus 12:50, Exodus 23:17, Exodus 25:39, Exodus 26:23, Exodus 27:13, Exodus 29:7, Exodus 36:19, Exodus 36:33, Exodus 37:11, Exodus 40:16, Leviticus 1:1, Leviticus 2:6, Leviticus 8:32, Leviticus 21:24, Leviticus 22:33, Leviticus 27:31, Numbers 3:19, Numbers 31:4, Numbers 32:3, Deuteronomy 17:13, Deuteronomy 28:3, Deuteronomy 29:3, Joshua 13:19, Joshua 22:6, Judges 14:20, 2 Samuel 1:17, 2 Samuel 12:26, 1 Kings 21:14, 2 Kings 4:32, 1 Chronicles 1:38, 1 Chronicles 2:44, 1 Chronicles 3:3, 1 Chronicles 6:29, 1 Chronicles 7:30, 1 Chronicles 8:7, 1 Chronicles 8:10, 1 Chronicles 11:44, 1 Chronicles 19:8, 1 Chronicles 23:14, Ezra 8:12, Nehemiah 11:36, Esther 10:1, Job 1:9, Job 3:14, Job 3:23, Job 5:9, Job 5:19, Job 9:9, Job 9:17, Job 12:14, Job 12:22, Job 14:22, Job 17:1, Job 20:12, Job 21:13, Job 26:7, Job 27:15, Job 28:14, Job 28:15, Job 31:1, Job 31:27, Job 31:38, Job 32:21, Job 32:22, Job 34:13, Job 36:3, Job 37:10, Job 39:7, Job 40:13, Job 40:15, Job 41:23, Job 41:34, Psalms 9:3, Psalms 23:2, Psalms 25:8, Psalms 31:6, Psalms 33:19, Psalms 37:15, Psalms 37:30, Psalms 38:9, Psalms 38:20, Psalms 45:11, Psalms 52:2, Psalms 56:7, Psalms 62:6, Psalms 62:11, Psalms 72:2, Psalms 72:13, Psalms 73:2, Psalms 73:13, Psalms 78:28, Psalms 83:12, Psalms 88:14, Psalms 89:40, Psalms 94:22, Psalms 96:2, Psalms 97:1, Psalms 104:10, Psalms 105:6, Psalms 105:38, Psalms 105:45, Psalms 106:3, Psalms 107:18, Psalms 119:32, Psalms 119:40, Psalms 119:98, Psalms 119:108, Psalms 119:145, Psalms 119:165, Psalms 119:168, Psalms 135:4, Psalms 138:3, Psalms 141:3, Psalms 145:1, Psalms 145:15, Psalms 145:20, Psalms 148:11, Psalms 150:5, Proverbs 1:13, Proverbs 1:26, Proverbs 2:3, Proverbs 3:11, Proverbs 3:13, Proverbs 3:20, Proverbs 3:23, Proverbs 5:1, Proverbs 6:10, Proverbs 7:10, Proverbs 13:5, Proverbs 16:28, Proverbs 18:18, Proverbs 23:28, Proverbs 23:33, Proverbs 24:4, Proverbs 24:33, Proverbs 26:4, Proverbs 27:6, Proverbs 27:8, Proverbs 28:3, Ecclesiastes 4:9, Ecclesiastes 6:7, Ecclesiastes 8:7, Ecclesiastes 9:18, Song of Solomon 1:10, Song of Solomon 7:6, Isaiah 2:1, Isaiah 26:2, Isaiah 31:6, Isaiah 65:24, Jeremiah 11:18, Jeremiah 19:10, Jeremiah 29:12, Jeremiah 36:15, Jeremiah 51:38, Lamentations 3:11, Ezekiel 10:13, Ezekiel 16:23, Ezekiel 38:5, Ezekiel 42:17, Daniel 7:21, Daniel 10:18, Hosea 5:12, Joel 3:15, Jonah 2:8, Nahum 1:1, Matthew 4:12, Matthew 11:28, Matthew 13:26, Matthew 14:16, Matthew 15:8, Matthew 15:24, Matthew 25:11, Matthew 26:70, Matthew 27:61, Mark 2:6, Mark 5:1, Mark 5:25, Mark 6:54, Mark 7:35, Mark 10:16, Mark 10:41, Mark 16:10, Luke 1:49, Luke 5:20, Luke 16:27, Luke 17:25, Luke 22:14, John 6:3, John 8:35, John 14:8, John 16:14, John 21:13, Acts 3:4, Acts 6:4, Acts 9:42, Acts 10:16, Romans 6:1, Romans 6:18, Romans 8:33, Romans 11:34, Romans 15:22, Romans 15:25, 1 Corinthians 9:8, 1 Corinthians 16:20, 1 Corinthians 16:22, 2 Corinthians 6:6, 2 Corinthians 7:6, 2 Corinthians 12:8, Galatians 4:2, Galatians 5:26, Colossians 2:4, 1 Timothy 6:21, Philemon 1:17, Hebrews 1:11, Hebrews 10:4, James 3:18, 1 John 3:5, Genesis 7:22, Genesis 8:18, Genesis 9:7, Genesis 15:11, Genesis 19:26, Genesis 24:62, Genesis 36:34, Genesis 36:37, Genesis 41:28, Exodus 25:24, Exodus 28:16, Exodus 29:31, Exodus 35:3, Exodus 39:15, Leviticus 3:11, Leviticus 6:13, Leviticus 9:16, Leviticus 14:50, Leviticus 26:14, Numbers 1:47, Numbers 16:48, Numbers 19:11, Numbers 22:2, Numbers 24:25, Numbers 26:13, Numbers 31:35, Numbers 34:26, Deuteronomy 3:7, Deuteronomy 3:22, Deuteronomy 23:6, Deuteronomy 28:46, Deuteronomy 33:4, Joshua 19:41, Joshua 21:35, Judges 13:22, 1 Samuel 2:6, 1 Samuel 2:18, 1 Samuel 18:14, 2 Samuel 2:31, 2 Samuel 19:1, 2 Samuel 22:34, 1 Kings 2:1, 1 Kings 13:27, 1 Kings 15:6, 1 Kings 18:16, 1 Kings 18:35, 1 Kings 22:40, 2 Kings 3:5, 2 Kings 10:36, 2 Kings 20:2, 1 Chronicles 1:45, 1 Chronicles 1:48, 1 Chronicles 2:29, 1 Chronicles 11:9, 1 Chronicles 16:19, 1 Chronicles 16:26, 1 Chronicles 23:21, 1 Chronicles 25:31, 2 Chronicles 33:10, 2 Chronicles 33:24, Ezra 2:40, Esther 4:10, Esther 6:7, Job 3:19, Job 8:7, Job 8:12, Job 8:16, Job 14:16, Job 16:11, Job 17:7, Job 19:22, Job 19:24, Job 20:24, Job 22:13, Job 22:17, Job 26:12, Job 27:10, Job 27:22, Job 28:10, Job 28:19, Job 29:19, Job 31:36, Job 34:36, Job 37:7, Job 37:9, Job 37:11, Psalms 7:4, Psalms 7:15, Psalms 9:19, Psalms 17:10, Psalms 18:33, Psalms 21:13, Psalms 25:19, Psalms 32:1, Psalms 33:3, Psalms 34:4, Psalms 41:7, Psalms 44:12, Psalms 44:18, Psalms 44:26, Psalms 49:20, Psalms 51:8, Psalms 62:7, Psalms 63:3, Psalms 65:1, Psalms 67:2, Psalms 69:5, Psalms 69:31, Psalms 73:7, Psalms 78:2, Psalms 78:27, Psalms 78:60, Psalms 81:11, Psalms 81:13, Psalms 82:4, Psalms 85:2, Psalms 88:17, Psalms 89:16, Psalms 89:27, Psalms 94:13, Psalms 94:18, Psalms 102:17, Psalms 104:12, Psalms 104:19, Psalms 105:32, Psalms 107:36, Psalms 108:8, Psalms 109:6, Psalms 109:24, Psalms 116:4, Psalms 118:24, Psalms 119:10, Psalms 119:11, Psalms 119:66, Psalms 119:71, Psalms 119:120, Psalms 119:136, Psalms 135:17, Psalms 136:3, Psalms 136:7, Psalms 136:22, Psalms 136:26, Psalms 139:17, Psalms 139:19, Psalms 145:18, Proverbs 1:9, Proverbs 2:1, Proverbs 3:29, Proverbs 4:13, Proverbs 4:22, Proverbs 4:23, Proverbs 4:27, Proverbs 5:16, Proverbs 6:11, Proverbs 6:33, Proverbs 6:35, Proverbs 7:2, Proverbs 7:24, Proverbs 8:36, Proverbs 12:23, Proverbs 12:25, Proverbs 13:8, Proverbs 14:17, Proverbs 14:20, Proverbs 16:8, Proverbs 17:22, Proverbs 19:4, Proverbs 20:8, Proverbs 21:8, Proverbs 21:28, Proverbs 22:24, Proverbs 24:18, Proverbs 24:19, Proverbs 24:34, Proverbs 27:4, Proverbs 27:23, Proverbs 27:26, Proverbs 31:3, Proverbs 31:11, Ecclesiastes 1:2, Ecclesiastes 1:4, Ecclesiastes 3:8, Ecclesiastes 5:3, Ecclesiastes 7:13, Ecclesiastes 7:24, Ecclesiastes 10:15, Song of Solomon 2:5, Song of Solomon 6:8, Song of Solomon 7:7, Isaiah 3:26, Isaiah 5:23, Isaiah 7:12, Isaiah 24:17, Isaiah 26:12, Isaiah 40:30, Isaiah 46:12, Jeremiah 37:16, Jeremiah 48:16, Jeremiah 51:42, Ezekiel 10:8, Ezekiel 39:16, Daniel 7:3, Daniel 7:17, Daniel 10:10, Hosea 1:5, Amos 5:1, Amos 8:13, Micah 6:3, Nahum 3:1, Habakkuk 3:12, Matthew 3:1, Matthew 3:6, Matthew 5:44, Matthew 12:14, Matthew 12:23, Matthew 14:25, Matthew 19:20, Matthew 21:14, Matthew 24:10, Matthew 24:46, Mark 3:1, Mark 6:46, Mark 9:11, Luke 8:7, Luke 10:4, Luke 12:43, Luke 16:29, Luke 17:11, Luke 17:18, Luke 17:19, Luke 20:31, Luke 22:51, John 5:1, John 5:15, John 6:56, John 11:46, Acts 5:6, Acts 14:16, Acts 18:11, Acts 26:19, Romans 1:2, Romans 4:25, Romans 8:1, Romans 11:21, Romans 11:32, Romans 16:1, Romans 16:16, 1 Corinthians 1:31, 1 Corinthians 13:4, 2 Corinthians 1:21, 2 Corinthians 11:24, Ephesians 5:9, Ephesians 5:17, Ephesians 6:24, Colossians 3:2, 1 Timothy 2:10, 1 Timothy 3:14, 2 Timothy 2:1, 2 Timothy 4:4, Hebrews 11:14, James 3:11, James 5:18, 1 John 3:21, Revelation 12:8, Revelation 16:16, Genesis 1:17, Genesis 22:10, Genesis 25:19, Genesis 28:8, Genesis 31:9, Genesis 36:32, Genesis 49:23, Genesis 50:6, Exodus 2:1, Exodus 17:15, Exodus 30:26, Exodus 37:5, Exodus 40:31, Leviticus 8:3, Leviticus 15:9, Leviticus 20:7, Leviticus 26:7, Numbers 1:19, Numbers 10:5, Numbers 15:12, Numbers 15:40, Numbers 26:6, Numbers 32:40, Numbers 34:10, Deuteronomy 2:32, Deuteronomy 25:13, Deuteronomy 27:8, Deuteronomy 28:28, Judges 9:50, Judges 16:1, Judges 20:19, 1 Samuel 14:23, 1 Samuel 18:29, 1 Samuel 19:12, 2 Samuel 3:33, 2 Samuel 7:20, 2 Samuel 14:3, 2 Samuel 22:19, 1 Kings 4:10, 1 Kings 6:30, 1 Kings 8:45, 1 Kings 8:62, 2 Kings 4:15, 2 Kings 22:11, 1 Chronicles 2:13, 1 Chronicles 4:32, 1 Chronicles 8:1, 1 Chronicles 12:16, 1 Chronicles 16:10, 1 Chronicles 23:2, 2 Chronicles 13:1, 2 Chronicles 15:19, Ezra 8:5, Ezra 8:10, Job 3:8, Job 9:2, Job 9:13, Job 10:13, Job 11:3, Job 12:9, Job 13:3, Job 13:19, Job 15:6, Job 15:25, Job 15:32, Job 16:15, Job 17:2, Job 21:22, Job 21:31, Job 27:21, Job 28:1, Job 28:12, Job 28:25, Job 30:21, Job 30:31, Job 31:8, Job 31:26, Job 32:9, Job 33:5, Job 33:18, Job 35:16, Job 36:23, Job 36:32, Job 36:33, Job 38:15, Job 38:36, Job 39:20, Job 39:27, Job 40:14, Psalms 6:7, Psalms 15:1, Psalms 18:18, Psalms 21:4, Psalms 22:19, Psalms 26:9, Psalms 26:10, Psalms 31:4, Psalms 31:24, Psalms 34:5, Psalms 38:15, Psalms 45:3, Psalms 47:6, Psalms 50:5, Psalms 50:20, Psalms 51:13, Psalms 64:2, Psalms 66:18, Psalms 68:11, Psalms 69:29, Psalms 73:3, Psalms 78:19, Psalms 78:24, Psalms 78:35, Psalms 78:62, Psalms 78:63, Psalms 80:8, Psalms 82:2, Psalms 84:4, Psalms 85:1, Psalms 90:7, Psalms 94:7, Psalms 97:6, Psalms 102:6, Psalms 103:1, Psalms 105:3, Psalms 112:3, Psalms 114:8, Psalms 119:1, Psalms 119:21, Psalms 119:33, Psalms 119:86, Psalms 119:91, Psalms 119:115, Psalms 126:1, Psalms 135:2, Psalms 136:21, Psalms 144:8, Psalms 145:14, Psalms 147:14, Proverbs 1:25, Proverbs 4:25, Proverbs 7:4, Proverbs 7:16, Proverbs 7:26, Proverbs 11:22, Proverbs 14:12, Proverbs 15:29, Proverbs 16:25, Proverbs 17:25, Proverbs 21:18, Proverbs 22:4, Proverbs 22:7, Proverbs 23:6, Proverbs 23:23, Proverbs 24:5, Proverbs 25:22, Proverbs 28:1, Proverbs 30:2, Proverbs 30:29, Proverbs 31:7, Proverbs 31:25, Ecclesiastes 3:4, Ecclesiastes 5:5, Ecclesiastes 7:11, Ecclesiastes 7:20, Song of Solomon 5:4, Song of Solomon 7:11, Isaiah 2:22, Isaiah 42:12, Isaiah 56:9, Jeremiah 25:25, Jeremiah 32:27, Jeremiah 35:9, Lamentations 3:39, Lamentations 3:44, Lamentations 5:15, Ezekiel 16:56, Ezekiel 25:2, Ezekiel 41:24, Ezekiel 48:19, Daniel 5:24, Daniel 5:25, Daniel 5:31, Hosea 7:3, Matthew 3:13, Matthew 7:9, Matthew 11:18, Matthew 13:45, Matthew 21:29, Matthew 23:21, Matthew 24:49, Mark 8:24, Mark 10:8, Mark 14:19, Luke 2:41, Luke 4:28, Luke 4:37, Luke 8:48, Luke 10:3, Luke 11:21, Luke 12:49, Luke 18:42, Luke 22:1, Luke 23:32, Luke 24:51, John 3:1, John 4:29, John 16:6, John 18:6, Acts 1:17, Acts 5:1, Acts 5:13, Acts 8:5, Acts 8:15, Acts 20:36, Acts 24:16, Romans 4:23, 1 Corinthians 14:8, 1 Corinthians 14:30, 2 Corinthians 4:1, 2 Corinthians 10:6, Galatians 4:21, Ephesians 5:11, Philippians 2:23, Philippians 4:21, 1 Thessalonians 2:1, 1 Thessalonians 4:12, Hebrews 9:3, Hebrews 10:37, Hebrews 13:10, James 1:14, James 1:20, 1 Peter 3:11, 2 Peter 1:7, 1 John 3:18, 3 John 1:13, Revelation 21:25, Genesis 8:6, Genesis 10:2, Genesis 20:10, Genesis 31:4, Genesis 35:15, Genesis 36:25, Genesis 37:1, Genesis 47:2, Exodus 9:17, Exodus 12:24, Exodus 16:19, Exodus 25:7, Exodus 26:20, Exodus 28:22, Exodus 31:5, Exodus 33:20, Leviticus 8:19, Leviticus 8:36, Leviticus 9:1, Leviticus 11:12, Leviticus 13:48, Leviticus 14:30, Leviticus 26:12, Numbers 7:42, Numbers 23:22, Numbers 32:8, Numbers 34:27, Numbers 34:28, Deuteronomy 1:14, Deuteronomy 2:13, Deuteronomy 10:16, Joshua 10:9, Joshua 23:8, Judges 15:9, Judges 16:4, Judges 20:9, 1 Samuel 3:16, 1 Samuel 8:4, 1 Samuel 15:34, 1 Samuel 30:29, 2 Samuel 3:11, 2 Samuel 14:1, 2 Samuel 22:12, 2 Samuel 22:30, 1 Kings 4:2, 2 Kings 13:24, 1 Chronicles 1:5, 1 Chronicles 2:22, 1 Chronicles 2:28, 1 Chronicles 10:11, 2 Chronicles 10:5, 2 Chronicles 16:13, 2 Chronicles 18:13, 2 Chronicles 19:1, Nehemiah 3:28, Job 4:3, Job 6:5, Job 6:14, Job 6:22, Job 6:24, Job 6:27, Job 8:19, Job 10:8, Job 11:11, Job 17:6, Job 17:12, Job 19:26, Job 20:17, Job 22:12, Job 23:3, Job 28:9, Job 28:13, Job 34:30, Job 34:32, Job 37:13, Job 39:14, Job 39:28, Job 41:6, Job 41:13, Job 41:28, Job 41:31, Job 42:4, Psalms 6:4, Psalms 7:13, Psalms 9:20, Psalms 17:2, Psalms 18:4, Psalms 18:29, Psalms 18:44, Psalms 22:20, Psalms 25:15, Psalms 26:3, Psalms 27:10, Psalms 34:7, Psalms 39:13, Psalms 41:10, Psalms 44:24, Psalms 48:9, Psalms 49:6, Psalms 50:11, Psalms 51:11, Psalms 55:1, Psalms 55:4, Psalms 56:12, Psalms 57:5, Psalms 57:11, Psalms 58:5, Psalms 59:6, Psalms 59:14, Psalms 63:2, Psalms 72:1, Psalms 73:24, Psalms 78:10, Psalms 78:43, Psalms 80:4, Psalms 80:19, Psalms 81:12, Psalms 83:17, Psalms 85:12, Psalms 86:4, Psalms 89:17, Psalms 91:5, Psalms 92:12, Psalms 94:14, Psalms 94:20, Psalms 103:5, Psalms 104:7, Psalms 107:34, Psalms 108:5, Psalms 108:11, Psalms 111:5, Psalms 119:7, Psalms 119:110, Psalms 119:111, Psalms 119:125, Psalms 132:8, Psalms 132:15, Psalms 135:8, Psalms 135:14, Psalms 135:21, Psalms 136:17, Psalms 139:4, Psalms 147:4, Proverbs 2:6, Proverbs 3:1, Proverbs 4:10, Proverbs 7:12, Proverbs 8:21, Proverbs 9:4, Proverbs 12:16, Proverbs 12:28, Proverbs 13:17, Proverbs 14:7, Proverbs 14:15, Proverbs 14:24, Proverbs 14:25, Proverbs 20:30, Proverbs 21:2, Proverbs 21:15, Proverbs 24:9, Proverbs 26:1, Proverbs 26:8, Proverbs 27:24, Proverbs 29:11, Proverbs 31:22, Ecclesiastes 3:1, Song of Solomon 1:14, Song of Solomon 4:12, Isaiah 5:21, Isaiah 33:7, Isaiah 40:13, Isaiah 42:2, Jeremiah 5:8, Jeremiah 30:5, Lamentations 3:9, Lamentations 3:43, Lamentations 3:52, Lamentations 5:2, Ezekiel 12:5, Ezekiel 17:2, Ezekiel 27:23, Ezekiel 39:5, Ezekiel 47:21, Joel 2:21, Jonah 2:10, Nahum 1:11, Habakkuk 3:18, Matthew 2:5, Matthew 13:3, Matthew 14:21, Matthew 17:6, Matthew 21:11, Matthew 24:12, Matthew 24:42, Matthew 27:12, Matthew 27:41, Matthew 27:47, Mark 5:24, Mark 7:7, Mark 8:16, Mark 8:32, Mark 8:36, Mark 10:12, Mark 10:28, Mark 11:10, Mark 14:56, Mark 15:26, Mark 15:35, Luke 1:43, Luke 2:52, Luke 4:32, Luke 10:8, Luke 12:21, Luke 19:28, Luke 21:1, Luke 21:14, Luke 22:41, Luke 24:11, John 1:36, John 2:18, John 4:24, John 6:66, John 8:5, John 8:27, John 8:58, John 10:11, John 12:32, John 18:19, Acts 10:18, Acts 11:30, Acts 15:6, Acts 18:13, Acts 21:2, Romans 2:2, 1 Corinthians 3:20, 1 Corinthians 5:9, 1 Corinthians 11:4, 1 Corinthians 11:11, 1 Corinthians 11:33, 1 Corinthians 12:29, Galatians 2:10, Galatians 3:6, Ephesians 3:4, Philippians 1:15, Colossians 1:26, Colossians 2:10, 1 Thessalonians 5:6, 2 Thessalonians 2:5, 2 Timothy 1:4, 2 Timothy 4:20, Hebrews 10:17, Hebrews 12:21, James 1:24, James 2:12, 1 Peter 5:3, 1 John 1:8, 1 John 2:9, Revelation 17:13, Revelation 21:18, Genesis 7:6, Genesis 7:20, Genesis 14:3, Genesis 24:28, Genesis 28:7, Genesis 33:9, Genesis 35:9, Genesis 36:29, Genesis 41:53, Genesis 44:3, Exodus 21:9, Exodus 34:33, Leviticus 19:33, Leviticus 26:23, Leviticus 26:27, Numbers 3:16, Numbers 3:23, Numbers 5:31, Numbers 7:24, Numbers 14:1, Numbers 14:4, Numbers 15:11, Numbers 17:7, Numbers 22:15, Numbers 31:32, Numbers 34:25, Deuteronomy 6:19, Deuteronomy 10:19, Deuteronomy 25:14, Deuteronomy 31:22, Deuteronomy 31:25, Deuteronomy 32:37, Joshua 21:29, Joshua 21:31, Judges 1:22, Judges 5:20, Judges 6:23, Judges 12:11, Ruth 1:18, 1 Samuel 15:27, 1 Samuel 18:15, 1 Samuel 20:20, 2 Samuel 3:15, 2 Samuel 4:3, 2 Samuel 5:7, 2 Samuel 10:7, 2 Samuel 22:45, 2 Samuel 23:34, 1 Kings 8:12, 1 Kings 13:10, 1 Kings 17:7, 1 Kings 18:17, 2 Kings 3:6, 2 Kings 6:4, 2 Kings 9:23, 2 Kings 10:26, 1 Chronicles 1:36, 1 Chronicles 1:42, 1 Chronicles 6:64, 1 Chronicles 21:19, 2 Chronicles 6:1, 2 Chronicles 6:2, 2 Chronicles 6:35, 2 Chronicles 20:30, Ezra 8:8, Ezra 8:23, Job 3:20, Job 4:12, Job 4:18, Job 5:14, Job 6:2, Job 6:7, Job 6:29, Job 9:23, Job 12:10, Job 13:15, Job 14:3, Job 15:27, Job 20:6, Job 20:14, Job 22:16, Job 23:5, Job 25:5, Job 27:20, Job 28:24, Job 29:11, Job 30:2, Job 33:4, Job 34:24, Job 34:34, Job 36:30, Job 37:22, Job 39:22, Job 41:9, Psalms 3:3, Psalms 12:7, Psalms 21:12, Psalms 24:10, Psalms 26:12, Psalms 29:4, Psalms 34:15, Psalms 37:3, Psalms 37:23, Psalms 38:7, Psalms 39:8, Psalms 44:7, Psalms 46:6, Psalms 58:2, Psalms 60:7, Psalms 63:4, Psalms 65:12, Psalms 68:28, Psalms 69:27, Psalms 69:34, Psalms 72:12, Psalms 73:16, Psalms 74:12, Psalms 83:9, Psalms 87:2, Psalms 89:36, Psalms 91:11, Psalms 103:16, Psalms 104:31, Psalms 106:17, Psalms 106:39, Psalms 107:35, Psalms 108:1, Psalms 110:7, Psalms 115:11, Psalms 118:18, Psalms 119:42, Psalms 119:92, Psalms 119:143, Psalms 120:5, Psalms 132:14, Psalms 132:16, Psalms 135:3, Psalms 136:4, Psalms 139:7, Psalms 139:13, Proverbs 2:5, Proverbs 2:17, Proverbs 4:6, Proverbs 4:14, Proverbs 5:7, Proverbs 8:25, Proverbs 10:10, Proverbs 13:16, Proverbs 14:19, Proverbs 15:4, Proverbs 15:30, Proverbs 17:1, Proverbs 17:16, Proverbs 19:3, Proverbs 19:15, Proverbs 20:22, Proverbs 21:29, Proverbs 22:22, Proverbs 23:1, Proverbs 24:30, Proverbs 25:10, Proverbs 25:15, Proverbs 27:16, Proverbs 28:15, Proverbs 29:4, Proverbs 29:10, Proverbs 30:25, Proverbs 30:30, Proverbs 31:9, Proverbs 31:23, Ecclesiastes 3:6, Ecclesiastes 4:11, Ecclesiastes 10:7, Song of Solomon 1:16, Song of Solomon 4:15, Isaiah 7:7, Isaiah 10:30, Isaiah 26:7, Isaiah 43:16, Isaiah 45:25, Isaiah 49:11, Isaiah 57:2, Jeremiah 2:14, Jeremiah 18:3, Jeremiah 29:15, Jeremiah 29:27, Jeremiah 30:12, Jeremiah 48:21, Jeremiah 49:15, Lamentations 3:7, Ezekiel 20:10, Daniel 6:19, Amos 5:7, Nahum 1:13, Matthew 2:3, Matthew 2:14, Matthew 6:8, Matthew 6:27, Matthew 7:29, Matthew 9:21, Matthew 14:4, Matthew 14:33, Matthew 15:9, Matthew 17:26, Matthew 22:17, Matthew 22:41, Matthew 24:17, Matthew 25:38, Matthew 26:8, Matthew 26:23, Mark 2:27, Mark 4:18, Mark 7:22, Mark 12:39, Mark 12:42, Mark 14:8, Luke 1:8, Luke 1:72, Luke 4:24, Luke 8:26, Luke 11:38, Luke 12:12, Luke 12:25, Luke 12:59, Luke 14:4, Luke 14:24, Luke 14:27, Luke 18:35, Luke 22:48, Luke 23:13, Luke 23:45, John 2:3, John 4:13, John 5:17, John 7:6, John 9:37, John 10:22, John 10:34, John 11:12, Acts 3:3, Acts 16:32, Acts 24:9, Romans 5:6, Romans 6:8, Romans 9:16, Romans 9:18, Romans 10:4, Romans 11:14, Romans 11:19, 1 Corinthians 1:5, 1 Corinthians 2:5, 1 Corinthians 7:33, 1 Corinthians 16:18, 2 Corinthians 6:12, 2 Corinthians 11:29, Colossians 4:5, 1 Thessalonians 4:4, 2 Timothy 1:7, Hebrews 3:4, James 5:1, 1 John 1:10, Revelation 2:6, Genesis 3:20, Genesis 9:24, Genesis 26:33, Genesis 30:24, Genesis 34:4, Genesis 37:11, Genesis 41:29, Genesis 41:41, Genesis 47:5, Genesis 47:8, Exodus 8:32, Exodus 18:27, Exodus 25:6, Exodus 25:30, Exodus 35:8, Exodus 35:13, Exodus 36:23, Exodus 39:34, Leviticus 3:7, Leviticus 14:26, Leviticus 17:16, Leviticus 23:44, Leviticus 25:24, Leviticus 25:48, Numbers 6:27, Numbers 11:14, Numbers 23:30, Numbers 26:49, Numbers 26:61, Numbers 34:18, Deuteronomy 15:13, Deuteronomy 28:50, Joshua 14:5, Joshua 21:18, Joshua 21:22, Judges 6:7, Judges 8:13, Judges 14:11, Judges 20:7, 2 Samuel 11:14, 2 Samuel 22:23, 1 Kings 1:49, 1 Kings 6:26, 1 Kings 10:18, 1 Kings 11:39, 1 Kings 16:32, 1 Kings 18:2, 1 Kings 18:8, 2 Kings 2:25, 2 Kings 7:11, 2 Kings 13:15, 2 Kings 19:36, 1 Chronicles 2:1, 1 Chronicles 2:31, 1 Chronicles 9:43, 1 Chronicles 11:7, 1 Chronicles 14:12, 1 Chronicles 21:27, 2 Chronicles 10:13, 2 Chronicles 27:6, Ezra 8:34, Nehemiah 12:9, Job 3:4, Job 6:17, Job 8:20, Job 10:2, Job 10:9, Job 10:21, Job 11:19, Job 15:8, Job 15:13, Job 18:13, Job 18:20, Job 20:27, Job 22:9, Job 24:4, Job 24:7, Job 26:13, Job 28:20, Job 29:3, Job 32:13, Job 33:8, Job 33:13, Job 35:12, Job 37:17, Job 38:7, Job 38:23, Job 39:9, Job 40:16, Job 40:21, Psalms 9:9, Psalms 12:3, Psalms 18:49, Psalms 22:6, Psalms 24:3, Psalms 25:13, Psalms 27:11, Psalms 30:4, Psalms 33:7, Psalms 34:12, Psalms 35:6, Psalms 37:4, Psalms 37:11, Psalms 37:24, Psalms 45:13, Psalms 49:16, Psalms 50:4, Psalms 51:12, Psalms 60:10, Psalms 61:8, Psalms 75:7, Psalms 78:34, Psalms 78:72, Psalms 91:2, Psalms 98:7, Psalms 101:1, Psalms 102:8, Psalms 104:17, Psalms 105:31, Psalms 113:1, Psalms 116:7, Psalms 119:9, Psalms 119:37, Psalms 119:76, Psalms 119:117, Psalms 119:118, Psalms 119:128, Psalms 119:138, Psalms 119:158, Psalms 119:161, Psalms 124:4, Psalms 135:13, Psalms 139:3, Psalms 147:17, Psalms 148:1, Psalms 148:5, Proverbs 3:9, Proverbs 5:11, Proverbs 6:9, Proverbs 8:10, Proverbs 9:3, Proverbs 9:11, Proverbs 11:31, Proverbs 12:1, Proverbs 12:15, Proverbs 13:12, Proverbs 17:12, Proverbs 17:21, Proverbs 18:3, Proverbs 18:12, Proverbs 20:6, Proverbs 20:7, Proverbs 20:27, Proverbs 21:10, Proverbs 22:8, Proverbs 25:4, Proverbs 25:27, Proverbs 25:28, Proverbs 26:16, Proverbs 28:21, Proverbs 29:14, Proverbs 29:21, Proverbs 31:24, Ecclesiastes 7:17, Ecclesiastes 7:19, Ecclesiastes 10:2, Isaiah 3:20, Isaiah 7:11, Isaiah 32:1, Isaiah 49:3, Isaiah 51:21, Isaiah 63:4, Isaiah 66:21, Jeremiah 25:8, Jeremiah 29:29, Jeremiah 32:10, Jeremiah 46:17, Jeremiah 51:40, Lamentations 5:17, Ezekiel 16:62, Ezekiel 20:19, Joel 2:29, Amos 7:5, Zechariah 11:4, Malachi 3:9, Matthew 2:21, Matthew 4:11, Matthew 8:5, Matthew 16:7, Matthew 16:10, Matthew 16:20, Matthew 18:22, Matthew 19:19, Matthew 22:6, Matthew 27:33, Matthew 27:44, Matthew 27:49, Mark 6:52, Mark 9:29, Mark 10:7, Mark 13:6, Luke 1:62, Luke 2:32, Luke 4:4, Luke 6:27, Luke 6:43, Luke 7:15, Luke 10:14, Luke 10:29, Luke 11:28, Luke 11:47, Luke 12:9, Luke 15:28, Luke 19:16, John 6:62, John 7:50, John 13:25, John 16:3, Acts 3:5, Acts 13:44, Acts 13:51, Acts 24:4, Romans 4:4, Romans 7:14, Romans 8:16, Romans 8:37, 1 Corinthians 10:31, 1 Corinthians 12:1, 1 Corinthians 12:30, 1 Corinthians 13:5, 1 Corinthians 14:13, 1 Corinthians 15:57, 2 Corinthians 11:8, Ephesians 3:12, Philippians 2:20, Philippians 4:17, Colossians 1:1, 1 Timothy 2:4, 2 Timothy 2:6, 2 Timothy 3:5, Hebrews 10:18, Hebrews 13:13, James 1:7, James 4:17, 1 Peter 2:1, 3 John 1:4, Revelation 20:7, Genesis 5:7, Genesis 8:10, Genesis 10:11, Genesis 12:14, Genesis 17:2, Genesis 27:43, Genesis 29:1, Genesis 29:24, Genesis 32:23, Genesis 35:19, Genesis 46:22, Exodus 4:24, Exodus 8:4, Exodus 13:10, Exodus 16:27, Exodus 22:23, Exodus 29:6, Exodus 30:38, Exodus 35:9, Exodus 40:23, Leviticus 11:30, Leviticus 21:22, Leviticus 27:17, Numbers 3:17, Numbers 4:38, Numbers 7:78, Numbers 16:35, Numbers 23:20, Numbers 24:12, Numbers 33:16, Numbers 34:24, Deuteronomy 6:14, Deuteronomy 6:16, Deuteronomy 12:19, Deuteronomy 20:10, Deuteronomy 28:19, Deuteronomy 32:28, Joshua 8:28, Joshua 10:38, Joshua 15:36, Joshua 21:24, Judges 4:12, Judges 5:22, Judges 5:25, Judges 7:10, Ruth 1:3, 1 Samuel 14:51, 1 Samuel 18:2, 1 Samuel 18:16, 1 Samuel 20:28, 2 Samuel 5:4, 2 Samuel 5:22, 2 Samuel 22:28, 1 Kings 3:24, 1 Kings 8:55, 1 Kings 10:23, 1 Kings 12:1, 1 Kings 20:8, 1 Kings 20:43, 2 Kings 2:20, 2 Kings 4:18, 2 Kings 4:33, 2 Kings 15:22, 2 Kings 17:40, 1 Chronicles 5:3, 1 Chronicles 17:2, 1 Chronicles 18:12, 1 Chronicles 23:1, 1 Chronicles 25:8, 1 Chronicles 26:13, 2 Chronicles 9:22, 2 Chronicles 10:1, 2 Chronicles 16:5, 2 Chronicles 25:2, Ezra 10:26, Nehemiah 7:43, Nehemiah 11:2, Job 2:6, Job 5:11, Job 7:17, Job 9:22, Job 9:28, Job 12:16, Job 14:9, Job 15:5, Job 15:35, Job 17:10, Job 21:12, Job 21:14, Job 28:26, Job 31:3, Job 36:4, Job 36:12, Job 38:3, Job 38:18, Job 38:35, Job 41:17, Psalms 2:5, Psalms 5:4, Psalms 7:7, Psalms 9:2, Psalms 15:2, Psalms 18:22, Psalms 26:11, Psalms 31:5, Psalms 32:3, Psalms 33:4, Psalms 33:14, Psalms 35:23, Psalms 37:16, Psalms 38:14, Psalms 44:23, Psalms 45:12, Psalms 45:15, Psalms 47:2, Psalms 51:5, Psalms 55:6, Psalms 55:11, Psalms 56:5, Psalms 69:24, Psalms 78:14, Psalms 78:36, Psalms 78:42, Psalms 78:65, Psalms 83:15, Psalms 85:10, Psalms 87:6, Psalms 88:7, Psalms 88:10, Psalms 88:11, Psalms 89:26, Psalms 89:34, Psalms 92:2, Psalms 95:6, Psalms 96:6, Psalms 97:5, Psalms 98:5, Psalms 102:4, Psalms 102:20, Psalms 103:15, Psalms 105:25, Psalms 107:39, Psalms 109:7, Psalms 110:5, Psalms 118:5, Psalms 118:16, Psalms 119:64, Psalms 119:69, Psalms 119:84, Psalms 119:85, Psalms 119:150, Psalms 127:3, Psalms 129:6, Psalms 136:13, Psalms 137:1, Psalms 146:3, Psalms 147:5, Proverbs 1:3, Proverbs 1:6, Proverbs 2:2, Proverbs 3:15, Proverbs 3:25, Proverbs 6:24, Proverbs 6:34, Proverbs 7:15, Proverbs 8:6, Proverbs 8:19, Proverbs 10:15, Proverbs 10:27, Proverbs 11:8, Proverbs 12:2, Proverbs 15:23, Proverbs 17:7, Proverbs 18:2, Proverbs 20:21, Proverbs 20:23, Proverbs 21:3, Proverbs 25:12, Proverbs 26:23, Proverbs 26:24, Proverbs 30:5, Proverbs 31:31, Ecclesiastes 1:5, Ecclesiastes 2:5, Ecclesiastes 6:1, Ecclesiastes 7:3, Isaiah 24:10, Isaiah 32:5, Isaiah 40:23, Isaiah 41:21, Isaiah 49:24, Jeremiah 2:16, Jeremiah 4:25, Jeremiah 5:18, Jeremiah 5:25, Jeremiah 6:18, Jeremiah 13:26, Jeremiah 14:5, Jeremiah 25:37, Jeremiah 46:1, Jeremiah 48:24, Lamentations 3:22, Lamentations 5:22, Ezekiel 6:7, Ezekiel 23:26, Daniel 1:6, Micah 6:11, Zechariah 11:15, Matthew 5:38, Matthew 7:18, Matthew 7:19, Matthew 8:22, Matthew 9:3, Matthew 15:21, Matthew 20:32, Matthew 26:12, Mark 1:8, Mark 6:16, Mark 6:30, Mark 15:6, Mark 15:27, Luke 1:28, Luke 1:68, Luke 1:71, Luke 1:77, Luke 2:45, Luke 4:10, Luke 9:53, Luke 10:12, Luke 10:28, Luke 12:29, Luke 14:13, Luke 17:12, Luke 18:18, Luke 18:23, Luke 18:41, Luke 20:27, Luke 20:34, Luke 21:38, Luke 22:16, John 4:48, John 5:12, John 8:4, John 8:51, John 13:23, John 14:20, John 17:4, John 18:40, John 21:5, Acts 5:30, Acts 7:48, Acts 8:23, Acts 10:20, Acts 14:12, Acts 16:28, Acts 19:39, Acts 22:15, Romans 4:15, Romans 9:24, Romans 12:10, Romans 13:10, 1 Corinthians 2:2, 1 Corinthians 2:15, 1 Corinthians 3:16, 2 Corinthians 10:3, Galatians 1:22, Galatians 6:3, Ephesians 3:3, Ephesians 6:2, Colossians 2:17, 1 Thessalonians 1:7, 1 Thessalonians 3:11, 1 Thessalonians 5:10, 2 Thessalonians 3:2, 1 Timothy 3:3, 2 Timothy 2:7, 2 Timothy 4:7, Philemon 1:18, Hebrews 8:2, 1 Peter 5:14, Revelation 2:21, Revelation 18:5, Genesis 5:10, Genesis 5:19, Genesis 5:30, Genesis 9:25, Genesis 13:15, Genesis 16:9, Genesis 16:14, Genesis 21:15, Genesis 24:4, Genesis 26:13, Genesis 27:6, Genesis 41:6, Genesis 41:23, Genesis 44:24, Genesis 47:21, Genesis 50:22, Exodus 1:5, Exodus 4:22, Exodus 5:6, Exodus 7:23, Exodus 9:26, Exodus 26:18, Exodus 36:25, Exodus 37:14, Leviticus 2:15, Leviticus 19:7, Leviticus 23:29, Leviticus 24:12, Numbers 7:30, Numbers 7:72, Numbers 26:19, Numbers 26:24, Numbers 27:9, Numbers 31:7, Numbers 33:44, Numbers 35:1, Deuteronomy 5:12, Deuteronomy 12:13, Joshua 1:12, Joshua 3:12, Joshua 15:41, Joshua 21:39, Judges 6:36, Judges 10:2, Judges 12:12, Ruth 3:12, 1 Samuel 12:25, 1 Samuel 14:44, 1 Samuel 18:3, 1 Samuel 21:10, 1 Samuel 27:4, 2 Samuel 13:27, 1 Kings 1:43, 1 Kings 2:2, 1 Kings 4:26, 1 Kings 6:23, 1 Kings 8:13, 1 Kings 11:42, 1 Kings 15:21, 1 Kings 16:1, 2 Kings 7:20, 2 Kings 10:20, 2 Kings 14:22, 2 Kings 19:17, 2 Kings 20:21, 1 Chronicles 2:33, 1 Chronicles 6:55, 1 Chronicles 8:34, 1 Chronicles 16:17, 1 Chronicles 16:24, 1 Chronicles 22:17, 1 Chronicles 26:15, 2 Chronicles 11:10, 2 Chronicles 21:18, 2 Chronicles 26:2, 2 Chronicles 34:29, Esther 1:2, Job 4:17, Job 7:6, Job 7:9, Job 8:13, Job 9:10, Job 10:11, Job 15:3, Job 17:16, Job 23:2, Job 26:4, Job 29:7, Job 29:17, Job 30:5, Job 30:13, Job 33:6, Job 33:7, Job 34:9, Job 35:5, Job 36:10, Job 36:15, Job 38:19, Job 39:15, Job 39:17, Job 40:7, Job 40:22, Job 41:18, Psalms 5:12, Psalms 6:5, Psalms 9:7, Psalms 16:7, Psalms 16:10, Psalms 18:40, Psalms 23:3, Psalms 29:1, Psalms 29:5, Psalms 31:12, Psalms 37:17, Psalms 37:35, Psalms 39:2, Psalms 44:14, Psalms 49:3, Psalms 52:3, Psalms 54:5, Psalms 59:4, Psalms 63:7, Psalms 65:6, Psalms 65:11, Psalms 68:5, Psalms 74:10, Psalms 77:8, Psalms 77:15, Psalms 78:39, Psalms 78:44, Psalms 79:4, Psalms 79:5, Psalms 80:10, Psalms 80:13, Psalms 81:6, Psalms 94:16, Psalms 96:3, Psalms 105:10, Psalms 105:28, Psalms 105:40, Psalms 106:16, Psalms 109:25, Psalms 111:7, Psalms 119:74, Psalms 119:80, Psalms 119:104, Psalms 119:132, Psalms 119:152, Psalms 124:2, Psalms 136:11, Psalms 139:2, Psalms 139:8, Psalms 139:9, Psalms 139:24, Psalms 141:1, Psalms 144:6, Psalms 144:10, Psalms 147:13, Psalms 149:4, Psalms 150:1, Proverbs 1:15, Proverbs 2:9, Proverbs 2:20, Proverbs 3:26, Proverbs 4:7, Proverbs 5:21, Proverbs 6:16, Proverbs 6:19, Proverbs 6:20, Proverbs 9:16, Proverbs 10:7, Proverbs 10:30, Proverbs 13:6, Proverbs 15:5, Proverbs 15:33, Proverbs 16:2, Proverbs 16:29, Proverbs 19:11, Proverbs 20:10, Proverbs 22:13, Proverbs 25:9, Proverbs 26:3, Proverbs 26:7, Proverbs 26:10, Proverbs 27:20, Proverbs 29:26, Proverbs 31:26, Ecclesiastes 1:15, Ecclesiastes 3:7, Ecclesiastes 7:7, Isaiah 19:9, Isaiah 35:5, Isaiah 40:25, Isaiah 40:29, Isaiah 43:8, Isaiah 54:7, Isaiah 57:12, Jeremiah 1:8, Jeremiah 10:6, Jeremiah 16:2, Jeremiah 16:8, Jeremiah 17:12, Jeremiah 25:35, Jeremiah 39:7, Jeremiah 48:43, Ezekiel 2:1, Ezekiel 4:12, Ezekiel 8:13, Ezekiel 16:58, Ezekiel 20:48, Ezekiel 21:17, Ezekiel 25:11, Ezekiel 27:14, Ezekiel 37:18, Ezekiel 42:19, Ezekiel 47:11, Hosea 8:8, Amos 6:3, Amos 7:6, Obadiah 1:2, Micah 5:11, Micah 5:14, Nahum 3:6, Habakkuk 1:17, Habakkuk 2:20, Matthew 5:26, Matthew 7:17, Matthew 9:4, Matthew 17:13, Matthew 17:14, Matthew 23:6, Matthew 27:38, Matthew 27:66, Matthew 28:6, Mark 1:17, Mark 3:25, Mark 9:4, Mark 10:26, Mark 14:2, Mark 15:8, Luke 1:53, Luke 1:69, Luke 10:9, Luke 18:33, Luke 19:2, Luke 19:40, Luke 24:14, John 1:1, John 1:17, John 1:28, John 4:28, John 6:69, John 7:14, John 8:50, John 8:56, John 9:20, John 11:34, John 12:7, John 12:23, John 18:7, John 20:3, Acts 2:3, Acts 2:27, Acts 9:35, Acts 13:3, Acts 19:30, Acts 26:17, Acts 27:14, Romans 7:21, Romans 8:19, Romans 15:7, 1 Corinthians 1:8, 1 Corinthians 15:47, 2 Corinthians 4:3, 2 Corinthians 8:4, 2 Corinthians 9:1, Galatians 3:12, Galatians 6:6, Ephesians 2:4, Philippians 1:30, Philippians 2:13, Colossians 1:3, 2 Timothy 3:1, 2 Timothy 3:12, Philemon 1:11, Hebrews 9:27, James 2:19, 1 John 2:3, 1 John 2:6, Revelation 2:4, Revelation 3:11, Revelation 6:3, Genesis 18:9, Genesis 20:15, Genesis 22:23, Genesis 29:5, Genesis 29:29, Genesis 31:11, Genesis 31:19, Genesis 44:27, Exodus 9:30, Exodus 16:34, Exodus 19:15, Exodus 25:15, Exodus 26:34, Exodus 35:26, Exodus 38:20, Leviticus 6:23, Leviticus 19:27, Leviticus 19:35, Numbers 3:18, Numbers 7:15, Numbers 7:21, Numbers 7:27, Numbers 7:33, Numbers 7:39, Numbers 7:45, Numbers 7:51, Numbers 7:57, Numbers 7:60, Numbers 7:63, Numbers 7:66, Numbers 7:69, Numbers 7:75, Numbers 7:81, Numbers 11:7, Numbers 13:4, Numbers 14:17, Numbers 14:37, Numbers 18:10, Numbers 24:19, Numbers 24:23, Deuteronomy 1:2, Deuteronomy 1:26, Deuteronomy 2:10, Deuteronomy 12:16, Deuteronomy 28:6, Deuteronomy 31:24, Deuteronomy 33:25, Joshua 7:8, Joshua 9:14, Joshua 15:46, Joshua 19:26, Joshua 21:37, Judges 1:2, Judges 4:23, Judges 13:4, Judges 14:7, Judges 20:24, 1 Samuel 17:15, 1 Samuel 20:14, 1 Samuel 22:12, 2 Samuel 1:19, 2 Samuel 17:4, 2 Samuel 22:5, 2 Samuel 22:20, 2 Samuel 22:22, 1 Kings 9:2, 1 Kings 10:14, 1 Kings 12:17, 1 Kings 15:9, 2 Kings 8:20, 1 Chronicles 1:41, 1 Chronicles 5:11, 1 Chronicles 6:50, 1 Chronicles 7:33, 1 Chronicles 8:29, 1 Chronicles 11:31, 2 Chronicles 3:10, 2 Chronicles 9:13, 2 Chronicles 10:17, 2 Chronicles 21:8, 2 Chronicles 25:6, 2 Chronicles 28:17, Ezra 6:19, Ezra 7:5, Ezra 10:27, Job 5:12, Job 5:20, Job 5:27, Job 6:18, Job 8:10, Job 11:8, Job 11:10, Job 11:12, Job 15:4, Job 15:7, Job 15:21, Job 16:22, Job 19:3, Job 19:19, Job 19:25, Job 20:3, Job 20:29, Job 22:2, Job 22:26, Job 23:15, Job 28:17, Job 31:37, Job 34:12, Job 34:25, Job 35:3, Job 36:17, Job 38:25, Job 38:26, Job 38:34, Job 38:39, Job 39:3, Job 39:8, Job 40:19, Job 41:20, Psalms 5:2, Psalms 14:5, Psalms 18:19, Psalms 18:46, Psalms 19:1, Psalms 19:11, Psalms 22:2, Psalms 22:10, Psalms 28:8, Psalms 29:10, Psalms 34:1, Psalms 37:8, Psalms 44:9, Psalms 46:8, Psalms 62:2, Psalms 64:1, Psalms 66:13, Psalms 67:1, Psalms 68:31, Psalms 69:21, Psalms 69:30, Psalms 71:10, Psalms 74:17, Psalms 76:9, Psalms 77:9, Psalms 77:11, Psalms 78:16, Psalms 83:11, Psalms 88:4, Psalms 89:21, Psalms 89:33, Psalms 89:45, Psalms 91:12, Psalms 96:9, Psalms 102:21, Psalms 107:20, Psalms 111:3, Psalms 118:28, Psalms 119:2, Psalms 119:6, Psalms 119:130, Psalms 129:7, Psalms 136:1, Psalms 137:9, Psalms 138:5, Psalms 139:11, Psalms 144:5, Psalms 145:3, Psalms 146:5, Psalms 149:2, Proverbs 1:8, Proverbs 4:3, Proverbs 4:8, Proverbs 4:11, Proverbs 5:6, Proverbs 5:23, Proverbs 6:2, Proverbs 7:5, Proverbs 11:1, Proverbs 11:4, Proverbs 12:9, Proverbs 13:9, Proverbs 13:10, Proverbs 15:3, Proverbs 15:17, Proverbs 15:25, Proverbs 18:11, Proverbs 19:16, Proverbs 19:20, Proverbs 21:19, Proverbs 21:24, Proverbs 24:21, Proverbs 29:23, Proverbs 31:28, Ecclesiastes 5:9, Ecclesiastes 10:11, Song of Solomon 1:2, Song of Solomon 6:12, Isaiah 9:14, Isaiah 13:12, Isaiah 34:8, Isaiah 40:8, Isaiah 43:22, Isaiah 50:5, Isaiah 63:2, Jeremiah 3:4, Jeremiah 22:27, Jeremiah 31:25, Jeremiah 46:20, Jeremiah 49:6, Jeremiah 49:39, Lamentations 3:66, Ezekiel 23:16, Ezekiel 30:19, Ezekiel 41:14, Hosea 7:15, Joel 2:4, Amos 1:15, Amos 5:10, Amos 5:21, Zechariah 5:10, Zechariah 9:6, Matthew 1:1, Matthew 6:29, Matthew 9:29, Matthew 10:20, Matthew 11:3, Matthew 12:19, Matthew 13:10, Matthew 22:18, Matthew 23:9, Matthew 25:6, Matthew 26:5, Matthew 26:14, Matthew 26:49, Mark 4:33, Mark 12:21, Mark 16:4, Luke 1:67, Luke 2:29, Luke 5:39, Luke 7:46, Luke 8:36, Luke 11:15, Luke 15:31, Luke 17:26, Luke 20:29, Luke 22:50, Luke 22:63, John 1:27, John 4:33, John 11:10, John 11:26, John 12:4, John 12:31, John 12:37, John 13:9, John 18:8, Acts 2:12, Acts 3:17, Acts 5:20, Acts 8:28, Acts 9:33, Acts 21:12, Romans 4:7, Romans 8:31, Romans 10:11, 1 Corinthians 1:23, 1 Corinthians 12:22, 1 Corinthians 15:21, 1 Corinthians 15:38, Galatians 4:7, Galatians 5:19, Ephesians 3:1, Ephesians 4:7, 1 Thessalonians 2:3, 1 Thessalonians 5:11, 2 Thessalonians 2:6, 1 Timothy 2:14, 2 Timothy 2:12, 2 Timothy 2:17, James 2:7, James 4:7, James 4:15, 1 Peter 4:5, Genesis 6:11, Genesis 11:19, Genesis 11:21, Genesis 24:38, Genesis 25:24, Genesis 29:31, Genesis 31:20, Genesis 32:14, Genesis 42:12, Genesis 42:18, Genesis 45:20, Exodus 18:24, Exodus 37:15, Exodus 39:4, Leviticus 7:3, Leviticus 8:20, Leviticus 23:35, Leviticus 25:37, Numbers 3:24, Numbers 3:29, Deuteronomy 2:3, Deuteronomy 15:23, Deuteronomy 23:8, Deuteronomy 26:6, Joshua 8:25, Joshua 8:30, Judges 2:8, Judges 3:17, Judges 9:42, Ruth 4:8, 1 Samuel 17:24, 1 Samuel 30:25, 2 Samuel 11:22, 2 Samuel 19:23, 1 Kings 4:15, 1 Kings 7:10, 1 Kings 12:30, 1 Kings 15:11, 1 Kings 22:29, 2 Kings 3:16, 2 Kings 4:28, 2 Kings 5:19, 2 Kings 9:29, 2 Kings 24:6, 1 Chronicles 2:52, 1 Chronicles 7:22, 1 Chronicles 9:35, 1 Chronicles 21:11, 1 Chronicles 27:18, 2 Chronicles 2:5, 2 Chronicles 17:1, 2 Chronicles 18:28, Ezra 2:43, Ezra 8:4, Ezra 10:29, Ezra 10:43, Nehemiah 7:46, Job 3:16, Job 7:3, Job 7:5, Job 8:2, Job 8:9, Job 13:23, Job 14:2, Job 15:34, Job 16:6, Job 23:10, Job 23:13, Job 24:23, Job 28:21, Job 30:20, Job 30:25, Job 30:26, Job 31:19, Job 31:23, Job 31:39, Job 33:19, Job 34:14, Job 36:13, Job 38:27, Job 40:5, Job 40:17, Job 41:1, Job 41:32, Job 42:2, Psalms 10:1, Psalms 12:8, Psalms 17:11, Psalms 18:21, Psalms 21:3, Psalms 22:30, Psalms 27:14, Psalms 37:18, Psalms 40:7, Psalms 44:10, Psalms 44:20, Psalms 50:12, Psalms 50:14, Psalms 55:9, Psalms 57:7, Psalms 57:10, Psalms 58:3, Psalms 63:6, Psalms 63:9, Psalms 64:4, Psalms 69:19, Psalms 78:15, Psalms 78:37, Psalms 80:2, Psalms 81:8, Psalms 81:9, Psalms 89:29, Psalms 90:6, Psalms 92:1, Psalms 94:9, Psalms 103:4, Psalms 103:8, Psalms 104:32, Psalms 106:8, Psalms 107:9, Psalms 107:12, Psalms 113:3, Psalms 115:18, Psalms 119:46, Psalms 119:159, Psalms 119:169, Psalms 132:5, Psalms 142:1, Psalms 143:6, Psalms 144:3, Psalms 145:8, Psalms 150:2, Proverbs 3:5, Proverbs 3:12, Proverbs 5:13, Proverbs 8:28, Proverbs 9:12, Proverbs 10:18, Proverbs 11:30, Proverbs 12:5, Proverbs 14:1, Proverbs 14:6, Proverbs 15:13, Proverbs 17:4, Proverbs 17:11, Proverbs 18:15, Proverbs 19:9, Proverbs 19:14, Proverbs 19:22, Proverbs 20:25, Proverbs 21:16, Proverbs 22:10, Proverbs 23:8, Proverbs 25:14, Proverbs 26:13, Proverbs 27:11, Proverbs 29:22, Proverbs 30:10, Ecclesiastes 3:3, Ecclesiastes 6:4, Ecclesiastes 9:13, Ecclesiastes 10:19, Isaiah 1:27, Isaiah 1:30, Isaiah 9:13, Isaiah 21:6, Isaiah 37:37, Isaiah 42:23, Isaiah 60:3, Jeremiah 8:15, Ezekiel 7:6, Ezekiel 35:14, Ezekiel 40:41, Amos 1:7, Amos 1:12, Amos 8:4, Micah 2:5, Micah 5:15, Habakkuk 2:11, Matthew 5:40, Matthew 8:15, Matthew 8:21, Matthew 16:5, Matthew 18:4, Matthew 18:33, Matthew 21:36, Matthew 23:33, Matthew 25:42, Matthew 26:19, Mark 3:20, Mark 6:1, Mark 6:47, Mark 9:8, Mark 10:18, Mark 10:22, Mark 14:45, Mark 15:22, Luke 12:16, Luke 17:35, Luke 18:19, Luke 22:33, Luke 23:43, Luke 24:50, John 2:19, John 2:24, John 2:25, John 5:27, John 12:5, John 15:27, John 19:37, Acts 5:11, Acts 6:6, Acts 7:9, Acts 7:59, Acts 11:15, Acts 12:16, Acts 16:35, Acts 20:37, Acts 21:10, Acts 23:24, Acts 27:19, Romans 9:28, Romans 10:1, 1 Corinthians 11:28, 1 Corinthians 13:7, 1 Corinthians 14:31, Galatians 3:9, Galatians 5:16, Ephesians 1:6, Ephesians 4:12, 1 Thessalonians 5:4, 1 Thessalonians 5:7, 1 Timothy 1:6, 1 Timothy 6:18, 2 Timothy 1:14, Titus 1:8, Philemon 1:10, Hebrews 2:15, Hebrews 2:16, Hebrews 10:13, 1 John 3:19, 1 John 4:15, Revelation 12:2, Revelation 22:13, Genesis 4:20, Genesis 11:17, Genesis 24:25, Genesis 26:16, Genesis 27:35, Genesis 28:21, Genesis 37:30, Genesis 38:10, Genesis 38:15, Genesis 45:25, Exodus 9:32, Exodus 10:20, Exodus 28:2, Exodus 28:5, Exodus 30:28, Exodus 30:35, Leviticus 5:5, Leviticus 9:20, Numbers 9:16, Numbers 11:27, Numbers 15:16, Numbers 26:39, Numbers 30:10, Numbers 34:19, Deuteronomy 2:11, Deuteronomy 21:12, Deuteronomy 24:9, Joshua 4:1, Joshua 15:32, Joshua 15:54, Joshua 21:42, Judges 4:4, Judges 9:39, Judges 10:13, 1 Samuel 4:15, 1 Samuel 10:7, 1 Samuel 14:25, 1 Samuel 18:12, 1 Samuel 23:21, 2 Samuel 8:9, 2 Samuel 10:1, 2 Samuel 18:10, 2 Samuel 20:20, 2 Samuel 22:4, 2 Samuel 22:36, 1 Kings 1:18, 1 Kings 7:4, 1 Kings 16:17, 1 Kings 20:3, 1 Kings 22:21, 1 Kings 22:37, 2 Kings 1:5, 2 Kings 2:22, 1 Chronicles 3:10, 1 Chronicles 7:13, 1 Chronicles 27:33, 2 Chronicles 26:12, Nehemiah 13:12, Job 4:6, Job 4:7, Job 4:9, Job 11:16, Job 14:15, Job 14:18, Job 15:11, Job 16:19, Job 20:9, Job 20:15, Job 22:4, Job 23:11, Job 24:19, Job 29:2, Job 29:18, Job 31:2, Job 32:1, Job 32:19, Job 34:31, Job 35:8, Job 37:19, Job 37:24, Job 38:14, Job 39:21, Job 40:10, Psalms 4:7, Psalms 8:4, Psalms 18:3, Psalms 21:5, Psalms 22:5, Psalms 26:8, Psalms 27:8, Psalms 33:11, Psalms 34:6, Psalms 37:21, Psalms 41:11, Psalms 44:11, Psalms 49:15, Psalms 49:17, Psalms 49:19, Psalms 55:20, Psalms 66:16, Psalms 68:15, Psalms 69:12, Psalms 71:17, Psalms 72:3, Psalms 72:8, Psalms 76:12, Psalms 78:1, Psalms 83:8, Psalms 85:4, Psalms 85:5, Psalms 86:8, Psalms 89:10, Psalms 92:13, Psalms 94:10, Psalms 104:11, Psalms 104:20, Psalms 105:24, Psalms 107:25, Psalms 107:41, Psalms 116:2, Psalms 118:7, Psalms 119:123, Psalms 119:144, Psalms 132:9, Psalms 135:1, Psalms 136:9, Psalms 139:20, Psalms 141:9, Psalms 144:9, Psalms 147:18, Proverbs 2:10, Proverbs 2:21, Proverbs 3:19, Proverbs 4:1, Proverbs 5:3, Proverbs 8:22, Proverbs 11:19, Proverbs 12:17, Proverbs 15:2, Proverbs 15:18, Proverbs 16:11, Proverbs 16:24, Proverbs 17:10, Proverbs 18:5, Proverbs 19:27, Proverbs 21:26, Proverbs 22:3, Proverbs 23:17, Proverbs 25:1, Proverbs 27:2, Proverbs 27:12, Proverbs 28:9, Proverbs 28:25, Proverbs 30:12, Proverbs 30:26, Ecclesiastes 8:4, Ecclesiastes 10:12, Isaiah 19:5, Isaiah 22:6, Isaiah 22:19, Isaiah 63:13, Jeremiah 38:21, Jeremiah 50:10, Lamentations 3:30, Ezekiel 27:4, Ezekiel 30:2, Ezekiel 32:5, Ezekiel 32:11, Ezekiel 41:10, Daniel 1:9, Daniel 3:30, Daniel 9:9, Hosea 3:2, Hosea 9:11, Joel 3:21, Amos 1:10, Habakkuk 1:7, Zechariah 2:1, Zechariah 6:3, Zechariah 12:14, Matthew 1:25, Matthew 4:5, Matthew 5:36, Matthew 5:37, Matthew 7:28, Matthew 9:5, Matthew 12:37, Matthew 18:24, Matthew 20:3, Matthew 21:40, Matthew 22:5, Matthew 27:2, Matthew 27:45, Mark 4:6, Mark 4:26, Mark 6:29, Mark 9:23, Mark 11:7, Mark 13:26, Luke 1:10, Luke 5:23, Luke 8:56, Luke 9:37, Luke 12:2, Luke 13:30, Luke 17:16, Luke 21:3, Luke 21:32, John 3:32, John 4:7, John 4:44, John 8:10, John 11:17, John 11:21, John 12:11, John 17:19, John 20:9, John 20:24, Acts 4:35, Acts 6:10, Acts 10:25, Acts 10:29, Acts 11:2, Acts 13:23, Acts 16:21, Acts 19:3, Acts 20:26, Romans 3:2, Romans 6:11, Romans 10:2, Romans 11:10, Romans 15:11, Romans 15:32, 1 Corinthians 12:18, 1 Corinthians 15:13, 1 Corinthians 15:46, 1 Corinthians 15:51, 2 Corinthians 3:17, 2 Corinthians 11:33, Galatians 4:5, Galatians 6:17, Ephesians 4:2, Ephesians 4:11, Ephesians 5:25, Ephesians 5:32, Philippians 1:8, Colossians 3:4, 1 Thessalonians 2:18, 1 Thessalonians 5:27, 2 Thessalonians 1:6, 1 Timothy 4:15, Titus 1:2, Hebrews 3:14, Hebrews 6:5, Hebrews 11:1, James 4:3, 1 Peter 5:4, 2 Peter 1:13, Genesis 1:4, Genesis 2:15, Genesis 3:21, Genesis 5:13, Genesis 5:16, Genesis 6:1, Genesis 9:26, Genesis 11:15, Genesis 11:23, Genesis 11:25, Genesis 21:3, Genesis 25:33, Genesis 26:17, Genesis 26:19, Genesis 39:7, Genesis 41:4, Genesis 44:11, Genesis 50:9, Exodus 5:20, Exodus 6:11, Exodus 12:32, Exodus 12:49, Exodus 31:9, Exodus 34:13, Exodus 36:31, Exodus 40:7, Leviticus 13:9, Leviticus 19:11, Leviticus 24:4, Leviticus 25:12, Leviticus 25:19, Numbers 7:48, Numbers 12:16, Numbers 16:24, Numbers 23:25, Numbers 29:40, Numbers 31:51, Numbers 33:50, Deuteronomy 2:16, Deuteronomy 5:4, Deuteronomy 8:12, Deuteronomy 14:22, Deuteronomy 22:23, Deuteronomy 32:26, Deuteronomy 32:29, Deuteronomy 34:7, Joshua 6:12, Joshua 9:3, Joshua 15:60, 1 Samuel 6:16, 1 Samuel 17:16, 1 Samuel 20:10, 1 Samuel 21:12, 1 Samuel 30:18, 2 Samuel 3:5, 2 Samuel 5:10, 2 Samuel 18:30, 1 Kings 2:41, 1 Kings 5:10, 1 Kings 5:15, 1 Kings 8:60, 1 Kings 17:4, 1 Kings 22:14, 2 Kings 12:14, 2 Kings 17:12, 2 Kings 21:20, 2 Kings 23:1, 1 Chronicles 2:26, 1 Chronicles 8:12, 1 Chronicles 9:7, 1 Chronicles 12:34, 1 Chronicles 14:3, 1 Chronicles 16:32, 1 Chronicles 16:34, 1 Chronicles 26:5, 1 Chronicles 27:19, 1 Chronicles 27:22, 2 Chronicles 8:4, 2 Chronicles 19:5, 2 Chronicles 20:28, 2 Chronicles 29:26, Ezra 10:22, Ezra 10:44, Nehemiah 6:4, Nehemiah 10:1, Nehemiah 10:9, Nehemiah 13:23, Esther 1:21, Job 6:15, Job 6:20, Job 7:19, Job 9:11, Job 10:12, Job 10:20, Job 11:2, Job 12:25, Job 14:17, Job 18:14, Job 22:24, Job 22:27, Job 23:14, Job 28:5, Job 29:14, Job 30:16, Job 30:27, Job 31:21, Job 32:8, Job 33:12, Job 33:30, Job 34:27, Job 36:26, Job 36:29, Job 38:37, Job 39:5, Job 39:10, Job 40:4, Psalms 1:6, Psalms 7:12, Psalms 7:16, Psalms 9:8, Psalms 18:11, Psalms 18:38, Psalms 24:8, Psalms 29:11, Psalms 35:18, Psalms 37:19, Psalms 44:16, Psalms 50:18, Psalms 55:14, Psalms 59:1, Psalms 60:8, Psalms 68:25, Psalms 69:32, Psalms 69:33, Psalms 72:7, Psalms 74:22, Psalms 78:32, Psalms 78:54, Psalms 81:15, Psalms 85:11, Psalms 89:42, Psalms 90:11, Psalms 90:16, Psalms 93:5, Psalms 94:12, Psalms 95:4, Psalms 96:5, Psalms 102:10, Psalms 102:19, Psalms 103:19, Psalms 104:8, Psalms 105:11, Psalms 105:33, Psalms 106:31, Psalms 107:1, Psalms 108:9, Psalms 109:13, Psalms 114:7, Psalms 116:17, Psalms 118:1, Psalms 118:29, Psalms 119:34, Psalms 119:72, Psalms 119:87, Psalms 132:10, Psalms 136:12, Psalms 138:1, Psalms 146:4, Psalms 146:10, Proverbs 1:12, Proverbs 7:21, Proverbs 9:2, Proverbs 10:8, Proverbs 10:29, Proverbs 12:20, Proverbs 12:24, Proverbs 13:1, Proverbs 17:3, Proverbs 18:10, Proverbs 19:28, Proverbs 20:4, Proverbs 20:20, Proverbs 21:31, Proverbs 22:9, Proverbs 22:27, Proverbs 27:7, Proverbs 29:17, Proverbs 31:27, Ecclesiastes 3:10, Ecclesiastes 5:17, Ecclesiastes 7:23, Ecclesiastes 11:4, Song of Solomon 1:15, Song of Solomon 2:10, Isaiah 9:11, Isaiah 19:15, Isaiah 23:5, Isaiah 32:19, Isaiah 40:16, Isaiah 46:5, Jeremiah 18:2, Jeremiah 30:13, Jeremiah 31:11, Jeremiah 41:17, Jeremiah 48:30, Lamentations 5:9, Lamentations 5:13, Lamentations 5:21, Ezekiel 21:16, Ezekiel 23:31, Ezekiel 36:9, Ezekiel 37:17, Ezekiel 39:22, Ezekiel 43:6, Ezekiel 48:2, Daniel 5:22, Hosea 2:4, Hosea 5:2, Hosea 6:7, Hosea 9:2, Hosea 12:3, Habakkuk 1:14, Zechariah 8:5, Zechariah 9:2, Zechariah 12:9, Matthew 4:1, Matthew 8:19, Matthew 9:24, Matthew 9:37, Matthew 12:30, Matthew 13:56, Matthew 15:18, Matthew 19:22, Matthew 21:35, Matthew 22:43, Matthew 26:21, Mark 1:11, Mark 4:4, Mark 5:3, Mark 11:20, Mark 14:15, Mark 14:63, Luke 2:16, Luke 7:13, Luke 8:40, Luke 9:51, Luke 11:23, Luke 12:17, Luke 12:40, Luke 14:34, Luke 21:27, Luke 22:3, Luke 23:18, Luke 24:38, John 4:54, John 6:33, John 7:40, John 8:49, John 9:28, John 11:43, John 13:30, John 15:13, John 20:5, Acts 4:5, Acts 24:17, Acts 27:42, Romans 1:19, Romans 6:12, Romans 6:15, Romans 14:1, 1 Corinthians 7:24, 1 Corinthians 12:9, 1 Corinthians 13:13, 2 Corinthians 2:11, Galatians 1:15, Philippians 2:11, Philippians 3:14, Colossians 1:29, 2 Thessalonians 2:11, 2 Thessalonians 3:3, 2 Thessalonians 3:11, 2 Timothy 3:3, Philemon 1:20, Hebrews 1:1, Hebrews 9:16, James 5:6, James 5:8, 1 Peter 1:14, 1 Peter 1:19, 1 Peter 4:15, Revelation 5:14, Revelation 14:17, Revelation 15:5, Genesis 14:4, Genesis 18:3, Genesis 21:1, Genesis 21:31, Genesis 25:29, Genesis 32:21, Genesis 32:24, Genesis 41:18, Genesis 42:11, Exodus 1:20, Exodus 4:12, Exodus 8:2, Exodus 9:5, Exodus 13:20, Exodus 20:21, Exodus 24:9, Exodus 24:13, Exodus 25:27, Exodus 28:9, Exodus 29:11, Exodus 29:43, Exodus 30:1, Exodus 30:24, Exodus 35:33, Exodus 39:2, Exodus 39:17, Leviticus 8:34, Leviticus 19:37, Leviticus 26:29, Numbers 4:13, Numbers 4:24, Numbers 7:7, Numbers 7:18, Numbers 7:54, Numbers 10:30, Numbers 10:34, Numbers 14:39, Numbers 25:1, Deuteronomy 1:5, Deuteronomy 8:4, Deuteronomy 14:10, Deuteronomy 23:15, Joshua 4:16, Joshua 4:20, Joshua 5:3, Judges 5:5, 1 Samuel 1:27, 1 Samuel 4:11, 1 Samuel 15:25, 2 Samuel 5:21, 2 Samuel 23:37, 1 Kings 6:17, 1 Kings 7:1, 1 Kings 14:25, 1 Kings 22:2, 2 Kings 5:9, 1 Chronicles 2:4, 1 Chronicles 2:10, 1 Chronicles 2:32, 1 Chronicles 2:35, 1 Chronicles 6:56, 1 Chronicles 9:3, 1 Chronicles 11:12, 1 Chronicles 11:39, 1 Chronicles 12:30, 1 Chronicles 13:1, 1 Chronicles 16:18, 1 Chronicles 16:28, 1 Chronicles 17:26, 1 Chronicles 18:2, 2 Chronicles 1:7, 2 Chronicles 3:6, 2 Chronicles 10:3, 2 Chronicles 24:15, Nehemiah 4:9, Job 3:18, Job 3:21, Job 5:6, Job 6:30, Job 9:5, Job 19:17, Job 19:28, Job 20:11, Job 20:21, Job 21:29, Job 22:29, Job 23:8, Job 24:3, Job 31:15, Job 31:25, Job 36:21, Job 37:3, Job 38:5, Job 40:8, Psalms 7:1, Psalms 13:5, Psalms 27:13, Psalms 34:8, Psalms 34:21, Psalms 35:21, Psalms 35:28, Psalms 41:3, Psalms 41:12, Psalms 46:3, Psalms 49:4, Psalms 58:4, Psalms 68:20, Psalms 68:26, Psalms 68:34, Psalms 69:17, Psalms 71:2, Psalms 71:9, Psalms 72:6, Psalms 74:18, Psalms 74:21, Psalms 75:4, Psalms 75:6, Psalms 77:14, Psalms 78:40, Psalms 80:18, Psalms 83:2, Psalms 84:5, Psalms 88:15, Psalms 89:32, Psalms 89:38, Psalms 91:3, Psalms 95:8, Psalms 96:4, Psalms 104:16, Psalms 105:41, Psalms 106:4, Psalms 106:29, Psalms 107:38, Psalms 109:10, Psalms 116:19, Psalms 119:58, Psalms 119:96, Psalms 119:124, Psalms 124:3, Psalms 135:11, Psalms 149:6, Proverbs 4:12, Proverbs 6:31, Proverbs 7:18, Proverbs 8:9, Proverbs 8:26, Proverbs 10:2, Proverbs 10:28, Proverbs 11:18, Proverbs 12:8, Proverbs 16:1, Proverbs 16:13, Proverbs 17:6, Proverbs 21:6, Proverbs 21:21, Proverbs 28:22, Proverbs 31:6, Proverbs 31:18, Ecclesiastes 7:9, Ecclesiastes 12:10, Song of Solomon 3:1, Isaiah 9:15, Isaiah 10:11, Isaiah 25:3, Isaiah 26:3, Isaiah 37:18, Isaiah 55:4, Isaiah 60:1, Jeremiah 2:12, Jeremiah 4:12, Jeremiah 10:24, Jeremiah 20:18, Jeremiah 32:34, Jeremiah 51:4, Ezekiel 20:49, Ezekiel 32:19, Ezekiel 40:30, Hosea 7:11, Hosea 9:14, Hosea 12:13, Joel 1:16, Amos 2:5, Amos 5:13, Micah 1:10, Habakkuk 1:9, Zechariah 1:13, Zechariah 6:4, Malachi 3:6, Matthew 10:40, Matthew 12:48, Matthew 13:29, Matthew 15:13, Matthew 16:6, Matthew 17:19, Matthew 20:9, Matthew 21:10, Matthew 22:9, Matthew 23:12, Matthew 24:33, Matthew 27:13, Mark 1:14, Mark 4:27, Mark 6:49, Mark 6:53, Luke 1:74, Luke 2:11, Luke 7:10, Luke 7:31, Luke 7:45, Luke 13:18, Luke 21:10, Luke 22:13, Luke 23:4, John 1:26, John 1:49, John 2:17, John 3:13, John 3:25, John 4:51, John 8:43, John 8:46, John 12:18, John 13:11, John 13:15, John 16:10, Acts 9:14, Acts 9:29, Acts 16:5, Acts 17:8, Acts 17:9, Acts 21:18, Acts 26:28, Acts 27:18, Acts 28:30, Romans 4:1, Romans 6:14, Romans 7:19, Romans 8:12, Romans 10:7, Romans 12:5, Romans 14:2, 1 Corinthians 9:6, 1 Corinthians 9:23, 1 Corinthians 14:33, 1 Corinthians 16:9, 2 Corinthians 6:3, Ephesians 1:12, Colossians 3:14, 1 Thessalonians 2:7, 1 Timothy 6:7, 2 Timothy 2:16, Hebrews 7:4, James 2:20, James 5:19, 1 Peter 4:8, 1 John 4:21, 1 John 5:19, Revelation 19:3, Revelation 19:16, Genesis 2:6, Genesis 5:26, Genesis 7:9, Genesis 8:14, Genesis 8:16, Genesis 21:9, Genesis 24:64, Genesis 37:5, Genesis 37:31, Genesis 40:2, Genesis 41:16, Exodus 2:21, Exodus 15:14, Exodus 32:14, Exodus 33:21, Exodus 37:21, Leviticus 7:23, Leviticus 10:5, Leviticus 11:6, Leviticus 11:41, Leviticus 14:57, Leviticus 24:15, Numbers 6:6, Numbers 7:36, Numbers 8:18, Numbers 10:20, Numbers 16:25, Numbers 20:23, Numbers 26:1, Numbers 27:23, Deuteronomy 1:6, Deuteronomy 1:23, Deuteronomy 32:1, Joshua 7:4, Joshua 15:20, Joshua 19:24, Judges 1:36, Judges 2:5, 1 Samuel 7:5, 1 Samuel 15:7, 1 Samuel 16:9, 2 Samuel 15:1, 2 Samuel 16:7, 2 Samuel 22:41, 1 Kings 1:16, 1 Kings 2:21, 1 Kings 4:22, 1 Kings 6:13, 1 Kings 15:28, 1 Kings 22:5, 2 Kings 20:4, 1 Chronicles 2:46, 1 Chronicles 6:74, 1 Chronicles 11:26, 2 Chronicles 17:12, 2 Chronicles 18:4, Job 3:10, Job 3:24, Job 4:11, Job 5:15, Job 5:26, Job 6:26, Job 7:2, Job 7:16, Job 9:3, Job 9:15, Job 11:7, Job 15:9, Job 15:31, Job 21:18, Job 22:14, Job 24:6, Job 25:4, Job 27:12, Job 28:18, Job 29:6, Job 29:16, Job 30:23, Job 30:28, Job 31:20, Job 31:32, Job 31:33, Job 34:17, Job 38:16, Job 38:20, Job 38:33, Job 39:13, Job 41:5, Psalms 1:2, Psalms 5:6, Psalms 7:2, Psalms 16:9, Psalms 20:3, Psalms 25:6, Psalms 33:17, Psalms 34:19, Psalms 35:5, Psalms 36:5, Psalms 36:11, Psalms 37:6, Psalms 38:13, Psalms 38:19, Psalms 42:2, Psalms 45:5, Psalms 48:5, Psalms 48:11, Psalms 51:7, Psalms 55:10, Psalms 55:17, Psalms 56:6, Psalms 68:12, Psalms 73:9, Psalms 78:52, Psalms 85:9, Psalms 91:9, Psalms 104:6, Psalms 105:35, Psalms 107:14, Psalms 107:22, Psalms 109:11, Psalms 109:12, Psalms 111:4, Psalms 112:4, Psalms 119:41, Psalms 119:43, Psalms 120:3, Psalms 125:4, Psalms 130:2, Psalms 132:17, Psalms 136:5, Psalms 136:14, Psalms 136:23, Psalms 139:18, Psalms 143:2, Psalms 144:1, Psalms 145:10, Psalms 145:19, Psalms 146:6, Psalms 149:3, Proverbs 3:10, Proverbs 3:24, Proverbs 3:27, Proverbs 4:19, Proverbs 6:29, Proverbs 6:30, Proverbs 8:8, Proverbs 11:25, Proverbs 11:27, Proverbs 12:7, Proverbs 14:8, Proverbs 14:11, Proverbs 15:16, Proverbs 16:4, Proverbs 16:7, Proverbs 16:23, Proverbs 19:5, Proverbs 19:8, Proverbs 21:20, Proverbs 22:19, Proverbs 27:3, Proverbs 29:6, Proverbs 29:24, Proverbs 31:16, Ecclesiastes 1:18, Ecclesiastes 7:5, Ecclesiastes 10:9, Ecclesiastes 10:16, Song of Solomon 4:5, Song of Solomon 4:13, Isaiah 3:2, Isaiah 5:22, Isaiah 10:9, Isaiah 11:5, Isaiah 13:6, Isaiah 24:19, Isaiah 28:14, Isaiah 33:10, Jeremiah 2:29, Jeremiah 17:9, Jeremiah 26:14, Jeremiah 29:20, Jeremiah 39:15, Ezekiel 6:2, Ezekiel 16:24, Ezekiel 16:50, Ezekiel 18:10, Ezekiel 26:1, Ezekiel 48:27, Hosea 4:4, Amos 2:13, Amos 5:24, Micah 7:11, Nahum 3:2, Zephaniah 1:2, Zechariah 5:7, Matthew 5:43, Matthew 10:33, Matthew 11:9, Matthew 14:12, Matthew 14:27, Matthew 14:28, Matthew 23:22, Matthew 25:46, Mark 1:32, Mark 3:10, Mark 4:10, Mark 8:18, Mark 12:20, Mark 14:24, Mark 15:10, Luke 1:7, Luke 1:52, Luke 3:12, Luke 5:11, Luke 7:26, Luke 8:46, Luke 11:6, Luke 19:39, Luke 22:31, Luke 22:64, Luke 23:31, John 6:50, John 10:7, John 10:8, John 10:35, John 12:43, Acts 2:5, Acts 3:1, Acts 4:22, Acts 8:21, Acts 9:5, Acts 10:34, Acts 10:35, Acts 12:1, Acts 22:17, Acts 27:6, Romans 9:19, Romans 15:29, 1 Corinthians 3:11, 1 Corinthians 8:2, 1 Corinthians 11:13, 1 Corinthians 12:31, 1 Corinthians 14:17, 1 Corinthians 14:39, 1 Corinthians 15:19, 1 Corinthians 15:35, 2 Corinthians 2:2, 2 Corinthians 4:8, Galatians 6:7, Galatians 6:15, Ephesians 2:22, Ephesians 3:13, Philippians 3:6, Colossians 4:18, 1 Timothy 4:7, 1 Timothy 5:25, 2 Timothy 2:11, Titus 2:15, Philemon 1:2, Philemon 1:8, Hebrews 4:8, Hebrews 11:30, Hebrews 12:6, James 3:8, James 5:13, 3 John 1:7, Genesis 4:3, Genesis 18:4, Genesis 19:27, Genesis 21:6, Genesis 22:24, Genesis 25:25, Genesis 44:21, Exodus 6:24, Exodus 12:44, Exodus 18:15, Exodus 20:6, Exodus 21:7, Exodus 23:26, Exodus 28:20, Exodus 31:2, Exodus 35:10, Exodus 35:20, Exodus 38:5, Leviticus 13:16, Leviticus 19:24, Leviticus 23:42, Leviticus 26:38, Numbers 2:14, Numbers 4:18, Numbers 4:20, Numbers 10:16, Numbers 10:26, Numbers 10:27, Numbers 13:11, Numbers 14:21, Numbers 26:41, Numbers 33:37, Deuteronomy 5:10, Deuteronomy 22:20, Deuteronomy 28:23, Joshua 4:22, Joshua 18:18, Joshua 19:40, Judges 3:26, Judges 9:55, Ruth 3:8, 1 Samuel 2:24, 1 Samuel 5:1, 1 Samuel 14:35, 1 Samuel 14:42, 1 Samuel 18:20, 1 Samuel 22:16, 1 Samuel 31:11, 2 Samuel 3:2, 2 Samuel 11:6, 2 Samuel 14:28, 2 Samuel 15:37, 2 Samuel 17:5, 2 Samuel 21:11, 2 Samuel 22:50, 1 Kings 2:25, 1 Kings 4:11, 1 Kings 8:10, 1 Kings 11:3, 1 Kings 11:35, 1 Kings 12:26, 1 Kings 14:12, 1 Kings 18:14, 1 Kings 20:24, 2 Kings 21:23, 1 Chronicles 4:37, 1 Chronicles 11:42, 1 Chronicles 16:15, 1 Chronicles 23:3, 1 Chronicles 28:16, 2 Chronicles 18:1, 2 Chronicles 29:4, Nehemiah 2:4, Nehemiah 6:15, Esther 9:11, Job 2:9, Job 4:4, Job 5:22, Job 6:9, Job 6:11, Job 8:8, Job 8:11, Job 10:7, Job 13:26, Job 14:6, Job 15:2, Job 15:15, Job 17:3, Job 18:5, Job 18:15, Job 19:8, Job 19:20, Job 20:5, Job 20:10, Job 24:8, Job 29:10, Job 31:29, Job 35:7, Job 37:2, Psalms 4:4, Psalms 10:13, Psalms 16:3, Psalms 17:6, Psalms 18:37, Psalms 21:11, Psalms 29:8, Psalms 35:3, Psalms 35:7, Psalms 37:37, Psalms 48:1, Psalms 50:15, Psalms 52:1, Psalms 58:6, Psalms 60:1, Psalms 66:5, Psalms 69:7, Psalms 73:5, Psalms 77:10, Psalms 78:17, Psalms 78:30, Psalms 80:14, Psalms 89:37, Psalms 90:8, Psalms 90:9, Psalms 94:15, Psalms 97:9, Psalms 98:6, Psalms 102:12, Psalms 103:12, Psalms 105:36, Psalms 106:42, Psalms 107:10, Psalms 110:2, Psalms 114:1, Psalms 115:16, Psalms 116:8, Psalms 119:119, Psalms 119:157, Psalms 129:2, Psalms 135:6, Psalms 136:10, Psalms 138:6, Psalms 145:5, Psalms 149:1, Proverbs 1:18, Proverbs 3:14, Proverbs 5:22, Proverbs 8:3, Proverbs 8:11, Proverbs 9:14, Proverbs 11:12, Proverbs 11:23, Proverbs 13:3, Proverbs 13:20, Proverbs 18:17, Proverbs 19:12, Proverbs 19:17, Proverbs 19:18, Proverbs 19:24, Proverbs 20:1, Proverbs 20:3, Proverbs 21:12, Proverbs 21:17, Proverbs 24:17, Proverbs 25:6, Ecclesiastes 6:5, Isaiah 7:15, Isaiah 7:24, Isaiah 10:28, Isaiah 13:15, Isaiah 14:14, Isaiah 24:9, Jeremiah 2:4, Jeremiah 13:2, Jeremiah 25:24, Jeremiah 36:5, Ezekiel 1:2, Ezekiel 5:3, Ezekiel 11:8, Ezekiel 16:21, Ezekiel 18:3, Ezekiel 28:6, Ezekiel 48:7, Ezekiel 48:23, Daniel 3:11, Daniel 4:29, Daniel 11:3, Micah 6:13, Habakkuk 1:11, Matthew 4:9, Matthew 12:50, Matthew 13:4, Matthew 13:46, Matthew 20:2, Matthew 21:7, Matthew 22:2, Matthew 23:19, Matthew 27:35, Matthew 27:65, Mark 3:23, Mark 4:2, Mark 6:23, Mark 9:3, Mark 9:24, Mark 11:5, Luke 1:30, Luke 2:14, Luke 9:47, Luke 10:15, Luke 11:45, Luke 13:23, Luke 15:19, Luke 20:8, Luke 22:38, Luke 22:69, Luke 24:31, John 6:46, John 7:41, John 8:57, John 12:15, John 16:5, John 16:29, Acts 2:26, Acts 5:14, Acts 9:20, Acts 10:46, Acts 12:5, Acts 15:9, Acts 18:4, Acts 26:30, Romans 5:8, Romans 11:36, Romans 16:13, 1 Corinthians 14:36, Galatians 3:29, Ephesians 5:18, Ephesians 5:26, Ephesians 6:15, 1 Thessalonians 1:2, 1 Thessalonians 5:18, 2 Thessalonians 3:5, 1 Timothy 2:6, Hebrews 1:7, Hebrews 4:10, Hebrews 5:9, Hebrews 10:14, James 1:10, James 2:26, 1 John 5:11, 1 John 5:12, Genesis 3:2, Genesis 11:11, Genesis 13:17, Genesis 17:24, Genesis 19:24, Genesis 27:10, Genesis 28:19, Genesis 37:24, Genesis 38:13, Exodus 4:29, Exodus 11:4, Exodus 14:15, Exodus 32:33, Exodus 36:21, Leviticus 21:4, Leviticus 22:20, Leviticus 23:7, Leviticus 23:25, Numbers 1:54, Numbers 4:4, Numbers 10:36, Numbers 11:19, Numbers 11:35, Numbers 15:34, Numbers 22:10, Numbers 22:21, Numbers 26:31, Numbers 26:32, Numbers 26:50, Numbers 27:16, Numbers 28:18, Numbers 29:23, Numbers 29:26, Deuteronomy 1:40, Deuteronomy 13:1, Deuteronomy 19:20, Judges 9:47, Judges 9:53, Judges 13:25, Judges 17:6, Judges 21:25, 1 Samuel 21:3, 1 Samuel 24:5, 2 Samuel 2:20, 2 Samuel 15:17, 2 Samuel 17:24, 2 Samuel 23:24, 1 Kings 2:16, 1 Kings 5:13, 1 Kings 6:36, 2 Kings 21:22, 1 Chronicles 4:13, 1 Chronicles 7:24, 1 Chronicles 9:21, 1 Chronicles 10:5, 1 Chronicles 16:8, 1 Chronicles 19:1, 1 Chronicles 26:18, 1 Chronicles 26:19, 2 Chronicles 15:7, 2 Chronicles 17:17, 2 Chronicles 32:16, Ezra 1:9, Ezra 7:8, Nehemiah 9:9, Job 3:3, Job 11:17, Job 12:15, Job 12:23, Job 15:16, Job 16:21, Job 17:14, Job 18:19, Job 20:19, Job 22:20, Job 26:3, Job 26:8, Job 27:19, Job 30:3, Job 30:6, Job 31:14, Job 32:14, Job 33:9, Job 37:5, Job 38:13, Job 38:29, Psalms 9:11, Psalms 11:7, Psalms 13:1, Psalms 17:13, Psalms 18:12, Psalms 18:42, Psalms 21:6, Psalms 22:9, Psalms 24:5, Psalms 25:2, Psalms 28:9, Psalms 31:3, Psalms 33:2, Psalms 34:10, Psalms 36:3, Psalms 38:11, Psalms 41:1, Psalms 41:4, Psalms 41:13, Psalms 44:8, Psalms 44:13, Psalms 44:19, Psalms 56:9, Psalms 68:10, Psalms 68:24, Psalms 73:25, Psalms 76:7, Psalms 78:13, Psalms 86:2, Psalms 89:28, Psalms 91:1, Psalms 91:6, Psalms 94:17, Psalms 94:21, Psalms 96:7, Psalms 99:9, Psalms 104:2, Psalms 104:18, Psalms 105:1, Psalms 106:14, Psalms 106:27, Psalms 106:28, Psalms 106:32, Psalms 119:83, Psalms 119:99, Psalms 119:148, Psalms 140:6, Psalms 142:5, Psalms 145:4, Psalms 145:6, Psalms 147:10, Psalms 148:6, Proverbs 7:22, Proverbs 10:23, Proverbs 11:7, Proverbs 12:3, Proverbs 14:26, Proverbs 14:28, Proverbs 15:21, Proverbs 15:26, Proverbs 17:19, Proverbs 18:4, Proverbs 22:17, Proverbs 23:13, Proverbs 23:31, Proverbs 26:20, Proverbs 28:26, Proverbs 29:13, Proverbs 29:20, Ecclesiastes 4:6, Ecclesiastes 4:14, Ecclesiastes 8:6, Ecclesiastes 12:7, Isaiah 5:3, Isaiah 10:19, Isaiah 33:3, Isaiah 33:17, Isaiah 38:22, Isaiah 49:17, Isaiah 62:7, Jeremiah 1:6, Jeremiah 7:19, Jeremiah 38:24, Jeremiah 38:28, Jeremiah 39:12, Jeremiah 48:31, Ezekiel 1:17, Ezekiel 7:23, Ezekiel 11:6, Ezekiel 20:37, Ezekiel 30:23, Daniel 1:12, Daniel 3:4, Daniel 3:8, Daniel 5:4, Daniel 6:28, Hosea 5:11, Hosea 14:1, Hosea 14:4, Amos 3:8, Amos 5:20, Zechariah 11:14, Matthew 3:5, Matthew 5:42, Matthew 6:14, Matthew 8:14, Matthew 9:32, Matthew 15:20, Matthew 17:10, Matthew 17:18, Matthew 18:34, Matthew 20:5, Matthew 20:14, Matthew 22:31, Matthew 23:8, Matthew 25:19, Matthew 26:33, Matthew 26:60, Mark 2:1, Mark 6:13, Mark 7:34, Mark 9:30, Mark 14:34, Mark 15:9, Luke 1:39, Luke 1:63, Luke 1:64, Luke 1:78, Luke 3:35, Luke 4:3, Luke 4:21, Luke 6:19, Luke 10:10, Luke 11:41, Luke 12:32, Luke 14:22, Luke 17:23, Luke 18:2, Luke 18:10, Luke 22:7, Luke 24:6, John 1:3, John 6:70, John 11:13, John 14:16, John 19:3, Acts 4:15, Acts 4:18, Acts 5:7, Acts 5:35, Acts 7:54, Acts 7:57, Acts 13:9, Acts 14:10, Acts 20:17, Acts 22:23, Acts 23:32, Acts 28:1, Romans 1:11, Romans 1:12, Romans 3:3, 1 Corinthians 3:14, 1 Corinthians 5:6, 1 Corinthians 10:9, 1 Corinthians 14:10, 1 Corinthians 15:17, Galatians 2:11, Galatians 4:13, Galatians 5:14, Philippians 1:16, Philippians 3:20, Colossians 3:9, Hebrews 3:8, Hebrews 7:9, Hebrews 7:17, Hebrews 11:39, 2 Peter 1:2, Jude 1:20, Revelation 14:16, Genesis 4:21, Genesis 10:10, Genesis 17:4, Genesis 24:29, Genesis 24:52, Genesis 24:59, Genesis 29:26, Genesis 40:12, Genesis 41:11, Genesis 42:30, Genesis 43:31, Genesis 45:14, Genesis 50:16, Exodus 3:3, Exodus 3:19, Exodus 15:6, Exodus 15:10, Exodus 20:26, Exodus 21:31, Exodus 23:4, Exodus 25:3, Exodus 29:39, Exodus 33:15, Leviticus 7:11, Leviticus 10:2, Leviticus 18:4, Numbers 2:33, Numbers 3:42, Numbers 4:22, Numbers 5:12, Numbers 12:3, Numbers 15:19, Numbers 16:21, Numbers 26:53, Numbers 26:56, Numbers 27:10, Numbers 29:29, Numbers 29:35, Numbers 31:29, Numbers 31:36, Numbers 33:36, Deuteronomy 9:22, Deuteronomy 11:15, Deuteronomy 18:21, Deuteronomy 20:12, Deuteronomy 32:18, Joshua 19:15, Judges 1:23, Judges 2:21, Judges 13:18, 1 Samuel 1:14, 1 Samuel 3:19, 1 Samuel 11:14, 1 Samuel 16:15, 1 Samuel 28:11, 2 Samuel 1:7, 2 Samuel 8:8, 2 Samuel 15:28, 2 Samuel 15:29, 2 Samuel 22:27, 2 Samuel 22:38, 1 Kings 4:4, 1 Kings 4:20, 1 Kings 7:22, 1 Kings 17:15, 1 Chronicles 4:6, 1 Chronicles 4:15, 1 Chronicles 9:15, 1 Chronicles 11:24, 1 Chronicles 13:4, 1 Chronicles 16:12, 1 Chronicles 17:18, 2 Chronicles 7:15, 2 Chronicles 8:17, 2 Chronicles 9:3, 2 Chronicles 32:2, Ezra 5:7, Nehemiah 3:2, Nehemiah 3:9, Esther 4:6, Esther 9:23, Job 4:2, Job 4:5, Job 5:1, Job 11:14, Job 15:22, Job 16:5, Job 17:8, Job 19:5, Job 19:13, Job 21:16, Job 23:7, Job 24:25, Job 27:8, Job 29:23, Job 30:10, Job 34:23, Job 39:1, Job 39:26, Psalms 2:9, Psalms 4:8, Psalms 6:8, Psalms 10:11, Psalms 16:6, Psalms 20:7, Psalms 21:1, Psalms 22:21, Psalms 24:1, Psalms 25:20, Psalms 33:5, Psalms 36:2, Psalms 39:3, Psalms 50:8, Psalms 56:1, Psalms 58:7, Psalms 63:10, Psalms 71:11, Psalms 76:3, Psalms 78:46, Psalms 78:56, Psalms 80:5, Psalms 88:18, Psalms 89:47, Psalms 96:8, Psalms 102:25, Psalms 103:22, Psalms 104:9, Psalms 104:30, Psalms 106:10, Psalms 106:40, Psalms 106:41, Psalms 107:6, Psalms 107:13, Psalms 107:19, Psalms 107:28, Psalms 112:2, Psalms 118:11, Psalms 119:27, Psalms 135:9, Psalms 140:9, Proverbs 1:5, Proverbs 4:5, Proverbs 9:8, Proverbs 10:3, Proverbs 10:31, Proverbs 12:22, Proverbs 15:10, Proverbs 15:15, Proverbs 15:24, Proverbs 17:18, Proverbs 18:1, Proverbs 21:7, Proverbs 21:13, Proverbs 23:9, Proverbs 23:22, Proverbs 24:28, Proverbs 26:6, Proverbs 26:21, Proverbs 29:1, Proverbs 29:15, Proverbs 31:30, Isaiah 1:12, Isaiah 5:18, Isaiah 10:1, Isaiah 16:11, Isaiah 30:7, Isaiah 33:13, Isaiah 37:28, Isaiah 42:20, Isaiah 43:7, Isaiah 55:8, Jeremiah 5:13, Jeremiah 34:6, Jeremiah 46:15, Lamentations 3:14, Ezekiel 1:14, Ezekiel 8:9, Ezekiel 33:18, Ezekiel 39:12, Ezekiel 43:26, Ezekiel 48:3, Ezekiel 48:6, Daniel 2:3, Daniel 8:20, Hosea 6:11, Joel 2:24, Amos 3:13, Jonah 1:15, Micah 7:13, Habakkuk 3:7, Zephaniah 2:6, Haggai 2:20, Zechariah 2:13, Matthew 5:6, Matthew 12:15, Matthew 14:29, Matthew 20:26, Matthew 21:20, Matthew 22:34, Matthew 24:19, Matthew 26:22, Mark 1:28, Mark 1:30, Mark 6:6, Mark 6:19, Mark 7:2, Mark 8:14, Mark 10:4, Mark 13:17, Mark 13:25, Luke 3:28, Luke 3:32, Luke 4:11, Luke 4:12, Luke 9:25, Luke 9:50, Luke 12:6, Luke 13:22, Luke 15:10, Luke 16:14, Luke 18:30, Luke 22:24, Luke 24:4, John 1:10, John 6:38, John 7:51, John 9:40, John 10:15, John 14:5, Acts 1:1, Acts 2:15, Acts 4:8, Acts 9:28, Acts 22:4, Acts 23:2, Acts 27:25, Romans 2:16, Romans 5:3, Romans 16:14, Romans 16:21, 1 Corinthians 1:13, 1 Corinthians 7:8, 1 Corinthians 7:26, 1 Corinthians 11:14, 1 Corinthians 14:1, 2 Corinthians 10:11, Galatians 4:20, Ephesians 1:22, Ephesians 2:6, Ephesians 2:17, Ephesians 3:11, Ephesians 4:21, Ephesians 6:17, Philippians 2:4, 1 Timothy 3:4, 1 Timothy 5:19, Hebrews 2:5, Hebrews 5:4, Hebrews 8:12, Hebrews 13:24, James 3:15, 1 Peter 1:4, 2 Peter 2:7, 1 John 2:23, 1 John 3:4, Revelation 1:10, Revelation 3:16, Revelation 5:7, Revelation 8:2, Revelation 18:18, Genesis 8:7, Genesis 11:13, Genesis 25:3, Genesis 27:16, Genesis 31:44, Genesis 34:9, Genesis 35:23, Genesis 36:9, Genesis 40:21, Genesis 42:23, Genesis 45:2, Genesis 48:12, Genesis 50:18, Exodus 2:8, Exodus 12:38, Exodus 28:24, Exodus 33:23, Exodus 34:19, Leviticus 18:8, Leviticus 25:17, Numbers 3:48, Numbers 4:29, Numbers 10:15, Numbers 11:2, Numbers 11:6, Numbers 14:42, Numbers 22:14, Numbers 23:12, Numbers 29:20, Deuteronomy 7:17, Deuteronomy 13:12, Deuteronomy 21:7, Joshua 16:2, Joshua 21:30, Joshua 21:36, Joshua 22:26, Judges 2:11, Judges 14:1, Judges 21:20, 1 Samuel 4:22, 1 Samuel 17:6, 1 Samuel 28:5, 2 Samuel 3:4, 2 Samuel 6:14, 2 Samuel 12:12, 2 Samuel 21:21, 2 Samuel 22:47, 2 Samuel 23:22, 1 Kings 2:12, 1 Kings 6:37, 1 Kings 11:8, 1 Kings 11:30, 1 Kings 21:9, 2 Kings 8:17, 2 Kings 24:11, 1 Chronicles 5:22, 1 Chronicles 7:17, 1 Chronicles 15:22, 1 Chronicles 20:7, 2 Chronicles 6:40, 2 Chronicles 14:12, 2 Chronicles 20:8, 2 Chronicles 24:2, 2 Chronicles 28:14, 2 Chronicles 34:5, Ezra 4:4, Ezra 10:12, Nehemiah 11:19, Job 1:11, Job 4:21, Job 6:3, Job 7:1, Job 9:27, Job 10:18, Job 12:20, Job 15:14, Job 15:24, Job 19:10, Job 19:21, Job 20:28, Job 23:6, Job 23:17, Job 30:18, Job 33:3, Job 33:25, Job 40:11, Job 41:10, Job 41:26, Psalms 9:12, Psalms 12:2, Psalms 13:3, Psalms 13:4, Psalms 22:8, Psalms 25:12, Psalms 29:2, Psalms 31:15, Psalms 38:4, Psalms 38:16, Psalms 41:9, Psalms 45:16, Psalms 46:5, Psalms 58:1, Psalms 59:10, Psalms 60:5, Psalms 64:9, Psalms 74:13, Psalms 78:45, Psalms 89:49, Psalms 92:10, Psalms 103:10, Psalms 105:5, Psalms 106:6, Psalms 107:11, Psalms 108:6, Psalms 109:19, Psalms 111:8, Psalms 112:8, Psalms 118:26, Psalms 119:23, Psalms 119:88, Psalms 119:133, Psalms 136:6, Psalms 136:16, Psalms 147:20, Proverbs 1:7, Proverbs 2:7, Proverbs 9:18, Proverbs 10:20, Proverbs 10:25, Proverbs 13:24, Proverbs 14:21, Proverbs 16:12, Proverbs 16:21, Proverbs 17:14, Proverbs 18:21, Proverbs 19:6, Proverbs 20:11, Proverbs 20:17, Proverbs 20:29, Proverbs 22:6, Proverbs 25:2, Proverbs 26:9, Proverbs 26:12, Proverbs 26:15, Proverbs 26:17, Proverbs 28:5, Proverbs 28:27, Ecclesiastes 7:1, Ecclesiastes 9:17, Song of Solomon 8:13, Song of Solomon 8:14, Isaiah 5:15, Isaiah 17:7, Isaiah 32:16, Isaiah 33:4, Isaiah 45:22, Isaiah 65:21, Jeremiah 22:1, Jeremiah 23:21, Jeremiah 27:2, Jeremiah 28:7, Jeremiah 49:11, Jeremiah 49:38, Ezekiel 18:32, Ezekiel 24:22, Ezekiel 33:3, Ezekiel 46:10, Ezekiel 48:24, Ezekiel 48:25, Hosea 1:3, Amos 3:7, Amos 5:23, Amos 8:7, Micah 7:15, Nahum 3:11, Zechariah 4:14, Zechariah 10:12, Matthew 2:19, Matthew 6:4, Matthew 8:18, Matthew 10:17, Matthew 10:39, Matthew 12:12, Matthew 13:6, Matthew 15:17, Matthew 15:26, Matthew 23:31, Matthew 24:5, Mark 1:9, Mark 1:26, Mark 1:39, Mark 4:29, Mark 5:37, Mark 6:10, Mark 6:51, Mark 10:5, Mark 15:11, Mark 15:45, Luke 7:1, Luke 9:59, Luke 10:32, Luke 13:9, Luke 14:33, Luke 17:33, Luke 20:24, Luke 23:30, Luke 24:9, John 1:40, John 3:6, John 6:29, John 6:68, John 9:19, John 11:1, John 11:24, John 13:37, John 14:13, John 15:8, John 18:29, Acts 3:14, Acts 6:8, Acts 8:11, Acts 9:19, Acts 11:8, Acts 11:14, Acts 19:15, Acts 19:18, Acts 21:6, Acts 26:15, Romans 2:18, Romans 2:24, Romans 3:24, Romans 12:17, Romans 15:6, Romans 16:11, 1 Corinthians 4:21, 1 Corinthians 8:11, 1 Corinthians 11:12, 1 Corinthians 16:5, 2 Corinthians 1:22, Galatians 2:3, Galatians 3:3, Ephesians 2:21, Colossians 4:15, Hebrews 7:15, Hebrews 9:1, Hebrews 11:24, James 2:22, 1 Peter 4:18, 1 John 2:12, 1 John 4:13, Jude 1:17, Revelation 8:9, Revelation 22:20, Genesis 4:5, Genesis 4:19, Genesis 6:6, Genesis 11:5, Genesis 20:4, Genesis 24:24, Genesis 29:4, Genesis 30:13, Genesis 41:17, Genesis 49:22, Exodus 5:12, Exodus 6:29, Exodus 7:13, Exodus 8:25, Exodus 16:28, Exodus 29:38, Exodus 33:4, Exodus 35:28, Exodus 37:12, Leviticus 1:7, Leviticus 14:46, Leviticus 19:28, Numbers 4:42, Numbers 5:10, Numbers 9:8, Numbers 10:24, Numbers 10:28, Numbers 22:19, Numbers 23:2, Numbers 23:26, Numbers 29:32, Numbers 33:6, Numbers 33:47, Numbers 35:7, Deuteronomy 1:37, Deuteronomy 27:23, Deuteronomy 33:18, Judges 4:1, Judges 11:6, Judges 11:28, Judges 18:11, Ruth 4:2, 1 Samuel 12:16, 1 Samuel 13:1, 1 Samuel 20:32, 1 Samuel 20:40, 2 Samuel 7:3, 2 Samuel 8:16, 2 Samuel 18:15, 1 Kings 1:50, 1 Kings 12:5, 1 Kings 18:3, 2 Kings 1:7, 2 Kings 5:4, 2 Kings 9:31, 2 Kings 21:5, 2 Kings 23:23, 1 Chronicles 12:28, 1 Chronicles 16:30, 2 Chronicles 4:1, 2 Chronicles 25:28, 2 Chronicles 28:2, 2 Chronicles 28:22, 2 Chronicles 33:5, Ezra 5:4, Ezra 9:10, Ezra 10:23, Nehemiah 11:21, Job 1:20, Job 6:23, Job 8:18, Job 20:7, Job 21:20, Job 22:18, Job 27:2, Job 27:7, Job 27:11, Job 31:11, Job 32:16, Job 36:19, Job 38:17, Job 39:6, Psalms 11:1, Psalms 21:2, Psalms 24:6, Psalms 33:8, Psalms 33:16, Psalms 35:1, Psalms 38:10, Psalms 48:13, Psalms 50:22, Psalms 55:18, Psalms 65:7, Psalms 68:9, Psalms 73:15, Psalms 80:15, Psalms 82:1, Psalms 89:39, Psalms 89:46, Psalms 89:51, Psalms 95:1, Psalms 105:8, Psalms 121:8, Psalms 136:15, Proverbs 1:31, Proverbs 4:9, Proverbs 6:25, Proverbs 8:34, Proverbs 10:6, Proverbs 10:26, Proverbs 11:28, Proverbs 12:6, Proverbs 13:11, Proverbs 14:16, Proverbs 16:22, Proverbs 16:30, Proverbs 17:9, Proverbs 25:3, Proverbs 25:19, Proverbs 26:25, Proverbs 27:18, Proverbs 28:23, Proverbs 31:21, Ecclesiastes 7:29, Song of Solomon 1:3, Isaiah 7:5, Isaiah 10:23, Isaiah 23:10, Isaiah 24:3, Isaiah 37:25, Isaiah 45:16, Isaiah 48:15, Isaiah 52:13, Isaiah 57:3, Jeremiah 5:23, Jeremiah 7:17, Jeremiah 10:15, Jeremiah 23:1, Jeremiah 26:17, Jeremiah 37:11, Jeremiah 42:3, Jeremiah 42:12, Jeremiah 51:18, Lamentations 3:48, Ezekiel 3:4, Ezekiel 12:18, Ezekiel 16:9, Ezekiel 24:9, Ezekiel 45:16, Ezekiel 48:5, Ezekiel 48:26, Daniel 6:1, Daniel 6:11, Daniel 8:21, Daniel 11:22, Hosea 2:1, Hosea 4:18, Hosea 8:9, Obadiah 1:21, Micah 5:9, Nahum 2:8, Zechariah 8:20, Matthew 5:31, Matthew 11:2, Matthew 15:39, Matthew 18:27, Matthew 21:34, Matthew 24:34, Matthew 25:8, Mark 4:35, Mark 6:18, Mark 11:14, Mark 13:15, Mark 13:30, Mark 14:20, Mark 14:66, Mark 16:11, Mark 16:15, Luke 4:31, Luke 5:9, Luke 6:11, Luke 8:50, Luke 9:8, Luke 9:35, Luke 10:37, Luke 10:39, Luke 12:51, Luke 19:35, Luke 21:31, Luke 22:6, Luke 22:45, Luke 24:22, Luke 24:26, John 1:7, John 1:43, John 3:14, John 3:27, John 3:34, John 4:22, John 11:19, John 13:32, John 13:35, John 19:33, John 20:22, Acts 4:37, Acts 7:21, Acts 9:7, Acts 10:44, Acts 12:13, Acts 13:35, Acts 13:42, Acts 14:18, Acts 15:19, Acts 16:31, Acts 19:36, Romans 1:1, Romans 2:28, Romans 3:29, Romans 6:10, 1 Corinthians 3:7, 1 Corinthians 4:11, 1 Corinthians 10:6, 1 Corinthians 10:19, 1 Corinthians 11:10, 1 Corinthians 11:21, 1 Corinthians 15:4, 2 Corinthians 5:13, 2 Corinthians 6:1, 2 Corinthians 8:21, 2 Corinthians 8:24, 2 Corinthians 9:14, 2 Corinthians 13:9, Galatians 4:22, Galatians 5:5, Ephesians 1:5, Ephesians 6:20, Philippians 2:7, Colossians 3:25, 1 Thessalonians 4:3, 1 Timothy 2:5, 2 Timothy 3:4, Hebrews 5:2, Hebrews 7:18, James 2:4, James 2:13, 1 John 2:10, Revelation 3:15, Revelation 8:1, Revelation 16:11, Revelation 21:7, Revelation 21:22, Genesis 10:20, Genesis 14:18, Genesis 16:15, Genesis 18:23, Genesis 21:4, Genesis 21:13, Genesis 21:25, Genesis 21:27, Genesis 22:1, Genesis 24:21, Genesis 25:11, Genesis 37:15, Genesis 37:16, Genesis 37:29, Genesis 45:15, Exodus 7:14, Exodus 22:20, Exodus 26:26, Exodus 27:6, Exodus 34:23, Exodus 37:2, Exodus 40:2, Leviticus 7:31, Leviticus 8:12, Leviticus 11:37, Leviticus 13:47, Leviticus 18:12, Leviticus 18:16, Leviticus 19:4, Leviticus 19:12, Leviticus 22:30, Leviticus 23:5, Leviticus 26:10, Numbers 2:7, Numbers 14:15, Numbers 16:31, Numbers 31:18, Numbers 32:24, Numbers 33:49, Numbers 34:7, Deuteronomy 11:27, Deuteronomy 14:9, Deuteronomy 20:2, Deuteronomy 27:21, Joshua 13:26, Joshua 19:17, Joshua 19:38, Joshua 21:23, Joshua 22:1, Judges 2:16, Judges 8:31, Judges 9:17, Judges 11:30, 1 Samuel 5:12, 1 Samuel 8:10, 1 Samuel 9:18, 1 Samuel 12:21, 1 Samuel 16:6, 1 Samuel 16:17, 1 Samuel 29:7, 2 Samuel 7:5, 2 Samuel 7:13, 2 Samuel 14:8, 2 Samuel 17:7, 2 Samuel 22:39, 1 Kings 8:57, 1 Kings 20:26, 2 Kings 6:3, 2 Kings 8:11, 2 Kings 8:22, 2 Kings 10:12, 2 Kings 12:6, 2 Kings 19:27, 1 Chronicles 1:29, 1 Chronicles 11:46, 1 Chronicles 12:31, 1 Chronicles 16:43, 1 Chronicles 18:14, 2 Chronicles 20:36, 2 Chronicles 31:7, Nehemiah 13:8, Esther 1:9, Job 8:22, Job 9:12, Job 17:9, Job 21:8, Job 21:30, Job 22:7, Job 26:2, Job 27:17, Job 30:11, Job 31:22, Job 31:31, Job 37:20, Job 39:2, Job 39:11, Job 40:2, Job 40:12, Job 41:12, Job 42:16, Psalms 2:7, Psalms 11:5, Psalms 18:14, Psalms 21:8, Psalms 22:31, Psalms 32:11, Psalms 33:12, Psalms 37:9, Psalms 37:36, Psalms 37:38, Psalms 41:8, Psalms 54:7, Psalms 56:8, Psalms 66:4, Psalms 68:7, Psalms 73:26, Psalms 75:3, Psalms 76:10, Psalms 78:26, Psalms 78:53, Psalms 78:69, Psalms 86:11, Psalms 88:12, Psalms 89:12, Psalms 89:43, Psalms 92:4, Psalms 92:15, Psalms 95:9, Psalms 104:33, Psalms 107:30, Psalms 110:1, Psalms 125:1, Psalms 141:8, Psalms 143:10, Psalms 147:11, Proverbs 2:22, Proverbs 10:24, Proverbs 12:12, Proverbs 12:27, Proverbs 13:25, Proverbs 16:19, Proverbs 19:2, Proverbs 19:10, Proverbs 19:21, Proverbs 22:12, Proverbs 22:18, Proverbs 24:25, Proverbs 27:21, Proverbs 28:6, Proverbs 28:11, Proverbs 28:28, Proverbs 29:19, Ecclesiastes 2:22, Ecclesiastes 10:8, Ecclesiastes 12:14, Song of Solomon 6:4, Isaiah 2:13, Isaiah 22:10, Isaiah 28:11, Isaiah 28:29, Isaiah 30:11, Isaiah 33:11, Isaiah 33:22, Isaiah 42:8, Isaiah 42:21, Isaiah 49:16, Isaiah 66:7, Jeremiah 6:27, Jeremiah 38:5, Jeremiah 51:61, Ezekiel 16:11, Ezekiel 16:12, Ezekiel 34:31, Ezekiel 37:27, Ezekiel 43:15, Ezekiel 48:4, Daniel 7:15, Hosea 2:22, Zephaniah 3:16, Matthew 1:14, Matthew 8:27, Matthew 9:38, Matthew 13:40, Matthew 14:8, Matthew 20:4, Matthew 28:14, Matthew 28:16, Mark 2:5, Mark 2:7, Mark 3:31, Mark 5:9, Mark 12:29, Mark 12:37, Mark 14:4, Mark 16:2, Luke 1:26, Luke 3:34, Luke 4:5, Luke 5:22, Luke 6:47, Luke 7:7, Luke 7:41, Luke 8:6, Luke 8:20, Luke 10:41, Luke 13:13, Luke 15:16, Luke 18:1, Luke 19:33, Luke 19:48, Luke 22:23, Luke 22:70, John 1:18, John 2:1, John 8:59, John 16:8, John 17:15, John 17:20, John 18:21, John 18:34, John 20:11, Acts 2:7, Acts 3:15, Acts 11:21, Acts 13:20, Acts 13:24, Acts 17:30, Acts 20:29, Acts 25:18, Acts 26:6, Romans 2:10, Romans 4:2, Romans 7:20, Romans 8:6, Romans 12:4, 1 Corinthians 1:25, 1 Corinthians 10:30, 1 Corinthians 11:15, 1 Corinthians 12:2, 1 Corinthians 12:26, 1 Corinthians 15:14, 2 Corinthians 8:16, 2 Corinthians 11:31, Galatians 5:15, Ephesians 4:32, Philippians 2:9, 1 Thessalonians 5:13, 1 Timothy 1:1, 1 Timothy 1:11, 2 Timothy 2:23, 2 Timothy 3:13, Titus 1:13, Philemon 1:21, Hebrews 12:4, Hebrews 13:6, Hebrews 13:19, 1 Peter 2:14, 2 Peter 3:6, 1 John 3:20, Genesis 2:10, Genesis 2:16, Genesis 3:18, Genesis 5:4, Genesis 10:31, Genesis 14:21, Genesis 18:22, Genesis 24:1, Genesis 24:58, Genesis 26:21, Genesis 31:48, Genesis 40:18, Genesis 44:28, Genesis 50:26, Exodus 1:9, Exodus 12:20, Exodus 21:21, Exodus 25:14, Exodus 25:25, Exodus 26:16, Exodus 30:30, Exodus 34:14, Exodus 40:8, Exodus 40:30, Exodus 40:34, Leviticus 4:16, Leviticus 11:5, Leviticus 13:22, Leviticus 26:24, Numbers 2:29, Numbers 10:32, Numbers 16:49, Numbers 23:8, Numbers 27:13, Numbers 28:4, Numbers 32:41, Deuteronomy 6:13, Deuteronomy 13:11, Deuteronomy 22:30, Deuteronomy 26:9, Deuteronomy 27:17, Deuteronomy 30:7, Deuteronomy 30:14, Deuteronomy 32:19, Deuteronomy 33:15, Joshua 4:13, Joshua 10:17, Joshua 10:36, Joshua 13:15, Joshua 21:17, Joshua 24:24, Judges 7:21, Judges 18:31, Ruth 3:6, 1 Samuel 2:2, 1 Samuel 7:4, 1 Samuel 17:27, 1 Samuel 23:8, 2 Samuel 1:11, 2 Samuel 5:25, 2 Samuel 11:26, 2 Samuel 22:42, 2 Samuel 23:14, 1 Kings 8:40, 1 Kings 10:4, 1 Kings 18:20, 1 Kings 21:23, 2 Kings 4:44, 2 Kings 6:24, 2 Kings 24:19, 1 Chronicles 3:9, 1 Chronicles 11:16, 1 Chronicles 26:24, 1 Chronicles 26:27, 2 Chronicles 11:3, 2 Chronicles 20:35, 2 Chronicles 27:3, 2 Chronicles 33:21, Ezra 10:33, Nehemiah 13:20, Job 4:10, Job 5:24, Job 9:16, Job 10:16, Job 30:4, Job 30:24, Job 31:9, Job 35:15, Job 36:5, Job 37:6, Job 38:4, Job 38:22, Job 41:25, Psalms 6:2, Psalms 7:14, Psalms 10:15, Psalms 16:8, Psalms 17:1, Psalms 20:1, Psalms 22:22, Psalms 30:1, Psalms 30:7, Psalms 34:17, Psalms 49:5, Psalms 56:4, Psalms 60:2, Psalms 61:4, Psalms 62:3, Psalms 66:20, Psalms 73:20, Psalms 80:12, Psalms 89:3, Psalms 89:4, Psalms 96:11, Psalms 102:15, Psalms 108:4, Psalms 113:9, Psalms 139:21, Proverbs 1:32, Proverbs 1:33, Proverbs 3:32, Proverbs 8:27, Proverbs 13:7, Proverbs 13:23, Proverbs 14:2, Proverbs 14:27, Proverbs 14:32, Proverbs 15:11, Proverbs 16:17, Proverbs 17:5, Proverbs 20:13, Proverbs 21:1, Proverbs 21:22, Proverbs 22:15, Proverbs 24:6, Proverbs 25:17, Proverbs 26:26, Proverbs 28:4, Proverbs 29:2, Proverbs 30:23, Ecclesiastes 7:16, Ecclesiastes 7:21, Song of Solomon 5:12, Isaiah 20:5, Isaiah 21:14, Isaiah 22:7, Isaiah 41:8, Isaiah 41:29, Isaiah 53:1, Isaiah 66:13, Jeremiah 30:9, Jeremiah 42:13, Jeremiah 51:32, Jeremiah 51:54, Jeremiah 52:2, Jeremiah 52:29, Ezekiel 1:18, Ezekiel 10:15, Ezekiel 26:13, Ezekiel 33:33, Daniel 11:42, Hosea 4:19, Micah 5:12, Nahum 1:7, Zechariah 7:6, Zechariah 7:9, Matthew 3:17, Matthew 4:7, Matthew 5:34, Matthew 8:31, Matthew 9:30, Matthew 14:9, Matthew 15:27, Matthew 22:28, Matthew 22:44, Matthew 23:17, Matthew 24:23, Matthew 24:44, Matthew 25:25, Matthew 26:25, Matthew 26:48, Matthew 27:52, Matthew 28:18, Mark 1:23, Mark 3:34, Mark 4:7, Mark 4:28, Mark 8:29, Mark 10:43, Luke 1:33, Luke 2:40, Luke 3:36, Luke 4:13, Luke 5:34, Luke 6:2, Luke 6:15, Luke 7:17, Luke 9:57, Luke 11:2, Luke 11:44, Luke 12:26, Luke 12:50, Luke 22:67, Luke 24:15, John 1:13, John 2:4, John 2:7, John 5:35, John 6:37, John 7:19, John 7:25, John 10:17, John 11:6, John 11:38, John 11:40, John 15:11, Acts 1:23, Acts 2:21, Acts 7:46, Acts 17:12, Acts 21:14, Acts 22:16, Acts 22:27, Acts 24:11, Romans 1:14, Romans 3:12, Romans 3:31, Romans 14:21, 1 Corinthians 1:1, 1 Corinthians 4:14, 2 Corinthians 8:13, Galatians 4:8, Galatians 5:22, Galatians 5:24, Ephesians 3:2, Ephesians 4:30, Philippians 4:19, Colossians 4:1, 2 Timothy 2:9, 2 Timothy 2:26, 2 Timothy 4:14, Titus 3:13, Hebrews 10:27, Hebrews 12:14, James 2:10, James 2:21, James 3:10, 1 John 4:5, 1 John 4:14, 1 John 5:5, Revelation 5:10, Revelation 6:7, Revelation 10:5, Revelation 13:13, Revelation 17:18, Genesis 26:12, Genesis 26:14, Genesis 29:14, Genesis 29:23, Genesis 29:28, Genesis 31:51, Genesis 33:4, Genesis 43:6, Genesis 43:19, Genesis 44:13, Exodus 7:7, Exodus 28:34, Exodus 35:14, Exodus 36:14, Exodus 40:3, Leviticus 7:17, Leviticus 8:8, Leviticus 9:14, Leviticus 20:15, Leviticus 21:2, Leviticus 23:30, Leviticus 24:21, Leviticus 27:12, Numbers 3:22, Numbers 3:34, Numbers 8:3, Numbers 10:23, Numbers 11:3, Numbers 13:21, Numbers 17:12, Numbers 18:18, Numbers 28:25, Numbers 32:42, Deuteronomy 4:35, Deuteronomy 6:8, Deuteronomy 11:32, Deuteronomy 15:8, Deuteronomy 20:13, Deuteronomy 21:11, Deuteronomy 25:16, Deuteronomy 32:16, Joshua 12:4, Joshua 14:13, Joshua 15:2, Joshua 24:10, Joshua 24:29, Judges 8:9, Judges 18:13, 1 Samuel 12:4, 1 Samuel 14:46, 1 Samuel 20:24, 1 Samuel 23:16, 2 Samuel 9:5, 2 Samuel 14:21, 2 Samuel 22:18, 1 Kings 1:10, 1 Kings 6:33, 1 Kings 8:49, 1 Kings 11:16, 1 Kings 13:30, 1 Kings 18:41, 1 Kings 22:7, 2 Kings 4:37, 2 Kings 6:16, 2 Kings 10:16, 2 Kings 17:10, 2 Kings 17:22, 2 Kings 21:26, 2 Kings 24:9, 1 Chronicles 3:24, 1 Chronicles 8:39, 1 Chronicles 16:25, 1 Chronicles 17:22, 1 Chronicles 27:26, 2 Chronicles 3:5, 2 Chronicles 11:11, 2 Chronicles 12:6, 2 Chronicles 15:10, 2 Chronicles 18:6, 2 Chronicles 33:17, Nehemiah 3:5, Nehemiah 7:57, Nehemiah 13:3, Job 2:8, Job 9:32, Job 11:15, Job 17:4, Job 21:15, Job 21:28, Job 24:22, Job 29:12, Job 33:28, Job 36:2, Job 38:12, Psalms 9:4, Psalms 33:6, Psalms 44:22, Psalms 60:4, Psalms 71:4, Psalms 72:5, Psalms 72:14, Psalms 74:14, Psalms 74:16, Psalms 77:17, Psalms 83:3, Psalms 89:8, Psalms 109:20, Psalms 123:3, Psalms 140:3, Psalms 140:7, Proverbs 1:21, Proverbs 2:16, Proverbs 3:33, Proverbs 6:1, Proverbs 6:15, Proverbs 10:19, Proverbs 11:26, Proverbs 12:26, Proverbs 14:3, Proverbs 14:29, Proverbs 19:13, Proverbs 20:5, Proverbs 20:15, Proverbs 22:11, Proverbs 22:14, Proverbs 25:16, Proverbs 31:5, Song of Solomon 3:3, Song of Solomon 5:3, Song of Solomon 8:4, Song of Solomon 8:10, Isaiah 8:15, Isaiah 30:31, Isaiah 33:5, Isaiah 34:12, Isaiah 36:14, Isaiah 48:10, Isaiah 52:3, Isaiah 54:13, Isaiah 57:7, Jeremiah 1:12, Jeremiah 4:24, Jeremiah 17:14, Jeremiah 18:9, Jeremiah 20:14, Jeremiah 25:22, Jeremiah 35:10, Ezekiel 40:35, Jonah 3:2, Habakkuk 3:4, Zechariah 4:3, Zechariah 13:5, Matthew 1:24, Matthew 3:14, Matthew 4:17, Matthew 6:3, Matthew 7:14, Matthew 12:26, Matthew 14:30, Matthew 19:25, Matthew 21:30, Matthew 22:8, Matthew 25:18, Matthew 26:37, Matthew 27:7, Matthew 27:26, Matthew 27:58, Mark 3:13, Mark 7:1, Mark 7:14, Mark 9:10, Mark 11:4, Mark 13:29, Mark 14:23, Luke 1:31, Luke 2:1, Luke 3:24, Luke 3:25, Luke 3:29, Luke 3:30, Luke 3:31, Luke 9:6, Luke 10:23, Luke 11:11, Luke 14:11, Luke 17:34, Luke 19:31, Luke 20:33, Luke 22:15, Luke 23:19, John 4:34, John 5:38, John 6:9, John 6:41, John 6:52, John 7:8, John 7:33, John 8:22, John 8:34, John 8:38, John 9:9, John 11:45, John 15:25, Acts 10:15, Acts 14:4, Acts 15:11, Acts 16:39, Acts 27:38, 1 Corinthians 3:12, 1 Corinthians 4:1, 1 Corinthians 4:12, 1 Corinthians 8:9, 1 Corinthians 15:43, 2 Corinthians 6:15, Ephesians 6:23, Philippians 2:6, Philippians 3:2, Colossians 4:17, 1 Thessalonians 3:1, 1 Thessalonians 5:9, 1 Timothy 1:14, 2 Timothy 2:8, 2 Timothy 4:6, Hebrews 3:15, Hebrews 5:6, Hebrews 10:19, 1 Peter 3:17, 1 Peter 5:13, 1 John 5:2, 3 John 1:8, Revelation 7:4, Revelation 9:16, Revelation 11:4, Revelation 16:7, Revelation 18:11, Genesis 5:22, Genesis 15:15, Genesis 29:21, Genesis 37:34, Genesis 38:7, Genesis 39:13, Genesis 41:38, Exodus 16:13, Exodus 16:26, Exodus 18:2, Exodus 22:21, Exodus 30:29, Exodus 32:9, Exodus 34:5, Exodus 36:26, Exodus 37:13, Leviticus 10:10, Leviticus 13:41, Leviticus 21:15, Leviticus 24:6, Leviticus 25:36, Leviticus 27:22, Numbers 14:28, Numbers 18:22, Numbers 21:15, Numbers 25:3, Numbers 28:17, Numbers 32:18, Numbers 34:5, Numbers 35:20, Numbers 35:22, Deuteronomy 2:33, Deuteronomy 8:5, Deuteronomy 11:3, Deuteronomy 30:11, Joshua 8:12, Joshua 21:26, Judges 1:6, Judges 3:30, Judges 13:13, Ruth 2:5, 1 Samuel 10:20, 1 Samuel 16:14, 2 Samuel 8:15, 2 Samuel 12:25, 2 Samuel 13:14, 2 Samuel 16:15, 2 Samuel 20:5, 1 Kings 7:5, 1 Kings 10:16, 1 Kings 16:30, 2 Kings 3:18, 2 Kings 19:34, 2 Kings 23:32, 2 Kings 23:37, 1 Chronicles 8:33, 1 Chronicles 13:3, 1 Chronicles 18:15, 1 Chronicles 23:30, 2 Chronicles 4:17, 2 Chronicles 4:20, 2 Chronicles 5:3, 2 Chronicles 16:11, 2 Chronicles 21:5, 2 Chronicles 29:14, Ezra 4:22, Nehemiah 5:1, Nehemiah 7:59, Job 5:21, Job 7:8, Job 8:15, Job 14:20, Job 18:21, Job 21:21, Job 29:24, Job 37:15, Job 38:32, Job 39:12, Psalms 4:3, Psalms 12:4, Psalms 25:14, Psalms 33:10, Psalms 33:18, Psalms 36:1, Psalms 45:14, Psalms 51:6, Psalms 68:1, Psalms 68:3, Psalms 69:3, Psalms 69:23, Psalms 69:36, Psalms 71:23, Psalms 74:3, Psalms 75:10, Psalms 78:57, Psalms 80:6, Psalms 86:5, Psalms 89:15, Psalms 89:48, Psalms 96:12, Psalms 97:8, Psalms 98:4, Psalms 106:26, Psalms 107:8, Psalms 107:15, Psalms 107:21, Psalms 107:31, Psalms 109:2, Psalms 111:6, Psalms 112:5, Psalms 119:75, Psalms 140:10, Psalms 140:11, Psalms 140:13, Psalms 146:2, Proverbs 9:7, Proverbs 9:10, Proverbs 11:14, Proverbs 15:14, Proverbs 20:28, Proverbs 22:1, Proverbs 23:21, Proverbs 24:13, Proverbs 25:21, Proverbs 26:27, Proverbs 29:7, Ecclesiastes 3:2, Ecclesiastes 11:2, Isaiah 28:24, Isaiah 32:20, Isaiah 37:35, Isaiah 48:4, Isaiah 48:12, Isaiah 61:5, Jeremiah 4:27, Jeremiah 13:9, Jeremiah 23:29, Jeremiah 25:16, Jeremiah 26:22, Ezekiel 15:3, Ezekiel 20:25, Ezekiel 21:6, Ezekiel 21:13, Ezekiel 37:3, Ezekiel 44:1, Daniel 1:16, Daniel 4:2, Daniel 5:9, Daniel 11:1, Daniel 12:9, Hosea 8:11, Joel 2:30, Jonah 2:4, Jonah 3:9, Haggai 1:10, Matthew 11:17, Matthew 13:8, Matthew 13:25, Matthew 14:11, Matthew 14:14, Matthew 15:3, Matthew 16:2, Matthew 27:34, Matthew 28:8, Matthew 28:13, Mark 6:28, Mark 12:13, Mark 15:2, Mark 15:33, Luke 1:21, Luke 6:13, Luke 7:42, Luke 8:34, Luke 9:20, Luke 16:17, Luke 17:3, Luke 17:15, Luke 18:40, Luke 19:20, Luke 21:20, Luke 22:40, Luke 23:3, Luke 23:51, John 3:10, John 5:26, John 5:28, John 6:2, John 6:60, John 7:7, John 8:48, John 9:32, John 19:18, Acts 2:43, Acts 4:3, Acts 4:14, Acts 6:15, Acts 13:28, Romans 7:9, Romans 7:11, Romans 13:14, Romans 16:10, 1 Corinthians 7:3, 1 Corinthians 7:27, 1 Corinthians 10:17, 1 Corinthians 10:18, 1 Corinthians 11:16, 2 Corinthians 5:5, Galatians 5:20, Galatians 6:9, Ephesians 6:11, Philippians 1:10, Philippians 2:26, Colossians 1:4, 1 Timothy 4:13, Hebrews 2:1, Hebrews 3:2, Hebrews 5:13, Hebrews 10:23, Hebrews 13:12, Hebrews 13:16, James 3:16, James 4:9, 2 John 1:8, Revelation 21:11, Revelation 21:24, Genesis 1:8, Genesis 4:16, Genesis 5:2, Genesis 9:19, Genesis 12:17, Genesis 14:19, Genesis 19:10, Genesis 21:21, Genesis 26:5, Genesis 37:18, Genesis 38:19, Genesis 41:33, Genesis 44:9, Exodus 10:4, Exodus 20:2, Exodus 26:21, Exodus 28:7, Exodus 32:3, Exodus 32:35, Exodus 33:6, Exodus 35:17, Exodus 36:10, Exodus 36:18, Exodus 36:30, Exodus 37:29, Exodus 40:22, Exodus 40:37, Leviticus 7:5, Leviticus 7:6, Leviticus 8:5, Leviticus 9:8, Leviticus 11:3, Leviticus 13:50, Leviticus 18:6, Leviticus 18:13, Leviticus 18:20, Leviticus 24:22, Numbers 3:2, Numbers 3:30, Numbers 10:19, Numbers 17:4, Numbers 20:18, Numbers 20:21, Numbers 22:40, Deuteronomy 27:18, Deuteronomy 29:9, Deuteronomy 34:10, Joshua 19:14, Judges 17:13, 1 Samuel 3:20, 1 Samuel 14:8, 1 Samuel 17:53, 1 Samuel 25:44, 2 Samuel 12:6, 2 Samuel 12:29, 1 Kings 2:6, 1 Kings 7:46, 1 Kings 15:1, 1 Kings 21:1, 1 Kings 22:9, 1 Kings 22:41, 2 Kings 3:15, 2 Kings 17:38, 2 Kings 22:15, 1 Chronicles 1:40, 1 Chronicles 6:72, 1 Chronicles 9:17, 1 Chronicles 13:12, 1 Chronicles 14:4, 1 Chronicles 23:10, 1 Chronicles 23:22, 1 Chronicles 23:27, 2 Chronicles 2:9, 2 Chronicles 4:18, 2 Chronicles 8:1, 2 Chronicles 15:3, 2 Chronicles 18:8, 2 Chronicles 27:8, 2 Chronicles 34:23, Ezra 8:27, Nehemiah 4:8, Nehemiah 7:4, Nehemiah 11:14, Nehemiah 11:31, Esther 9:32, Job 12:7, Job 13:27, Job 14:21, Job 15:33, Job 19:7, Job 19:16, Job 26:10, Job 27:14, Job 31:40, Job 33:21, Job 34:28, Job 38:11, Job 41:11, Psalms 3:6, Psalms 5:8, Psalms 8:8, Psalms 9:1, Psalms 9:18, Psalms 10:4, Psalms 18:26, Psalms 31:18, Psalms 37:22, Psalms 37:33, Psalms 37:39, Psalms 39:4, Psalms 46:4, Psalms 50:7, Psalms 61:5, Psalms 69:15, Psalms 78:12, Psalms 78:51, Psalms 86:12, Psalms 102:13, Psalms 107:17, Psalms 109:15, Psalms 109:29, Psalms 119:149, Psalms 119:176, Psalms 149:9, Proverbs 3:18, Proverbs 7:7, Proverbs 8:24, Proverbs 10:9, Proverbs 11:3, Proverbs 13:18, Proverbs 13:19, Proverbs 14:31, Proverbs 15:32, Proverbs 16:20, Proverbs 17:26, Proverbs 22:21, Proverbs 29:3, Ecclesiastes 2:20, Ecclesiastes 4:2, Ecclesiastes 9:4, Ecclesiastes 10:5, Song of Solomon 2:8, Isaiah 12:5, Isaiah 22:17, Isaiah 28:20, Jeremiah 28:2, Jeremiah 32:11, Jeremiah 44:16, Ezekiel 4:11, Ezekiel 8:4, Ezekiel 10:10, Ezekiel 15:8, Ezekiel 41:21, Ezekiel 42:9, Ezekiel 42:16, Hosea 4:7, Hosea 9:5, Joel 3:5, Amos 5:27, Nahum 3:9, Haggai 2:21, Zechariah 14:3, Malachi 4:5, Matthew 1:11, Matthew 5:1, Matthew 12:36, Matthew 12:49, Matthew 19:11, Matthew 22:7, Matthew 26:28, Matthew 27:20, Mark 1:41, Mark 4:30, Mark 7:28, Mark 7:29, Mark 8:10, Mark 8:28, Mark 11:21, Mark 14:6, Mark 14:33, Mark 16:16, Luke 1:51, Luke 2:13, Luke 2:17, Luke 3:26, Luke 6:12, Luke 6:26, Luke 8:21, Luke 9:61, Luke 10:33, Luke 12:13, Luke 13:26, Luke 16:30, Luke 20:42, Luke 22:4, Luke 22:8, Luke 22:22, Luke 24:30, John 5:9, John 9:29, John 9:34, John 12:46, John 14:29, John 16:16, John 17:22, John 18:2, John 20:8, Acts 7:14, Acts 10:14, Acts 10:31, Acts 11:6, Acts 13:16, Acts 14:2, Acts 15:14, Acts 25:1, Romans 3:30, Romans 9:10, 1 Corinthians 1:9, 1 Corinthians 6:4, 1 Corinthians 9:11, 1 Corinthians 11:29, 2 Corinthians 2:9, 2 Corinthians 6:9, 2 Corinthians 10:18, Galatians 6:16, Ephesians 5:8, Ephesians 5:20, Philippians 2:10, Hebrews 3:18, Hebrews 7:12, Hebrews 11:10, Hebrews 12:16, Hebrews 13:22, 1 Peter 2:4, 2 Peter 2:2, Revelation 16:8, Revelation 19:13, Genesis 3:12, Genesis 8:3, Genesis 9:13, Genesis 9:27, Genesis 17:25, Genesis 18:11, Genesis 19:37, Genesis 21:18, Genesis 24:18, Genesis 27:32, Genesis 31:40, Genesis 36:20, Genesis 37:21, Genesis 38:5, Genesis 46:10, Genesis 47:7, Exodus 1:1, Exodus 5:9, Exodus 6:30, Exodus 8:7, Exodus 20:23, Exodus 25:40, Exodus 28:37, Exodus 29:16, Exodus 35:27, Exodus 35:34, Leviticus 4:32, Leviticus 11:38, Leviticus 14:15, Leviticus 16:8, Leviticus 26:9, Numbers 1:5, Numbers 2:22, Numbers 15:18, Numbers 15:27, Numbers 16:12, Numbers 16:50, Numbers 22:1, Numbers 23:5, Numbers 23:15, Numbers 30:15, Numbers 31:2, Deuteronomy 5:6, Deuteronomy 11:16, Deuteronomy 18:8, Deuteronomy 23:9, Deuteronomy 29:4, Deuteronomy 34:2, Deuteronomy 34:3, Joshua 10:29, Joshua 21:28, Judges 9:21, Judges 9:30, Judges 9:32, 1 Samuel 3:7, 1 Samuel 8:21, 1 Samuel 17:31, 1 Samuel 17:41, 1 Samuel 31:5, 2 Samuel 1:25, 2 Samuel 23:29, 1 Kings 1:29, 1 Kings 6:25, 1 Kings 7:28, 1 Kings 13:20, 1 Kings 15:2, 1 Kings 16:25, 1 Kings 20:4, 1 Kings 21:3, 1 Chronicles 1:9, 1 Chronicles 2:34, 1 Chronicles 10:10, 1 Chronicles 23:26, 1 Chronicles 27:3, 1 Chronicles 27:9, 1 Chronicles 27:12, 2 Chronicles 2:1, 2 Chronicles 8:10, 2 Chronicles 26:17, 2 Chronicles 34:1, Ezra 2:55, Ezra 8:2, Nehemiah 10:30, Nehemiah 11:15, Job 2:5, Job 22:23, Job 24:11, Job 24:16, Job 36:9, Job 37:16, Job 39:4, Job 41:30, Psalms 2:8, Psalms 18:17, Psalms 29:3, Psalms 31:8, Psalms 32:10, Psalms 34:16, Psalms 35:24, Psalms 42:3, Psalms 44:5, Psalms 60:3, Psalms 69:28, Psalms 74:4, Psalms 83:18, Psalms 86:13, Psalms 89:5, Psalms 92:11, Psalms 106:9, Psalms 119:73, Psalms 119:116, Psalms 128:5, Psalms 134:1, Proverbs 4:4, Proverbs 5:10, Proverbs 10:11, Proverbs 12:10, Proverbs 12:18, Proverbs 13:14, Proverbs 14:4, Proverbs 14:35, Proverbs 15:9, Proverbs 15:19, Proverbs 15:27, Proverbs 17:24, Proverbs 20:19, Proverbs 21:9, Proverbs 21:27, Proverbs 23:24, Proverbs 24:22, Proverbs 25:24, Proverbs 25:26, Proverbs 30:20, Ecclesiastes 5:7, Ecclesiastes 10:3, Ecclesiastes 10:13, Song of Solomon 5:14, Isaiah 3:10, Isaiah 3:18, Isaiah 6:12, Isaiah 17:4, Isaiah 19:10, Isaiah 21:13, Isaiah 32:18, Isaiah 38:9, Isaiah 43:26, Isaiah 64:10, Jeremiah 6:14, Jeremiah 7:5, Jeremiah 7:7, Jeremiah 8:11, Jeremiah 30:2, Jeremiah 37:4, Jeremiah 41:15, Jeremiah 49:35, Ezekiel 7:10, Ezekiel 11:3, Ezekiel 12:24, Ezekiel 16:18, Ezekiel 30:14, Ezekiel 35:7, Ezekiel 47:7, Daniel 3:23, Hosea 6:6, Hosea 8:12, Hosea 12:12, Hosea 14:6, Joel 3:1, Amos 2:3, Amos 5:17, Habakkuk 2:10, Zephaniah 1:6, Zechariah 4:11, Zechariah 14:9, Matthew 1:6, Matthew 1:9, Matthew 5:35, Matthew 7:7, Matthew 7:15, Matthew 7:23, Matthew 11:22, Matthew 15:34, Matthew 18:14, Matthew 20:15, Matthew 22:11, Matthew 26:44, Matthew 27:14, Mark 2:13, Mark 3:7, Mark 8:11, Mark 10:13, Luke 1:44, Luke 5:6, Luke 7:11, Luke 8:19, Luke 9:31, Luke 13:8, Luke 24:28, John 1:30, John 6:71, John 8:18, John 10:9, John 13:31, Acts 1:10, Acts 2:10, Acts 5:22, Acts 7:39, Acts 11:9, Acts 19:28, Acts 19:37, Acts 20:2, Acts 20:34, Acts 24:20, Romans 7:15, Romans 10:10, 1 Corinthians 3:8, 1 Corinthians 10:5, 1 Corinthians 12:6, 1 Corinthians 15:31, 2 Corinthians 11:13, 2 Corinthians 11:22, 2 Corinthians 12:15, Galatians 4:12, Ephesians 2:13, Ephesians 2:16, Philippians 1:9, 1 Thessalonians 4:8, 1 Thessalonians 5:2, 1 Timothy 1:19, 1 Timothy 3:1, 1 Timothy 3:5, Titus 1:14, Philemon 1:1, Hebrews 3:16, Hebrews 10:20, James 1:19, 2 Peter 1:18, 1 John 3:11, Revelation 22:10, Genesis 7:15, Genesis 8:12, Genesis 9:1, Genesis 9:22, Genesis 11:2, Genesis 14:6, Genesis 20:18, Genesis 27:18, Genesis 29:18, Genesis 32:8, Genesis 36:31, Genesis 37:26, Genesis 41:26, Genesis 46:21, Genesis 47:25, Exodus 4:16, Exodus 8:23, Exodus 9:31, Exodus 13:22, Exodus 27:5, Exodus 27:15, Exodus 30:27, Exodus 36:22, Exodus 39:10, Exodus 40:17, Leviticus 4:11, Leviticus 16:9, Leviticus 16:31, Leviticus 25:20, Leviticus 27:34, Numbers 2:31, Numbers 20:27, Deuteronomy 9:13, Deuteronomy 14:12, Deuteronomy 24:11, Deuteronomy 27:16, Joshua 24:16, Judges 10:14, Judges 20:21, Judges 21:9, 1 Samuel 10:4, 1 Samuel 14:5, 1 Samuel 22:20, 1 Samuel 23:15, 2 Samuel 6:9, 2 Samuel 15:13, 2 Samuel 20:24, 1 Kings 2:43, 1 Kings 16:28, 2 Kings 4:3, 2 Kings 25:12, 1 Chronicles 4:20, 1 Chronicles 4:38, 1 Chronicles 16:33, 1 Chronicles 18:9, 1 Chronicles 27:4, 1 Chronicles 27:8, 2 Chronicles 3:9, 2 Chronicles 8:2, 2 Chronicles 13:21, 2 Chronicles 26:22, 2 Chronicles 27:4, 2 Chronicles 30:11, Ezra 2:57, Ezra 8:19, Esther 7:5, Job 12:8, Job 13:9, Job 27:5, Job 31:16, Psalms 5:3, Psalms 8:6, Psalms 17:4, Psalms 18:25, Psalms 22:16, Psalms 31:1, Psalms 45:6, Psalms 45:10, Psalms 69:16, Psalms 69:22, Psalms 80:16, Psalms 83:4, Psalms 88:9, Psalms 89:6, Psalms 90:14, Psalms 91:7, Psalms 103:13, Psalms 103:20, Psalms 109:30, Psalms 112:1, Psalms 118:19, Psalms 119:90, Psalms 119:160, Psalms 141:7, Psalms 144:15, Proverbs 10:17, Proverbs 10:32, Proverbs 12:13, Proverbs 16:16, Proverbs 17:8, Proverbs 22:5, Proverbs 24:16, Proverbs 28:20, Proverbs 29:9, Proverbs 31:15, Ecclesiastes 7:6, Isaiah 5:17, Isaiah 8:17, Isaiah 23:2, Isaiah 27:5, Isaiah 33:12, Isaiah 43:25, Jeremiah 11:2, Jeremiah 15:21, Jeremiah 25:2, Jeremiah 48:42, Jeremiah 51:63, Ezekiel 10:18, Ezekiel 10:21, Ezekiel 27:30, Ezekiel 34:11, Ezekiel 34:22, Ezekiel 47:6, Ezekiel 48:30, Hosea 12:10, Joel 1:15, Amos 1:4, Amos 5:2, Jonah 1:16, Jonah 4:3, Haggai 1:4, Haggai 1:15, Zechariah 2:3, Malachi 1:5, Matthew 1:16, Matthew 9:25, Matthew 13:42, Matthew 13:50, Matthew 18:1, Matthew 20:7, Matthew 26:38, Matthew 27:23, Mark 3:9, Mark 4:22, Mark 5:22, Mark 7:17, Mark 9:34, Mark 10:11, Mark 14:51, Mark 14:69, Mark 15:12, Luke 5:31, Luke 10:6, Luke 12:52, Luke 12:55, Luke 23:44, Luke 23:55, Luke 24:13, John 1:32, John 2:8, John 5:11, John 6:1, John 9:4, John 10:28, John 11:15, John 11:30, John 11:49, John 12:12, John 12:44, John 13:4, John 18:9, Acts 4:11, Acts 5:19, Acts 7:12, Acts 9:30, Acts 10:1, Acts 17:20, Acts 18:22, Acts 24:19, Acts 25:27, Acts 26:9, Acts 26:32, Romans 6:23, Romans 8:2, 1 Corinthians 1:11, 1 Corinthians 1:24, 1 Corinthians 2:7, 1 Corinthians 10:25, 1 Corinthians 15:23, 1 Corinthians 16:3, 2 Corinthians 5:8, 2 Corinthians 10:4, Galatians 1:11, Galatians 1:18, Galatians 2:1, Galatians 4:18, Galatians 5:2, Galatians 5:3, Ephesians 2:20, Ephesians 4:24, Ephesians 5:24, Colossians 3:10, 1 Thessalonians 3:3, 2 Thessalonians 3:9, 1 Timothy 3:11, 2 Timothy 4:11, Titus 3:7, Philemon 1:15, Hebrews 2:7, Hebrews 2:13, Hebrews 2:18, Hebrews 5:11, Hebrews 12:18, James 2:9, 1 Peter 2:2, 1 Peter 2:19, 1 Peter 4:10, 2 Peter 1:20, Revelation 1:14, Revelation 4:2, Revelation 5:4, Revelation 10:11, Revelation 21:17, Genesis 1:15, Genesis 8:8, Genesis 10:7, Genesis 10:18, Genesis 11:28, Genesis 17:21, Genesis 24:17, Genesis 25:10, Genesis 32:3, Genesis 36:30, Genesis 38:30, Genesis 45:28, Exodus 12:28, Exodus 17:4, Exodus 21:16, Exodus 25:35, Exodus 32:16, Exodus 37:7, Exodus 38:4, Exodus 38:22, Exodus 39:42, Leviticus 2:7, Leviticus 19:26, Leviticus 22:12, Leviticus 22:15, Numbers 6:16, Numbers 7:12, Numbers 15:7, Numbers 31:10, Numbers 34:23, Numbers 35:10, Deuteronomy 8:6, Deuteronomy 8:17, Deuteronomy 14:5, Deuteronomy 22:12, Deuteronomy 24:22, Deuteronomy 27:13, Deuteronomy 27:24, Joshua 3:9, Joshua 10:18, Joshua 10:22, Joshua 16:7, Judges 1:20, Judges 5:24, Judges 6:40, Judges 13:15, Judges 17:12, Judges 20:46, Ruth 1:5, 1 Samuel 1:5, 1 Samuel 10:26, 1 Samuel 16:19, 1 Samuel 31:13, 2 Samuel 2:11, 2 Samuel 3:9, 2 Samuel 7:17, 2 Samuel 10:15, 2 Samuel 14:12, 2 Samuel 17:28, 2 Samuel 22:26, 1 Kings 16:6, 1 Kings 19:1, 1 Kings 20:2, 2 Kings 18:33, 1 Chronicles 2:16, 1 Chronicles 2:25, 1 Chronicles 4:31, 1 Chronicles 8:36, 1 Chronicles 9:39, 1 Chronicles 9:42, 1 Chronicles 14:16, 1 Chronicles 17:15, 1 Chronicles 24:23, 2 Chronicles 8:5, 2 Chronicles 11:20, 2 Chronicles 24:8, 2 Chronicles 29:13, 2 Chronicles 31:8, 2 Chronicles 31:11, 2 Chronicles 36:6, Nehemiah 8:11, Esther 1:1, Job 9:4, Job 19:27, Job 20:8, Job 32:5, Job 33:27, Psalms 34:22, Psalms 61:7, Psalms 62:8, Psalms 68:21, Psalms 69:14, Psalms 72:19, Psalms 77:19, Psalms 89:24, Psalms 100:4, Psalms 100:5, Psalms 102:28, Psalms 104:13, Psalms 105:37, Psalms 107:43, Psalms 130:6, Psalms 141:6, Psalms 143:5, Psalms 145:12, Proverbs 1:24, Proverbs 6:5, Proverbs 10:5, Proverbs 11:11, Proverbs 14:22, Proverbs 17:27, Proverbs 18:24, Proverbs 24:15, Proverbs 24:29, Proverbs 27:9, Proverbs 27:25, Isaiah 1:28, Isaiah 5:10, Isaiah 5:16, Isaiah 12:6, Isaiah 14:17, Isaiah 16:2, Isaiah 19:24, Isaiah 29:1, Isaiah 29:12, Isaiah 36:21, Isaiah 38:21, Isaiah 41:24, Isaiah 46:2, Jeremiah 7:15, Jeremiah 20:15, Jeremiah 22:19, Jeremiah 23:11, Jeremiah 28:10, Jeremiah 32:16, Jeremiah 33:17, Jeremiah 36:11, Jeremiah 44:20, Ezekiel 12:9, Ezekiel 16:44, Ezekiel 19:6, Ezekiel 20:29, Ezekiel 40:45, Amos 5:9, Habakkuk 2:2, Zephaniah 3:18, Zechariah 2:12, Zechariah 9:12, Zechariah 14:1, Malachi 3:12, Matthew 10:22, Matthew 16:25, Matthew 17:23, Matthew 18:29, Matthew 19:27, Matthew 20:34, Matthew 21:26, Matthew 27:43, Mark 5:27, Mark 8:8, Mark 9:36, Mark 10:15, Mark 12:4, Mark 12:23, Mark 13:13, Mark 14:32, Luke 1:11, Luke 3:27, Luke 7:33, Luke 8:30, Luke 9:24, Luke 10:17, Luke 11:30, Luke 18:17, Luke 19:9, Luke 21:30, Luke 22:46, Luke 22:71, Luke 23:15, Luke 24:20, John 5:21, John 9:2, John 14:30, John 15:7, John 16:24, John 18:30, John 19:28, John 19:34, John 20:6, John 21:9, Acts 11:22, Acts 15:40, Acts 18:28, Acts 22:7, Acts 27:15, Acts 27:23, Acts 28:14, Romans 1:30, Romans 8:24, Romans 16:15, 1 Corinthians 6:3, 1 Corinthians 8:8, 1 Corinthians 9:19, 1 Corinthians 14:4, 1 Corinthians 14:20, 1 Corinthians 15:20, 2 Corinthians 6:18, 2 Corinthians 11:17, Galatians 3:2, Galatians 3:24, Galatians 4:4, Ephesians 1:9, Ephesians 4:8, Philippians 2:3, Philippians 2:19, Colossians 2:15, Colossians 2:22, 1 Timothy 1:17, Titus 2:13, Hebrews 9:21, Hebrews 10:38, James 2:1, 1 Peter 1:25, 1 John 3:22, Jude 1:18, Revelation 1:2, Revelation 2:3, Revelation 2:16, Revelation 7:7, Revelation 22:12, Genesis 2:13, Genesis 6:14, Genesis 9:6, Genesis 13:1, Genesis 21:8, Genesis 27:28, Genesis 31:15, Genesis 34:1, Genesis 45:24, Genesis 46:2, Genesis 48:3, Genesis 49:27, Exodus 2:17, Exodus 5:18, Exodus 7:3, Exodus 12:51, Exodus 29:3, Exodus 29:4, Exodus 29:19, Exodus 31:8, Exodus 40:6, Leviticus 18:19, Leviticus 25:14, Leviticus 26:28, Numbers 3:6, Numbers 5:23, Numbers 8:25, Numbers 11:28, Numbers 12:12, Numbers 14:41, Numbers 23:18, Numbers 34:8, Deuteronomy 1:10, Deuteronomy 2:35, Deuteronomy 3:25, Deuteronomy 7:21, Deuteronomy 10:7, Deuteronomy 27:25, Deuteronomy 28:41, Deuteronomy 33:1, Deuteronomy 34:5, Joshua 13:24, Joshua 20:2, Judges 3:18, Judges 6:16, Judges 18:16, Judges 19:7, 1 Samuel 1:6, 1 Samuel 6:10, 1 Samuel 14:31, 1 Samuel 20:17, 1 Samuel 24:22, 1 Samuel 25:16, 1 Samuel 28:16, 1 Samuel 28:25, 1 Samuel 31:10, 2 Samuel 13:7, 2 Samuel 22:25, 2 Samuel 22:40, 2 Samuel 23:6, 1 Kings 5:4, 1 Kings 10:8, 1 Kings 12:13, 2 Kings 17:3, 2 Kings 17:30, 2 Kings 17:39, 2 Kings 18:3, 2 Kings 18:8, 1 Chronicles 6:19, 1 Chronicles 7:20, 1 Chronicles 10:3, 1 Chronicles 11:1, 1 Chronicles 27:13, 2 Chronicles 20:13, 2 Chronicles 28:20, 2 Chronicles 29:2, 2 Chronicles 33:1, 2 Chronicles 36:11, Nehemiah 3:18, Nehemiah 11:9, Esther 3:5, Esther 5:13, Job 3:13, Job 22:6, Job 22:28, Job 30:22, Job 35:11, Job 36:18, Job 39:24, Psalms 8:5, Psalms 18:39, Psalms 24:7, Psalms 24:9, Psalms 36:8, Psalms 57:9, Psalms 58:9, Psalms 63:5, Psalms 74:1, Psalms 78:58, Psalms 79:12, Psalms 82:3, Psalms 90:15, Psalms 99:1, Psalms 107:3, Psalms 107:32, Psalms 108:3, Psalms 109:28, Psalms 109:31, Psalms 143:11, Psalms 145:21, Proverbs 11:20, Proverbs 15:6, Proverbs 17:20, Proverbs 17:28, Proverbs 18:8, Proverbs 18:20, Proverbs 19:1, Proverbs 23:34, Proverbs 24:11, Proverbs 24:24, Proverbs 26:22, Proverbs 28:12, Proverbs 28:18, Proverbs 29:16, Proverbs 31:2, Ecclesiastes 7:4, Ecclesiastes 7:10, Isaiah 10:34, Isaiah 32:9, Isaiah 38:6, Isaiah 51:15, Isaiah 62:3, Isaiah 64:1, Jeremiah 2:17, Jeremiah 3:11, Jeremiah 10:4, Jeremiah 23:37, Jeremiah 23:40, Jeremiah 25:17, Jeremiah 35:5, Ezekiel 3:8, Ezekiel 4:1, Ezekiel 6:10, Ezekiel 9:10, Ezekiel 17:14, Ezekiel 32:14, Ezekiel 33:17, Daniel 2:22, Daniel 3:6, Daniel 10:15, Hosea 1:9, Matthew 5:10, Matthew 6:33, Matthew 10:10, Matthew 12:3, Matthew 15:14, Matthew 19:10, Matthew 19:16, Matthew 22:3, Matthew 25:36, Mark 1:3, Mark 2:24, Mark 3:26, Mark 8:22, Mark 10:2, Mark 14:71, Mark 15:19, Luke 1:24, Luke 6:30, Luke 6:39, Luke 7:2, Luke 10:36, Luke 12:30, Luke 12:38, Luke 13:21, Luke 15:2, Luke 19:7, John 4:40, John 5:16, John 5:34, John 7:10, John 8:13, John 10:6, John 13:7, John 13:14, John 16:27, John 20:4, John 20:14, John 20:16, John 20:21, Acts 2:28, Acts 7:23, Acts 8:24, Acts 9:4, Acts 23:31, Acts 25:13, Acts 26:12, Acts 28:10, Acts 28:16, Romans 1:10, Romans 3:7, Romans 5:20, 1 Corinthians 8:13, 1 Corinthians 11:26, 2 Corinthians 2:7, 2 Corinthians 11:28, 2 Corinthians 11:32, 2 Corinthians 12:5, Galatians 4:19, Ephesians 3:17, Philippians 1:12, Philippians 1:26, Colossians 4:13, 1 Thessalonians 5:5, 1 Timothy 3:12, 1 Timothy 5:22, 2 Timothy 1:2, 2 Timothy 1:15, 2 Timothy 3:9, Hebrews 11:40, Hebrews 13:2, James 3:3, James 4:6, 1 Peter 2:13, 1 Peter 2:25, 1 Peter 4:16, 1 John 4:12, Revelation 5:3, Revelation 9:21, Revelation 18:24, Revelation 20:14, Genesis 2:8, Genesis 27:3, Genesis 28:16, Genesis 29:16, Genesis 31:49, Genesis 32:2, Genesis 32:13, Genesis 34:27, Genesis 36:21, Genesis 47:31, Exodus 2:12, Exodus 21:5, Exodus 26:14, Exodus 38:14, Exodus 39:13, Exodus 40:24, Leviticus 14:38, Leviticus 25:7, Leviticus 25:42, Leviticus 26:32, Numbers 2:16, Numbers 3:49, Numbers 8:14, Numbers 15:33, Numbers 20:22, Numbers 22:24, Deuteronomy 6:5, Deuteronomy 12:32, Deuteronomy 15:3, Deuteronomy 22:28, Joshua 11:7, Joshua 11:13, Judges 5:10, Judges 5:18, 1 Samuel 8:14, 1 Samuel 9:23, 1 Samuel 11:6, 1 Samuel 17:11, 1 Samuel 25:9, 1 Samuel 27:6, 1 Samuel 31:6, 2 Samuel 5:1, 2 Samuel 18:16, 1 Kings 3:25, 1 Kings 4:6, 1 Kings 9:12, 1 Kings 12:3, 1 Kings 14:16, 1 Kings 15:10, 1 Kings 18:9, 1 Kings 22:36, 2 Kings 4:21, 2 Kings 15:34, 2 Kings 16:4, 1 Chronicles 2:7, 1 Chronicles 6:80, 1 Chronicles 7:14, 1 Chronicles 9:20, 1 Chronicles 22:6, 2 Chronicles 13:20, 2 Chronicles 15:14, 2 Chronicles 22:3, 2 Chronicles 28:4, 2 Chronicles 35:27, Nehemiah 4:20, Nehemiah 6:5, Nehemiah 12:10, Job 2:4, Job 5:4, Job 5:13, Job 5:17, Job 6:6, Job 15:29, Job 24:17, Job 34:6, Job 34:37, Psalms 10:6, Psalms 18:41, Psalms 32:2, Psalms 32:8, Psalms 51:17, Psalms 62:12, Psalms 66:6, Psalms 75:1, Psalms 78:71, Psalms 79:3, Psalms 90:4, Psalms 91:13, Psalms 106:1, Psalms 109:17, Psalms 116:16, Psalms 124:7, Psalms 145:7, Psalms 147:8, Proverbs 1:11, Proverbs 11:6, Proverbs 12:11, Proverbs 13:4, Proverbs 15:28, Proverbs 21:5, Proverbs 25:18, Proverbs 28:8, Proverbs 28:14, Proverbs 30:16, Ecclesiastes 1:10, Ecclesiastes 4:13, Isaiah 1:20, Isaiah 3:11, Isaiah 24:14, Isaiah 27:3, Isaiah 33:24, Isaiah 35:1, Isaiah 38:7, Isaiah 40:19, Isaiah 41:28, Isaiah 54:12, Isaiah 59:1, Jeremiah 5:21, Jeremiah 6:25, Jeremiah 27:17, Jeremiah 29:9, Jeremiah 33:3, Jeremiah 49:27, Ezekiel 2:9, Ezekiel 3:5, Ezekiel 23:5, Ezekiel 30:17, Ezekiel 34:5, Ezekiel 37:5, Ezekiel 38:3, Daniel 11:9, Hosea 2:14, Hosea 6:2, Hosea 6:10, Amos 2:16, Malachi 3:13, Matthew 1:10, Matthew 1:13, Matthew 1:15, Matthew 2:7, Matthew 6:15, Matthew 6:22, Matthew 6:32, Matthew 9:23, Matthew 12:28, Matthew 15:6, Matthew 22:30, Matthew 22:42, Matthew 27:5, Mark 2:20, Mark 7:19, Mark 9:21, Mark 10:37, Mark 12:10, Mark 14:31, Mark 14:48, Mark 14:64, Mark 15:14, Mark 15:17, Mark 15:42, Luke 3:37, Luke 6:14, Luke 6:40, Luke 10:31, Luke 11:20, Luke 13:12, Luke 15:14, Luke 16:28, Luke 22:17, Luke 22:39, John 1:46, John 3:28, John 6:25, John 17:3, John 18:4, John 18:12, John 20:30, Acts 1:5, Acts 2:24, Acts 9:32, Acts 9:37, Acts 12:18, Acts 13:19, Acts 14:6, Acts 16:24, Acts 22:12, Acts 27:22, Acts 27:44, Romans 4:3, Romans 8:22, Romans 10:21, Romans 13:8, 1 Corinthians 2:16, 1 Corinthians 3:4, 1 Corinthians 15:53, 2 Corinthians 3:2, Galatians 5:4, Ephesians 5:29, Philippians 2:22, Colossians 3:8, 1 Thessalonians 2:5, 1 Thessalonians 2:19, 1 Thessalonians 3:12, 2 Thessalonians 2:14, 2 Thessalonians 3:7, 1 Timothy 5:1, 2 Timothy 2:4, Philemon 1:5, Hebrews 1:4, Hebrews 1:6, Hebrews 11:25, 1 John 2:2, 1 John 2:4, 1 John 5:3, Revelation 16:4, Revelation 17:9, Revelation 19:14, Revelation 20:15, Revelation 22:7, Genesis 2:22, Genesis 12:20, Genesis 18:15, Genesis 21:2, Genesis 26:26, Genesis 27:11, Genesis 27:17, Genesis 31:7, Genesis 31:28, Genesis 34:28, Exodus 3:10, Exodus 4:26, Exodus 5:17, Exodus 8:27, Exodus 12:9, Exodus 12:41, Exodus 13:6, Exodus 19:19, Exodus 22:2, Exodus 22:15, Exodus 26:30, Exodus 27:8, Exodus 28:40, Exodus 37:20, Exodus 39:31, Leviticus 7:10, Leviticus 14:5, Leviticus 16:7, Leviticus 27:25, Numbers 3:3, Numbers 16:34, Numbers 24:18, Numbers 33:14, Deuteronomy 1:24, Deuteronomy 8:8, Deuteronomy 9:17, Deuteronomy 10:13, Deuteronomy 12:9, Deuteronomy 24:6, Deuteronomy 28:38, Deuteronomy 28:44, Joshua 13:7, Judges 1:11, Judges 9:8, Judges 18:6, Judges 21:15, 1 Samuel 16:22, 1 Samuel 18:28, 1 Samuel 24:14, 1 Samuel 25:32, 2 Samuel 5:14, 2 Samuel 14:10, 2 Samuel 19:33, 1 Kings 4:3, 1 Kings 9:28, 1 Kings 21:5, 2 Kings 14:20, 2 Kings 14:29, 2 Kings 15:3, 2 Kings 19:30, 2 Kings 25:20, 1 Chronicles 8:8, 1 Chronicles 9:14, 1 Chronicles 12:22, 1 Chronicles 14:17, 1 Chronicles 22:7, 1 Chronicles 23:6, 1 Chronicles 24:1, 1 Chronicles 24:20, 1 Chronicles 27:15, 1 Chronicles 28:10, 2 Chronicles 9:15, 2 Chronicles 13:17, 2 Chronicles 17:13, 2 Chronicles 26:4, 2 Chronicles 36:2, Esther 2:10, Esther 2:19, Job 8:4, Job 11:18, Job 15:20, Job 19:12, Job 33:15, Psalms 4:6, Psalms 6:6, Psalms 22:25, Psalms 31:2, Psalms 35:20, Psalms 50:1, Psalms 50:3, Psalms 64:10, Psalms 69:35, Psalms 70:5, Psalms 74:19, Psalms 77:16, Psalms 78:7, Psalms 86:9, Psalms 89:7, Psalms 98:2, Psalms 104:15, Proverbs 5:20, Proverbs 10:1, Proverbs 19:19, Proverbs 19:26, Proverbs 20:2, Proverbs 28:7, Proverbs 28:17, Proverbs 31:4, Ecclesiastes 2:9, Ecclesiastes 3:13, Ecclesiastes 3:21, Ecclesiastes 5:4, Ecclesiastes 5:13, Song of Solomon 2:15, Song of Solomon 7:9, Isaiah 1:25, Isaiah 8:13, Isaiah 11:1, Isaiah 14:10, Isaiah 21:5, Isaiah 37:31, Isaiah 59:20, Isaiah 63:19, Isaiah 64:12, Jeremiah 23:30, Jeremiah 31:39, Jeremiah 33:2, Jeremiah 36:18, Jeremiah 51:13, Jeremiah 52:26, Lamentations 3:32, Ezekiel 28:15, Ezekiel 31:2, Ezekiel 33:19, Ezekiel 39:24, Ezekiel 40:14, Ezekiel 42:2, Daniel 4:5, Amos 2:12, Micah 7:7, Habakkuk 2:14, Zephaniah 1:16, Zechariah 4:1, Zechariah 7:13, Matthew 1:21, Matthew 7:16, Matthew 10:11, Matthew 14:6, Matthew 16:1, Matthew 21:3, Matthew 26:27, Matthew 26:61, Matthew 27:37, Matthew 27:53, Matthew 28:5, Mark 1:29, Mark 6:15, Mark 9:28, Mark 16:12, Luke 1:29, Luke 5:2, Luke 9:44, Luke 10:42, Luke 11:37, Luke 11:43, Luke 14:29, Luke 16:5, Luke 16:19, Luke 18:4, Luke 19:4, Luke 24:25, John 4:5, John 7:30, John 8:23, John 11:16, John 18:13, John 18:32, John 19:42, John 21:4, Acts 2:9, Acts 8:19, Acts 9:24, Acts 20:21, Acts 20:23, Acts 25:4, Romans 2:19, Romans 4:14, Romans 6:3, 1 Corinthians 3:5, 1 Corinthians 7:19, 1 Corinthians 11:19, 2 Corinthians 1:3, 2 Corinthians 3:11, 2 Corinthians 11:10, Galatians 4:6, Ephesians 1:10, Ephesians 3:21, Ephesians 4:4, Ephesians 6:5, Philippians 1:23, Philippians 4:11, Colossians 1:2, Colossians 1:13, 1 Thessalonians 5:1, 2 Thessalonians 2:9, 2 Thessalonians 2:12, 2 Thessalonians 3:16, 1 Timothy 2:12, 1 Timothy 3:10, Hebrews 4:11, Hebrews 7:20, James 1:4, 1 Peter 3:8, 2 Peter 1:14, 3 John 1:5, Revelation 1:12, Revelation 7:6, Revelation 11:16, Genesis 4:2, Genesis 5:1, Genesis 6:12, Genesis 16:7, Genesis 17:6, Genesis 18:12, Genesis 21:29, Genesis 26:27, Genesis 29:9, Genesis 30:29, Genesis 30:39, Genesis 41:13, Genesis 41:52, Exodus 1:15, Exodus 2:18, Exodus 6:18, Exodus 12:2, Exodus 16:2, Exodus 17:11, Exodus 20:19, Exodus 22:26, Exodus 23:30, Exodus 30:7, Exodus 39:39, Leviticus 10:11, Leviticus 11:25, Leviticus 13:44, Leviticus 19:25, Leviticus 21:11, Numbers 8:10, Numbers 26:45, Numbers 33:51, Deuteronomy 3:5, Deuteronomy 4:48, Deuteronomy 5:3, Deuteronomy 16:12, Deuteronomy 16:21, Deuteronomy 25:10, Deuteronomy 30:8, Joshua 9:25, Joshua 10:7, Joshua 13:2, Joshua 13:28, Joshua 18:2, Judges 1:5, Judges 3:23, Judges 4:8, Judges 11:32, Judges 12:14, Judges 13:24, Judges 14:10, Judges 18:4, Judges 18:21, Ruth 2:1, Ruth 2:16, 1 Samuel 1:17, 1 Samuel 2:11, 1 Samuel 2:23, 1 Samuel 17:19, 1 Samuel 18:11, 1 Samuel 20:22, 1 Samuel 20:23, 1 Samuel 23:18, 2 Samuel 7:1, 2 Samuel 8:17, 2 Samuel 23:19, 1 Kings 3:5, 1 Kings 4:5, 1 Kings 7:19, 2 Kings 3:8, 2 Kings 6:14, 2 Kings 7:14, 2 Kings 17:2, 2 Kings 17:5, 1 Chronicles 4:12, 1 Chronicles 5:8, 1 Chronicles 6:39, 1 Chronicles 6:66, 1 Chronicles 9:32, 1 Chronicles 11:21, 1 Chronicles 18:16, 1 Chronicles 23:19, 1 Chronicles 29:28, 2 Chronicles 3:13, 2 Chronicles 15:11, 2 Chronicles 22:12, 2 Chronicles 34:6, 2 Chronicles 35:2, Ezra 8:3, Ezra 10:30, Job 5:5, Job 5:25, Job 24:1, Job 27:6, Job 28:3, Job 31:28, Job 33:24, Job 36:11, Psalms 1:5, Psalms 21:10, Psalms 27:2, Psalms 35:17, Psalms 36:4, Psalms 42:7, Psalms 55:22, Psalms 58:8, Psalms 64:5, Psalms 68:22, Psalms 69:26, Psalms 74:20, Psalms 81:16, Psalms 90:5, Psalms 102:18, Psalms 105:44, Psalms 111:9, Psalms 115:7, Psalms 118:15, Psalms 123:4, Psalms 138:4, Psalms 140:12, Psalms 146:7, Proverbs 1:19, Proverbs 1:28, Proverbs 3:28, Proverbs 6:26, Proverbs 11:5, Proverbs 18:19, Proverbs 29:18, Song of Solomon 3:7, Song of Solomon 5:8, Isaiah 21:12, Isaiah 22:12, Isaiah 32:3, Isaiah 41:5, Isaiah 57:20, Isaiah 65:3, Jeremiah 2:33, Jeremiah 3:9, Jeremiah 5:11, Jeremiah 5:27, Jeremiah 9:6, Jeremiah 12:17, Jeremiah 31:30, Jeremiah 36:17, Jeremiah 36:19, Jeremiah 48:13, Jeremiah 51:10, Jeremiah 51:20, Jeremiah 51:45, Jeremiah 51:49, Ezekiel 1:9, Ezekiel 1:12, Ezekiel 4:10, Ezekiel 7:18, Ezekiel 11:18, Ezekiel 13:12, Ezekiel 20:4, Ezekiel 22:24, Ezekiel 24:1, Ezekiel 24:5, Ezekiel 30:8, Ezekiel 41:20, Hosea 2:17, Hosea 4:16, Jonah 2:5, Jonah 4:7, Habakkuk 3:9, Haggai 2:15, Zechariah 8:15, Matthew 1:7, Matthew 2:12, Matthew 9:8, Matthew 10:27, Matthew 10:32, Matthew 14:5, Matthew 19:4, Matthew 20:28, Matthew 22:29, Matthew 25:16, Mark 5:36, Mark 5:43, Mark 10:34, Mark 13:21, Mark 15:4, Luke 2:8, Luke 9:29, Luke 12:7, Luke 14:19, Luke 14:32, Luke 15:24, Luke 16:11, Luke 16:23, Luke 18:32, John 1:12, John 11:52, John 16:18, John 21:22, Acts 5:27, Acts 7:22, Acts 7:56, Acts 8:31, Acts 8:35, Acts 15:27, Acts 16:11, Acts 23:16, Acts 23:28, Acts 27:31, Romans 2:21, Romans 9:1, Romans 12:16, Romans 14:9, 1 Corinthians 1:4, 1 Corinthians 5:12, 1 Corinthians 7:10, 1 Corinthians 7:38, 1 Corinthians 15:49, 2 Corinthians 2:12, 2 Corinthians 6:8, 2 Corinthians 8:6, 2 Corinthians 8:8, Ephesians 1:14, Ephesians 2:8, Philippians 2:2, Colossians 1:12, 1 Timothy 1:5, 1 Timothy 2:8, 1 Timothy 6:14, Titus 3:15, Hebrews 8:7, Hebrews 13:18, James 1:1, James 3:9, 1 John 1:6, 1 John 2:17, Revelation 1:18, Revelation 10:3, Revelation 21:15, Genesis 3:23, Genesis 7:18, Genesis 10:21, Genesis 11:27, Genesis 13:4, Genesis 15:3, Genesis 18:33, Genesis 21:20, Genesis 22:18, Genesis 34:20, Genesis 35:20, Genesis 43:25, Genesis 45:12, Genesis 46:30, Exodus 2:24, Exodus 6:19, Exodus 16:5, Exodus 16:25, Exodus 28:17, Exodus 32:22, Leviticus 4:5, Leviticus 11:8, Leviticus 18:25, Leviticus 18:28, Numbers 1:4, Numbers 3:1, Numbers 4:10, Numbers 6:23, Numbers 12:11, Numbers 22:12, Numbers 26:21, Numbers 26:30, Numbers 28:10, Numbers 28:23, Numbers 31:13, Numbers 34:6, Numbers 35:26, Deuteronomy 4:17, Deuteronomy 10:14, Deuteronomy 16:5, Deuteronomy 24:10, Deuteronomy 33:28, Joshua 7:20, Joshua 13:17, Joshua 21:33, Judges 3:21, Judges 11:16, Judges 16:16, Judges 17:11, 1 Samuel 1:21, 1 Samuel 20:11, 1 Samuel 21:14, 2 Samuel 1:14, 2 Samuel 2:9, 2 Samuel 16:17, 2 Samuel 18:6, 1 Kings 1:14, 1 Kings 10:24, 1 Kings 13:23, 1 Kings 17:11, 2 Kings 11:6, 2 Kings 20:7, 1 Chronicles 1:33, 1 Chronicles 4:3, 1 Chronicles 4:43, 1 Chronicles 6:3, 1 Chronicles 16:7, 2 Chronicles 13:22, 2 Chronicles 14:3, Nehemiah 3:24, Nehemiah 12:41, Job 1:14, Job 4:20, Job 9:19, Job 20:20, Job 21:34, Job 32:11, Job 33:23, Psalms 10:7, Psalms 12:1, Psalms 21:7, Psalms 30:12, Psalms 31:9, Psalms 32:4, Psalms 36:10, Psalms 66:3, Psalms 68:33, Psalms 74:9, Psalms 89:11, Psalms 91:14, Psalms 91:15, Psalms 104:28, Proverbs 1:23, Proverbs 8:30, Proverbs 13:2, Proverbs 16:5, Proverbs 19:23, Proverbs 21:11, Proverbs 22:16, Proverbs 25:8, Proverbs 30:33, Ecclesiastes 1:14, Ecclesiastes 5:14, Isaiah 23:7, Isaiah 41:27, Isaiah 43:13, Isaiah 57:18, Isaiah 63:18, Jeremiah 3:15, Jeremiah 14:20, Jeremiah 19:12, Jeremiah 22:16, Jeremiah 35:1, Jeremiah 47:6, Jeremiah 48:40, Ezekiel 13:3, Ezekiel 21:20, Ezekiel 21:25, Ezekiel 26:6, Ezekiel 30:15, Ezekiel 34:15, Ezekiel 35:4, Ezekiel 38:7, Ezekiel 39:3, Daniel 2:32, Daniel 5:1, Daniel 5:18, Daniel 12:8, Hosea 2:10, Hosea 5:8, Amos 6:5, Amos 6:13, Amos 7:13, Amos 9:10, Jonah 1:2, Nahum 1:9, Nahum 2:5, Zechariah 11:10, Matthew 1:4, Matthew 9:12, Matthew 10:3, Matthew 12:38, Matthew 19:6, Matthew 19:26, Matthew 22:12, Matthew 23:28, Mark 1:21, Mark 1:40, Mark 3:2, Mark 3:6, Mark 4:34, Mark 5:41, Mark 8:2, Mark 8:4, Mark 9:14, Mark 10:45, Mark 12:6, Mark 14:67, Luke 1:42, Luke 5:35, Luke 8:4, Luke 9:9, Luke 9:62, Luke 16:12, Luke 18:7, Luke 22:2, John 1:41, John 6:7, John 6:44, John 7:15, John 12:21, John 16:15, John 16:26, John 17:2, John 19:32, John 21:14, Acts 1:15, Acts 2:41, Acts 9:1, Acts 9:3, Acts 9:41, Acts 18:3, Acts 18:21, Acts 27:4, Acts 27:11, Romans 4:6, Romans 4:24, Romans 5:1, Romans 5:13, Romans 8:20, Romans 11:6, Romans 13:5, Romans 16:20, 1 Corinthians 3:2, 1 Corinthians 12:25, 1 Corinthians 13:3, 1 Corinthians 15:42, Galatians 5:1, Philippians 1:11, Philippians 1:17, Philippians 1:22, 1 Thessalonians 5:15, Hebrews 7:23, Hebrews 10:10, Hebrews 10:28, Hebrews 11:33, Hebrews 13:23, James 5:10, 1 Peter 5:6, 2 Peter 1:6, Revelation 2:12, Revelation 12:15, Genesis 18:20, Genesis 18:27, Genesis 19:38, Genesis 20:2, Genesis 25:4, Genesis 27:13, Genesis 28:3, Genesis 35:17, Genesis 38:2, Genesis 39:18, Genesis 42:5, Exodus 2:2, Exodus 7:12, Exodus 12:5, Exodus 14:7, Exodus 15:4, Exodus 16:21, Exodus 18:13, Exodus 24:6, Exodus 25:26, Exodus 28:14, Exodus 39:9, Leviticus 7:26, Leviticus 9:21, Leviticus 24:5, Leviticus 25:53, Numbers 3:33, Numbers 15:32, Numbers 17:13, Numbers 26:3, Numbers 29:17, Numbers 32:20, Numbers 33:48, Deuteronomy 1:13, Deuteronomy 1:45, Deuteronomy 8:10, Deuteronomy 18:2, Deuteronomy 18:19, Deuteronomy 23:1, Joshua 1:3, Joshua 3:11, Joshua 19:32, Judges 1:28, Judges 5:2, Judges 7:17, Judges 9:40, Judges 12:7, Ruth 1:20, 1 Samuel 2:26, 1 Samuel 17:54, 1 Samuel 24:9, 1 Samuel 26:18, 1 Samuel 26:22, 2 Samuel 2:12, 2 Samuel 7:15, 2 Samuel 11:16, 2 Samuel 14:5, 2 Samuel 14:27, 2 Samuel 19:3, 2 Samuel 22:9, 2 Samuel 24:11, 1 Kings 4:30, 1 Kings 8:17, 1 Kings 17:3, 2 Kings 4:12, 2 Kings 14:4, 2 Kings 18:36, 2 Kings 19:24, 1 Chronicles 3:15, 1 Chronicles 6:48, 1 Chronicles 9:18, 1 Chronicles 17:4, 1 Chronicles 21:6, 1 Chronicles 27:20, 2 Chronicles 6:7, 2 Chronicles 14:4, 2 Chronicles 20:4, 2 Chronicles 20:11, Ezra 6:4, Job 3:5, Job 17:5, Job 28:11, Job 31:12, Psalms 8:1, Psalms 10:2, Psalms 10:17, Psalms 18:8, Psalms 19:5, Psalms 25:3, Psalms 31:21, Psalms 45:9, Psalms 46:10, Psalms 50:16, Psalms 53:3, Psalms 53:4, Psalms 62:10, Psalms 69:9, Psalms 74:11, Psalms 78:50, Psalms 95:2, Psalms 104:1, Psalms 107:26, Psalms 116:3, Psalms 128:2, Psalms 139:12, Psalms 141:2, Proverbs 11:9, Proverbs 11:21, Proverbs 12:4, Proverbs 17:15, Proverbs 22:29, Proverbs 25:5, Proverbs 26:2, Proverbs 27:14, Proverbs 27:22, Ecclesiastes 3:12, Ecclesiastes 5:20, Ecclesiastes 10:1, Ecclesiastes 10:14, Song of Solomon 3:8, Isaiah 17:1, Isaiah 26:13, Isaiah 40:17, Isaiah 45:10, Isaiah 61:2, Jeremiah 11:9, Jeremiah 14:2, Jeremiah 33:7, Jeremiah 48:20, Ezekiel 2:2, Ezekiel 8:7, Ezekiel 20:11, Ezekiel 22:21, Ezekiel 23:6, Ezekiel 23:41, Ezekiel 29:1, Ezekiel 36:24, Ezekiel 37:4, Ezekiel 40:31, Daniel 2:19, Daniel 2:20, Amos 5:26, Jonah 2:7, Micah 6:1, Habakkuk 2:4, Zephaniah 3:4, Matthew 5:46, Matthew 10:34, Matthew 13:49, Matthew 15:37, Matthew 18:26, Matthew 23:26, Matthew 27:15, Matthew 27:32, Mark 3:21, Mark 3:29, Mark 4:13, Mark 4:21, Mark 5:29, Mark 6:36, Mark 9:15, Mark 12:5, Mark 12:18, Luke 1:25, Luke 4:1, Luke 6:32, Luke 8:38, Luke 8:52, Luke 13:24, Luke 14:3, Luke 17:29, Luke 19:12, Luke 21:5, Luke 23:23, Luke 24:35, John 6:31, John 6:54, John 6:65, John 7:38, John 8:11, John 8:31, John 8:37, John 11:20, John 12:25, John 19:9, Acts 1:26, Acts 3:18, Acts 3:23, Acts 4:7, Acts 8:16, Acts 13:4, Acts 15:8, Acts 17:14, Acts 23:34, Romans 3:22, Romans 9:9, Romans 9:31, Romans 15:1, 1 Corinthians 4:4, 1 Corinthians 6:10, 1 Corinthians 10:1, 1 Corinthians 12:11, 2 Corinthians 1:5, 2 Corinthians 1:23, 2 Corinthians 2:15, Galatians 4:3, Ephesians 3:18, Ephesians 4:10, 2 Thessalonians 3:4, 1 Timothy 5:9, 1 Timothy 5:20, 2 Timothy 4:16, Titus 2:7, Titus 3:1, Hebrews 9:17, James 1:15, 2 Peter 1:5, 1 John 3:6, Revelation 6:13, Genesis 1:27, Genesis 9:18, Genesis 18:13, Genesis 34:26, Genesis 37:23, Genesis 39:2, Genesis 40:9, Genesis 41:7, Genesis 43:22, Genesis 50:2, Exodus 2:20, Exodus 3:21, Exodus 4:8, Exodus 4:30, Exodus 9:21, Exodus 12:43, Exodus 21:10, Exodus 21:11, Exodus 24:11, Exodus 30:14, Exodus 39:24, Leviticus 9:13, Leviticus 11:7, Leviticus 11:24, Numbers 14:23, Numbers 15:21, Numbers 15:41, Numbers 21:14, Numbers 24:2, Numbers 28:5, Numbers 30:13, Numbers 31:42, Numbers 32:25, Deuteronomy 2:15, Deuteronomy 16:17, Deuteronomy 20:15, Deuteronomy 28:2, Deuteronomy 34:12, Joshua 3:5, Joshua 8:15, Joshua 21:19, Judges 5:7, Judges 6:12, 1 Samuel 14:38, 1 Samuel 19:15, 1 Samuel 20:35, 1 Samuel 25:1, 1 Samuel 27:7, 1 Samuel 28:10, 1 Samuel 31:3, 2 Samuel 1:5, 2 Samuel 2:14, 2 Samuel 2:28, 2 Samuel 15:26, 1 Kings 2:45, 1 Kings 6:9, 1 Kings 22:25, 2 Kings 4:23, 2 Kings 15:37, 2 Kings 25:28, 1 Chronicles 9:4, 1 Chronicles 15:14, 1 Chronicles 27:11, 2 Chronicles 3:14, 2 Chronicles 11:12, 2 Chronicles 18:24, Ezra 8:24, Nehemiah 3:32, Esther 2:2, Esther 9:10, Job 10:1, Job 14:14, Job 15:23, Job 22:30, Job 29:13, Job 32:12, Psalms 9:15, Psalms 11:6, Psalms 14:3, Psalms 25:5, Psalms 26:1, Psalms 44:17, Psalms 51:16, Psalms 58:10, Psalms 71:16, Psalms 73:27, Psalms 78:49, Psalms 81:5, Psalms 84:2, Psalms 97:2, Psalms 99:7, Psalms 99:8, Psalms 103:11, Psalms 106:45, Proverbs 11:13, Proverbs 11:24, Proverbs 12:14, Proverbs 16:15, Proverbs 16:32, Proverbs 28:16, Isaiah 22:8, Isaiah 22:9, Isaiah 24:4, Isaiah 24:21, Isaiah 28:12, Isaiah 30:9, Isaiah 40:7, Isaiah 45:5, Isaiah 54:15, Isaiah 63:8, Jeremiah 2:9, Jeremiah 8:21, Jeremiah 20:13, Jeremiah 31:17, Jeremiah 39:8, Jeremiah 49:21, Ezekiel 16:54, Ezekiel 21:9, Ezekiel 23:36, Ezekiel 24:4, Ezekiel 24:10, Ezekiel 27:5, Ezekiel 29:2, Ezekiel 31:1, Ezekiel 32:22, Ezekiel 46:8, Hosea 8:6, Hosea 9:17, Joel 3:10, Amos 8:6, Micah 2:6, Habakkuk 2:9, Zephaniah 1:11, Zephaniah 3:10, Zephaniah 3:12, Matthew 1:8, Matthew 4:13, Matthew 7:8, Matthew 7:12, Matthew 8:2, Matthew 8:17, Matthew 11:24, Matthew 13:34, Matthew 13:43, Matthew 13:47, Matthew 14:20, Matthew 19:7, Matthew 22:23, Matthew 24:50, Matthew 27:4, Mark 1:15, Mark 3:28, Mark 5:16, Mark 5:34, Mark 6:5, Mark 7:21, Mark 9:13, Mark 12:35, Mark 14:10, Mark 16:3, Luke 2:12, Luke 2:35, Luke 2:49, Luke 9:1, Luke 11:10, Luke 13:31, Luke 16:22, Luke 19:13, Luke 19:23, John 1:25, John 7:45, John 9:35, John 12:50, John 14:7, John 15:21, John 19:36, Acts 1:25, Acts 4:4, Acts 5:8, Acts 7:3, Acts 9:34, Acts 10:10, Acts 10:19, Acts 17:2, Acts 24:8, Romans 3:13, Romans 11:9, 1 Corinthians 3:17, 1 Corinthians 5:2, 2 Corinthians 1:24, 2 Corinthians 8:3, 2 Corinthians 8:15, 2 Corinthians 8:17, 2 Corinthians 8:18, Ephesians 4:15, 1 Thessalonians 5:12, 1 Timothy 4:4, 1 Timothy 5:24, Titus 1:12, Hebrews 10:30, Hebrews 10:32, 1 Peter 1:5, 1 Peter 4:2, Revelation 1:8, Revelation 2:26, Revelation 7:10, Revelation 7:16, Revelation 8:4, Revelation 21:13, Genesis 4:10, Genesis 5:3, Genesis 11:8, Genesis 14:11, Genesis 24:9, Genesis 34:3, Genesis 34:17, Genesis 36:16, Genesis 39:10, Genesis 41:2, Exodus 13:8, Exodus 22:17, Exodus 29:15, Exodus 30:33, Exodus 35:11, Exodus 39:38, Leviticus 11:39, Numbers 5:28, Numbers 10:21, Numbers 21:27, Numbers 23:16, Numbers 25:2, Numbers 32:26, Deuteronomy 23:11, Deuteronomy 33:20, Joshua 1:16, Joshua 2:17, Joshua 4:4, Joshua 5:2, Joshua 9:20, Joshua 10:41, Judges 1:32, Judges 3:29, Judges 5:13, Judges 19:21, Judges 20:27, Judges 21:1, 1 Samuel 3:12, 1 Samuel 8:2, 1 Samuel 8:3, 1 Samuel 8:19, 1 Samuel 17:10, 1 Samuel 19:6, 1 Samuel 23:27, 2 Samuel 1:3, 2 Samuel 1:9, 2 Samuel 6:13, 2 Samuel 9:8, 2 Samuel 15:16, 2 Samuel 19:30, 2 Samuel 20:13, 2 Samuel 20:16, 1 Kings 7:3, 1 Kings 11:14, 1 Kings 13:13, 1 Kings 15:12, 2 Kings 10:35, 2 Kings 11:3, 2 Kings 23:14, 1 Chronicles 4:23, 1 Chronicles 4:39, 1 Chronicles 6:65, 1 Chronicles 16:31, 1 Chronicles 26:7, 1 Chronicles 28:3, 1 Chronicles 28:14, 2 Chronicles 20:3, 2 Chronicles 29:29, 2 Chronicles 32:10, Ezra 5:10, Ezra 7:12, Ezra 10:25, Nehemiah 3:3, Nehemiah 4:11, Nehemiah 5:4, Esther 9:14, Job 12:3, Job 24:15, Job 27:13, Psalms 18:13, Psalms 19:9, Psalms 22:15, Psalms 35:25, Psalms 54:6, Psalms 58:11, Psalms 61:2, Psalms 65:10, Psalms 80:17, Psalms 92:9, Psalms 93:4, Psalms 101:7, Psalms 119:48, Psalms 142:3, Proverbs 14:33, Proverbs 23:5, Ecclesiastes 6:6, Ecclesiastes 12:2, Isaiah 3:15, Isaiah 13:2, Isaiah 13:17, Isaiah 15:3, Isaiah 21:15, Isaiah 25:12, Jeremiah 9:14, Jeremiah 20:17, Jeremiah 26:1, Jeremiah 33:1, Jeremiah 44:5, Jeremiah 52:32, Ezekiel 16:40, Ezekiel 19:3, Ezekiel 20:17, Ezekiel 22:6, Ezekiel 23:43, Ezekiel 24:19, Ezekiel 32:1, Ezekiel 32:6, Ezekiel 35:13, Ezekiel 36:27, Ezekiel 40:38, Ezekiel 48:9, Daniel 2:17, Daniel 4:24, Daniel 11:26, Daniel 11:34, Amos 5:25, Micah 1:15, Micah 4:11, Zechariah 2:5, Zechariah 8:11, Zechariah 11:8, Malachi 1:3, Matthew 1:5, Matthew 7:3, Matthew 10:29, Matthew 15:2, Matthew 16:14, Matthew 19:3, Matthew 20:13, Matthew 22:46, Matthew 25:1, Matthew 25:14, Matthew 26:15, Matthew 27:57, Mark 4:36, Mark 5:31, Mark 8:7, Mark 8:15, Mark 9:7, Mark 11:24, Mark 12:2, Luke 6:33, Luke 6:41, Luke 13:27, Luke 17:21, Luke 19:24, Luke 19:38, Luke 22:18, Luke 24:36, John 4:18, John 5:32, John 6:30, John 7:27, John 8:47, John 10:10, John 18:33, John 19:5, Acts 3:7, Acts 10:47, Acts 11:11, Acts 14:5, Acts 25:22, Acts 26:25, Romans 11:7, Romans 11:13, Romans 11:30, 1 Corinthians 1:7, 1 Corinthians 7:40, 1 Corinthians 8:12, 1 Corinthians 13:1, 1 Corinthians 15:1, 1 Corinthians 15:45, 1 Corinthians 16:7, 1 Corinthians 16:10, 2 Corinthians 4:7, 2 Corinthians 4:17, 2 Corinthians 5:6, 2 Corinthians 8:1, 2 Corinthians 12:16, Galatians 3:11, Galatians 4:17, Ephesians 1:15, Ephesians 4:31, Ephesians 5:2, Ephesians 5:28, Ephesians 5:33, Ephesians 6:14, 2 Timothy 4:5, Titus 1:4, Philemon 1:19, Hebrews 1:14, Hebrews 6:13, James 3:7, 1 Peter 1:6, 1 Peter 1:20, 1 Peter 2:15, 1 Peter 2:16, 1 Peter 3:5, 2 Peter 3:13, 1 John 3:7, Revelation 1:6, Revelation 1:15, Revelation 1:19, Revelation 7:5, Revelation 13:11, Genesis 6:2, Genesis 16:1, Genesis 21:33, Genesis 22:11, Genesis 23:18, Genesis 34:10, Genesis 39:3, Genesis 44:14, Exodus 5:5, Exodus 9:12, Exodus 12:25, Exodus 21:3, Exodus 23:1, Exodus 23:7, Exodus 26:3, Exodus 28:36, Exodus 32:21, Exodus 32:32, Exodus 35:4, Exodus 39:28, Exodus 40:4, Leviticus 8:10, Leviticus 19:5, Leviticus 22:19, Leviticus 23:31, Leviticus 25:32, Leviticus 25:39, Leviticus 25:51, Numbers 4:2, Numbers 23:6, Numbers 31:20, Numbers 31:27, Numbers 33:53, Numbers 35:19, Deuteronomy 1:20, Deuteronomy 1:35, Deuteronomy 19:19, Deuteronomy 21:22, Deuteronomy 26:4, Joshua 1:1, Joshua 6:14, Joshua 13:32, Joshua 21:12, Judges 1:18, Judges 5:21, Judges 6:6, Judges 7:9, Judges 9:13, Judges 15:3, Judges 19:14, Ruth 1:14, 1 Samuel 5:2, 1 Samuel 8:15, 1 Samuel 15:29, 1 Samuel 16:21, 1 Samuel 23:6, 1 Samuel 30:5, 2 Samuel 1:15, 2 Samuel 8:18, 2 Samuel 10:10, 2 Samuel 10:13, 2 Samuel 19:12, 2 Samuel 23:23, 2 Samuel 24:23, 1 Kings 7:34, 1 Kings 8:14, 1 Kings 18:15, 2 Kings 9:8, 2 Kings 13:9, 1 Chronicles 3:22, 1 Chronicles 6:10, 1 Chronicles 11:25, 1 Chronicles 16:6, 1 Chronicles 19:14, 1 Chronicles 22:1, 1 Chronicles 22:4, 2 Chronicles 6:3, 2 Chronicles 6:11, 2 Chronicles 9:7, 2 Chronicles 32:20, 2 Chronicles 32:28, 2 Chronicles 35:26, Ezra 2:65, Nehemiah 1:10, Nehemiah 6:17, Nehemiah 9:16, Nehemiah 12:40, Job 7:4, Job 9:20, Job 10:3, Job 12:6, Job 16:13, Job 19:15, Job 23:9, Job 24:9, Job 31:13, Job 34:11, Psalms 6:10, Psalms 8:3, Psalms 9:10, Psalms 12:6, Psalms 22:1, Psalms 23:5, Psalms 30:11, Psalms 49:13, Psalms 71:13, Psalms 74:23, Psalms 86:16, Psalms 89:2, Psalms 89:14, Psalms 93:3, Psalms 104:24, Psalms 109:18, Psalms 110:4, Psalms 129:8, Psalms 140:8, Psalms 148:13, Proverbs 4:18, Proverbs 6:23, Proverbs 24:27, Song of Solomon 5:15, Song of Solomon 6:2, Isaiah 3:3, Isaiah 5:27, Isaiah 10:25, Isaiah 10:29, Isaiah 14:24, Isaiah 21:4, Isaiah 26:16, Isaiah 27:7, Isaiah 33:2, Isaiah 57:14, Isaiah 60:12, Isaiah 64:3, Jeremiah 1:1, Jeremiah 4:8, Jeremiah 4:23, Jeremiah 10:23, Jeremiah 36:1, Jeremiah 37:8, Jeremiah 51:37, Ezekiel 2:7, Ezekiel 8:8, Ezekiel 8:15, Ezekiel 21:30, Ezekiel 25:5, Ezekiel 28:8, Ezekiel 30:20, Ezekiel 32:28, Ezekiel 34:19, Ezekiel 38:10, Ezekiel 47:23, Daniel 4:13, Hosea 4:5, Hosea 4:9, Hosea 7:9, Hosea 9:12, Hosea 10:3, Amos 7:15, Nahum 2:10, Haggai 1:2, Zechariah 2:10, Zechariah 7:2, Zechariah 8:7, Zechariah 9:3, Malachi 4:4, Matthew 13:39, Matthew 14:24, Matthew 15:5, Matthew 18:23, Matthew 20:17, Matthew 23:3, Matthew 26:35, Matthew 27:62, Mark 7:13, Mark 7:36, Mark 13:24, Mark 14:47, Luke 1:1, Luke 1:2, Luke 1:45, Luke 7:49, Luke 8:55, Luke 9:17, Luke 9:38, Luke 12:19, Luke 15:25, Luke 20:11, Luke 20:15, Luke 20:18, Luke 21:4, Luke 23:39, Luke 23:47, John 8:3, John 8:24, John 10:5, John 11:11, John 18:14, Acts 1:21, Acts 3:24, Acts 5:32, Acts 15:33, Acts 16:29, Acts 18:10, Acts 22:8, Acts 27:8, Acts 27:16, Romans 2:7, Romans 6:9, 1 Corinthians 1:16, 1 Corinthians 9:1, 1 Corinthians 9:2, 1 Corinthians 15:37, 1 Corinthians 16:1, 2 Corinthians 5:17, 2 Corinthians 8:5, 2 Corinthians 9:9, Galatians 1:7, 1 Thessalonians 2:10, 1 Thessalonians 2:15, 2 Thessalonians 1:1, Titus 3:2, Hebrews 6:8, Hebrews 10:12, 2 Peter 1:15, Genesis 2:18, Genesis 3:11, Genesis 10:9, Genesis 13:11, Genesis 18:1, Genesis 27:23, Genesis 33:3, Genesis 37:36, Genesis 45:7, Exodus 3:11, Exodus 5:11, Exodus 7:24, Exodus 19:22, Exodus 21:2, Exodus 21:30, Exodus 22:13, Exodus 26:7, Exodus 27:14, Exodus 30:31, Exodus 39:37, Leviticus 3:16, Leviticus 15:16, Leviticus 17:3, Leviticus 26:18, Leviticus 26:19, Numbers 3:50, Numbers 32:23, Deuteronomy 10:18, Deuteronomy 10:20, Deuteronomy 19:2, Deuteronomy 27:7, Deuteronomy 31:30, Joshua 6:1, Joshua 24:25, Judges 15:15, 1 Samuel 8:6, 1 Samuel 20:36, 2 Samuel 2:2, 2 Samuel 8:13, 2 Samuel 9:13, 2 Samuel 12:14, 2 Samuel 20:4, 2 Samuel 22:8, 1 Kings 1:36, 1 Kings 8:41, 1 Kings 10:6, 1 Kings 11:37, 1 Kings 17:22, 1 Kings 20:37, 1 Kings 20:38, 2 Kings 4:17, 2 Kings 10:27, 2 Kings 16:1, 2 Kings 18:29, 2 Kings 21:4, 2 Kings 24:10, 2 Kings 25:29, 1 Chronicles 2:54, 1 Chronicles 5:16, 1 Chronicles 11:8, 1 Chronicles 17:14, 1 Chronicles 21:30, 1 Chronicles 23:17, 1 Chronicles 24:2, 1 Chronicles 27:10, 1 Chronicles 27:21, 2 Chronicles 2:15, 2 Chronicles 6:6, 2 Chronicles 9:5, 2 Chronicles 13:6, 2 Chronicles 14:10, 2 Chronicles 15:4, 2 Chronicles 19:9, 2 Chronicles 26:14, 2 Chronicles 33:20, 2 Chronicles 35:23, 2 Chronicles 36:1, Ezra 6:10, Nehemiah 4:21, Nehemiah 7:67, Job 3:9, Job 8:6, Job 10:17, Job 30:12, Psalms 10:3, Psalms 17:15, Psalms 18:20, Psalms 36:7, Psalms 52:8, Psalms 54:3, Psalms 64:8, Psalms 68:8, Psalms 69:2, Psalms 71:19, Psalms 73:28, Psalms 92:7, Psalms 104:25, Psalms 125:2, Psalms 125:5, Psalms 130:7, Psalms 139:14, Psalms 142:6, Proverbs 8:13, Proverbs 10:13, Proverbs 11:29, Proverbs 30:32, Ecclesiastes 2:13, Ecclesiastes 4:3, Ecclesiastes 9:7, Song of Solomon 1:5, Isaiah 1:10, Isaiah 1:16, Isaiah 8:2, Isaiah 8:10, Isaiah 15:6, Isaiah 15:8, Isaiah 29:2, Isaiah 29:20, Isaiah 29:24, Isaiah 32:17, Isaiah 38:13, Isaiah 43:5, Isaiah 46:9, Jeremiah 6:8, Jeremiah 17:2, Jeremiah 23:13, Jeremiah 37:12, Jeremiah 50:23, Jeremiah 52:33, Ezekiel 14:5, Ezekiel 18:11, Ezekiel 27:36, Ezekiel 31:13, Ezekiel 36:28, Ezekiel 37:13, Ezekiel 40:15, Ezekiel 41:1, Ezekiel 41:18, Hosea 12:6, Joel 2:8, Joel 3:11, Obadiah 1:10, Micah 1:9, Micah 3:1, Matthew 1:19, Matthew 6:31, Matthew 10:16, Matthew 15:19, Matthew 17:2, Matthew 18:35, Matthew 21:45, Matthew 21:46, Matthew 23:5, Matthew 24:39, Matthew 26:41, Mark 1:31, Mark 3:11, Mark 12:40, Mark 14:38, Luke 1:27, Luke 4:26, Luke 8:44, Luke 14:14, Luke 17:37, Luke 20:2, Luke 20:25, Luke 20:47, Luke 21:37, Luke 22:30, Luke 22:49, Luke 23:27, Luke 24:1, John 3:3, John 3:12, John 10:4, John 13:19, John 14:6, John 19:2, Acts 1:6, Acts 1:7, Acts 7:29, Acts 11:24, Acts 15:28, Acts 15:32, Acts 18:9, Acts 21:35, Acts 22:9, Acts 22:28, 1 Corinthians 3:22, 1 Corinthians 7:7, 1 Corinthians 11:32, 1 Corinthians 14:28, 2 Corinthians 5:21, Ephesians 2:5, Philippians 4:1, Colossians 2:7, Colossians 3:12, Colossians 3:24, 1 Timothy 5:23, 2 Timothy 2:24, 2 Timothy 3:14, Titus 2:2, Hebrews 2:12, Hebrews 5:3, Hebrews 6:11, Hebrews 6:12, Hebrews 10:36, James 2:14, James 3:14, 1 John 3:15, Revelation 9:10, Genesis 4:9, Genesis 6:3, Genesis 11:7, Genesis 15:12, Genesis 22:20, Genesis 24:36, Genesis 26:2, Genesis 28:1, Genesis 29:19, Genesis 32:15, Genesis 36:13, Genesis 40:3, Exodus 5:13, Exodus 21:27, Exodus 21:33, Exodus 38:28, Exodus 40:12, Leviticus 14:2, Leviticus 14:47, Leviticus 14:49, Leviticus 22:8, Leviticus 25:26, Numbers 4:3, Numbers 8:13, Numbers 14:5, Numbers 15:22, Numbers 21:20, Numbers 21:32, Numbers 22:17, Numbers 27:20, Numbers 30:1, Deuteronomy 7:11, Deuteronomy 14:27, Deuteronomy 30:17, Deuteronomy 32:44, Joshua 7:16, Joshua 8:7, Joshua 14:8, Joshua 15:17, Joshua 19:16, Judges 1:29, Judges 8:4, Judges 11:10, Judges 11:15, Judges 18:8, 1 Samuel 6:11, 1 Samuel 11:13, 1 Samuel 15:14, 2 Samuel 1:18, 2 Samuel 11:19, 2 Samuel 16:19, 2 Samuel 22:21, 2 Samuel 22:43, 2 Samuel 24:8, 1 Kings 1:12, 1 Kings 2:17, 1 Kings 7:37, 1 Kings 13:7, 1 Kings 20:21, 2 Kings 4:19, 2 Kings 13:20, 1 Chronicles 8:28, 1 Chronicles 18:3, 1 Chronicles 19:11, 1 Chronicles 25:9, 1 Chronicles 26:1, 1 Chronicles 26:22, 1 Chronicles 27:34, 2 Chronicles 7:2, 2 Chronicles 9:26, 2 Chronicles 20:5, Nehemiah 11:16, Nehemiah 12:30, Job 10:22, Job 12:5, Job 19:29, Job 20:23, Job 29:25, Job 35:9, Job 35:14, Job 37:21, Job 39:16, Psalms 10:18, Psalms 19:7, Psalms 53:2, Psalms 59:7, Psalms 59:11, Psalms 63:11, Psalms 78:6, Psalms 78:31, Psalms 79:6, Psalms 79:11, Psalms 117:2, Psalms 118:12, Proverbs 13:13, Ecclesiastes 11:10, Isaiah 1:17, Isaiah 4:6, Isaiah 7:13, Isaiah 26:8, Isaiah 28:5, Isaiah 47:7, Jeremiah 1:14, Jeremiah 16:17, Jeremiah 18:14, Jeremiah 23:31, Jeremiah 26:7, Jeremiah 31:1, Jeremiah 51:8, Jeremiah 52:16, Lamentations 4:17, Ezekiel 7:22, Ezekiel 11:10, Ezekiel 16:29, Ezekiel 23:38, Ezekiel 27:26, Ezekiel 30:3, Ezekiel 31:7, Ezekiel 44:14, Daniel 7:18, Daniel 10:17, Hosea 2:16, Hosea 13:4, Joel 3:14, Amos 3:2, Micah 2:10, Micah 5:10, Nahum 1:10, Nahum 3:12, Nahum 3:16, Matthew 5:15, Matthew 5:23, Matthew 10:18, Matthew 10:26, Matthew 13:48, Matthew 23:39, Matthew 27:56, Matthew 27:63, Mark 2:10, Mark 4:37, Mark 5:5, Mark 6:8, Mark 7:10, Mark 11:8, Mark 12:9, Luke 1:58, Luke 5:25, Luke 7:40, Luke 10:38, Luke 14:1, Luke 16:6, Luke 18:3, Luke 19:29, Luke 22:42, Luke 23:41, Luke 23:56, Luke 24:46, John 6:23, John 7:36, John 9:25, John 10:3, John 16:28, John 17:5, John 19:19, Acts 1:24, Acts 2:45, Acts 4:6, Acts 5:31, Acts 7:31, Acts 14:9, Acts 20:30, Acts 22:6, Acts 23:19, Acts 23:33, Acts 25:2, Acts 28:28, Romans 1:8, Romans 2:9, Romans 10:16, Romans 15:15, 1 Corinthians 3:1, 1 Corinthians 3:19, 1 Corinthians 9:14, 1 Corinthians 10:8, 1 Corinthians 10:29, 1 Corinthians 11:7, 1 Corinthians 15:9, 1 Corinthians 16:17, 2 Corinthians 3:5, 2 Corinthians 5:18, 2 Corinthians 8:20, 2 Corinthians 9:11, 2 Corinthians 13:14, Ephesians 3:19, Philippians 3:17, 1 Timothy 1:2, 1 Timothy 5:11, Philemon 1:9, Hebrews 10:7, Hebrews 11:21, Hebrews 12:13, 1 Peter 4:7, 1 John 3:16, 1 John 4:7, Revelation 10:2, Revelation 11:3, Genesis 10:1, Genesis 15:16, Genesis 29:30, Genesis 31:3, Genesis 31:30, Genesis 41:32, Genesis 50:21, Exodus 4:19, Exodus 5:15, Exodus 8:6, Exodus 12:10, Exodus 19:14, Exodus 38:2, Leviticus 7:32, Leviticus 14:27, Leviticus 15:23, Leviticus 21:3, Leviticus 25:23, Leviticus 25:34, Leviticus 27:15, Numbers 10:4, Numbers 17:3, Numbers 20:29, Numbers 23:29, Numbers 27:18, Numbers 30:3, Numbers 32:31, Numbers 35:14, Deuteronomy 7:18, Deuteronomy 12:22, Deuteronomy 20:4, Deuteronomy 29:24, Joshua 2:2, Joshua 4:6, Joshua 6:2, Joshua 9:26, Joshua 13:11, Joshua 15:14, Joshua 15:15, Judges 9:11, 1 Samuel 7:16, 1 Samuel 9:10, 1 Samuel 19:16, 1 Samuel 20:18, 1 Samuel 22:10, 1 Samuel 24:17, 1 Samuel 25:6, 1 Samuel 28:6, 2 Samuel 13:35, 2 Samuel 18:21, 1 Kings 18:39, 1 Kings 20:19, 2 Kings 2:13, 2 Kings 10:18, 2 Kings 19:33, 1 Chronicles 1:17, 1 Chronicles 5:21, 1 Chronicles 6:15, 1 Chronicles 6:44, 1 Chronicles 23:9, 1 Chronicles 26:29, 2 Chronicles 6:17, 2 Chronicles 15:17, 2 Chronicles 17:4, 2 Chronicles 25:3, 2 Chronicles 26:7, 2 Chronicles 29:20, Ezra 10:17, Nehemiah 12:12, Esther 5:10, Esther 6:12, Esther 7:6, Job 1:13, Job 14:19, Job 21:19, Psalms 32:7, Psalms 42:8, Psalms 48:2, Psalms 60:6, Psalms 74:8, Psalms 81:10, Psalms 97:7, Psalms 143:1, Proverbs 15:8, Proverbs 27:27, Ecclesiastes 4:15, Ecclesiastes 7:8, Isaiah 16:1, Isaiah 29:19, Isaiah 37:34, Isaiah 38:10, Jeremiah 2:32, Jeremiah 18:7, Jeremiah 21:6, Jeremiah 26:6, Jeremiah 40:13, Jeremiah 46:24, Jeremiah 48:9, Jeremiah 50:46, Jeremiah 51:21, Jeremiah 52:28, Ezekiel 1:8, Ezekiel 19:4, Ezekiel 22:5, Ezekiel 32:17, Ezekiel 36:13, Ezekiel 44:20, Daniel 6:6, Daniel 9:5, Hosea 2:11, Hosea 2:21, Hosea 7:5, Joel 1:3, Amos 7:11, Micah 6:12, Nahum 2:9, Nahum 3:8, Habakkuk 1:2, Zephaniah 3:3, Matthew 8:34, Matthew 9:27, Matthew 10:8, Matthew 12:27, Matthew 13:20, Matthew 21:44, Matthew 25:31, Matthew 26:50, Mark 1:22, Mark 4:31, Mark 6:55, Mark 9:33, Mark 12:25, Mark 13:7, Mark 14:53, Mark 15:7, Luke 1:6, Luke 4:8, Luke 5:5, Luke 6:3, Luke 6:25, Luke 11:19, Luke 13:29, Luke 15:18, Luke 17:1, Luke 19:46, Luke 22:58, Luke 24:41, John 4:17, John 6:17, John 8:2, John 8:25, John 8:29, John 8:53, John 11:27, John 11:37, John 12:28, John 12:29, John 13:2, John 14:19, John 17:25, John 19:27, Acts 2:18, Acts 4:2, Acts 6:11, Acts 7:27, Acts 9:25, Acts 10:36, Acts 10:48, Acts 13:12, Acts 15:35, Acts 16:25, Acts 19:22, Acts 20:22, Acts 23:22, Acts 27:5, Acts 28:9, Romans 2:20, Romans 11:31, Romans 16:5, 1 Corinthians 3:15, 1 Corinthians 7:13, 1 Corinthians 10:23, 1 Corinthians 14:27, 1 Corinthians 15:2, Galatians 2:21, Ephesians 4:9, Colossians 3:15, 1 Thessalonians 3:9, 1 Timothy 1:20, 2 Timothy 4:13, Hebrews 3:5, Hebrews 6:2, Hebrews 10:9, James 3:13, 1 Peter 2:18, 1 John 5:14, Jude 1:21, Revelation 9:13, Revelation 17:11, Revelation 20:5, Genesis 3:10, Genesis 6:9, Genesis 7:8, Genesis 8:2, Genesis 8:4, Genesis 9:3, Genesis 23:20, Genesis 25:12, Genesis 30:43, Genesis 32:26, Genesis 34:13, Genesis 41:57, Genesis 42:20, Genesis 44:7, Genesis 44:22, Exodus 1:17, Exodus 3:14, Exodus 17:16, Exodus 21:34, Exodus 23:20, Exodus 24:18, Exodus 25:9, Exodus 25:28, Exodus 25:34, Exodus 34:21, Leviticus 13:24, Leviticus 15:21, Leviticus 15:32, Leviticus 16:1, Leviticus 18:5, Leviticus 25:21, Numbers 1:49, Numbers 2:9, Numbers 19:3, Numbers 23:1, Numbers 26:40, Numbers 26:55, Numbers 27:19, Numbers 31:17, Deuteronomy 2:20, Deuteronomy 6:12, Deuteronomy 7:23, Deuteronomy 19:18, Deuteronomy 19:21, Deuteronomy 21:2, Deuteronomy 28:37, Deuteronomy 28:43, Joshua 6:3, Joshua 8:17, Judges 1:12, Judges 2:23, Judges 9:56, Judges 20:16, Judges 20:17, 1 Samuel 10:6, 1 Samuel 10:9, 1 Samuel 14:16, 1 Samuel 16:10, 1 Samuel 20:16, 1 Samuel 22:4, 1 Samuel 22:23, 1 Samuel 23:9, 1 Samuel 24:1, 1 Samuel 25:27, 2 Samuel 3:20, 2 Samuel 11:7, 2 Samuel 13:11, 2 Samuel 15:5, 2 Samuel 19:4, 1 Kings 6:18, 1 Kings 7:33, 1 Kings 20:18, 2 Kings 3:10, 2 Kings 4:20, 2 Kings 14:18, 1 Chronicles 5:6, 1 Chronicles 7:5, 1 Chronicles 21:20, 1 Chronicles 23:5, 1 Chronicles 23:25, 1 Chronicles 26:2, 1 Chronicles 26:11, 1 Chronicles 27:14, 2 Chronicles 9:2, 2 Chronicles 20:1, 2 Chronicles 21:14, Ezra 4:8, Esther 2:4, Job 30:15, Job 37:23, Job 40:23, Psalms 9:14, Psalms 14:4, Psalms 18:24, Psalms 43:3, Psalms 45:17, Psalms 46:2, Psalms 49:10, Psalms 74:7, Psalms 89:50, Psalms 104:29, Psalms 112:10, Psalms 144:7, Psalms 146:8, Proverbs 23:7, Proverbs 28:13, Ecclesiastes 8:3, Ecclesiastes 8:5, Song of Solomon 5:13, Song of Solomon 7:2, Isaiah 1:9, Isaiah 2:8, Isaiah 8:12, Isaiah 17:2, Isaiah 21:10, Isaiah 22:23, Isaiah 32:13, Isaiah 41:13, Isaiah 57:19, Isaiah 64:8, Jeremiah 1:11, Jeremiah 3:22, Jeremiah 8:5, Jeremiah 21:5, Jeremiah 32:22, Jeremiah 36:25, Jeremiah 50:1, Jeremiah 51:41, Ezekiel 11:2, Ezekiel 22:2, Ezekiel 23:9, Ezekiel 23:33, Ezekiel 29:17, Daniel 11:29, Hosea 8:5, Hosea 13:1, Hosea 14:5, Joel 2:31, Amos 4:12, Amos 7:12, Obadiah 1:9, Obadiah 1:14, Nahum 1:5, Matthew 1:2, Matthew 1:3, Matthew 4:8, Matthew 4:15, Matthew 5:47, Matthew 10:13, Matthew 11:20, Matthew 12:20, Matthew 26:2, Matthew 26:53, Matthew 28:9, Mark 1:4, Mark 1:6, Mark 4:25, Mark 5:20, Mark 6:24, Mark 6:35, Mark 10:25, Luke 3:33, Luke 4:39, Luke 7:30, Luke 9:27, Luke 11:9, Luke 16:4, Luke 17:14, Luke 19:14, Luke 21:15, Luke 23:40, Luke 24:7, John 2:14, John 7:4, John 8:16, John 10:41, John 11:8, John 14:11, John 17:9, John 19:30, John 20:12, John 20:23, Acts 2:19, Acts 2:42, Acts 7:13, Acts 7:37, Acts 10:3, Acts 11:29, Romans 1:9, Romans 2:22, Romans 5:7, Romans 8:10, Romans 9:6, Romans 13:6, 1 Corinthians 1:28, 2 Corinthians 1:15, 2 Corinthians 4:10, 2 Corinthians 4:16, Galatians 3:23, Ephesians 4:19, Ephesians 4:22, Ephesians 6:8, Philippians 1:25, Philippians 2:30, Philippians 4:7, 1 Thessalonians 4:11, 1 Timothy 2:15, Titus 2:10, Titus 3:10, Hebrews 1:10, Hebrews 11:15, Hebrews 11:38, Hebrews 12:20, 2 John 1:4, Revelation 5:2, Revelation 20:2, Genesis 24:50, Genesis 26:11, Genesis 27:7, Genesis 30:9, Genesis 30:18, Genesis 39:11, Genesis 41:25, Genesis 41:31, Genesis 41:39, Genesis 42:29, Genesis 44:29, Genesis 44:34, Genesis 45:17, Exodus 10:16, Exodus 10:22, Exodus 14:3, Exodus 20:12, Exodus 26:32, Exodus 30:25, Exodus 37:6, Exodus 38:9, Exodus 40:13, Leviticus 8:18, Leviticus 11:11, Leviticus 19:3, Numbers 3:15, Numbers 10:7, Numbers 15:8, Numbers 15:10, Numbers 19:5, Numbers 21:6, Numbers 24:24, Numbers 32:27, Deuteronomy 2:26, Deuteronomy 7:3, Joshua 9:8, Joshua 10:31, Joshua 15:16, Judges 5:3, Judges 5:9, Judges 8:23, Judges 9:46, Judges 15:7, Judges 21:4, 1 Samuel 12:13, 1 Samuel 13:9, 1 Samuel 16:8, 1 Samuel 23:1, 1 Samuel 24:12, 1 Samuel 24:13, 2 Samuel 3:38, 2 Samuel 8:7, 2 Samuel 12:16, 2 Samuel 13:39, 2 Samuel 14:31, 2 Samuel 16:14, 2 Samuel 18:8, 1 Kings 1:1, 1 Kings 4:29, 1 Kings 7:27, 1 Kings 10:3, 1 Kings 10:28, 1 Kings 18:22, 1 Kings 19:5, 1 Kings 22:28, 2 Kings 4:14, 2 Kings 6:26, 2 Kings 11:1, 2 Kings 11:13, 2 Kings 12:2, 2 Kings 24:17, 1 Chronicles 5:2, 1 Chronicles 8:32, 1 Chronicles 10:8, 1 Chronicles 18:7, 2 Chronicles 11:15, 2 Chronicles 18:27, 2 Chronicles 31:20, Ezra 9:3, Nehemiah 3:27, Nehemiah 7:72, Nehemiah 12:7, Esther 9:21, Job 4:19, Job 5:23, Job 6:10, Job 14:7, Job 15:28, Job 20:22, Job 24:14, Job 38:24, Job 38:41, Psalms 3:7, Psalms 9:5, Psalms 27:3, Psalms 29:9, Psalms 30:3, Psalms 37:25, Psalms 38:3, Psalms 42:9, Psalms 43:4, Psalms 59:17, Psalms 70:4, Psalms 72:10, Psalms 76:11, Psalms 84:6, Psalms 109:14, Psalms 109:21, Psalms 137:8, Psalms 139:15, Psalms 147:1, Proverbs 7:23, Proverbs 16:6, Proverbs 29:27, Ecclesiastes 1:7, Ecclesiastes 2:1, Ecclesiastes 3:15, Song of Solomon 4:14, Song of Solomon 7:5, Isaiah 6:4, Isaiah 11:7, Isaiah 14:27, Isaiah 24:8, Isaiah 28:6, Isaiah 65:6, Jeremiah 4:17, Jeremiah 5:26, Jeremiah 7:21, Jeremiah 7:26, Jeremiah 23:25, Jeremiah 31:5, Jeremiah 31:24, Jeremiah 36:13, Jeremiah 50:8, Ezekiel 17:4, Ezekiel 22:16, Ezekiel 23:19, Ezekiel 23:30, Ezekiel 23:46, Ezekiel 25:8, Ezekiel 32:8, Ezekiel 34:3, Ezekiel 36:21, Ezekiel 45:22, Daniel 5:6, Daniel 10:3, Daniel 12:13, Hosea 7:2, Hosea 11:3, Joel 3:6, Amos 6:6, Jonah 1:9, Micah 1:3, Habakkuk 1:10, Zephaniah 3:14, Zechariah 12:11, Zechariah 13:8, Malachi 3:15, Matthew 7:2, Matthew 14:36, Matthew 15:4, Matthew 21:43, Matthew 24:27, Matthew 24:36, Matthew 26:10, Matthew 26:34, Matthew 28:15, Mark 1:38, Mark 10:48, Mark 11:28, Mark 14:37, Luke 1:18, Luke 1:79, Luke 4:33, Luke 5:4, Luke 7:4, Luke 12:4, John 1:21, John 2:20, John 4:1, John 10:40, John 11:2, John 11:41, John 14:22, Acts 10:21, Acts 21:19, Acts 28:31, Romans 1:23, Romans 8:7, Romans 11:4, Romans 11:16, Romans 15:26, 1 Corinthians 1:19, 1 Corinthians 4:13, 1 Corinthians 5:4, 1 Corinthians 16:6, 2 Corinthians 4:14, 2 Corinthians 6:7, 2 Corinthians 6:10, 2 Corinthians 11:2, Galatians 3:18, Ephesians 6:4, Ephesians 6:19, 1 Thessalonians 1:10, 2 Thessalonians 2:1, 2 Thessalonians 3:1, 1 Timothy 2:1, Titus 2:9, Hebrews 9:5, Hebrews 10:33, Hebrews 10:39, James 4:1, 1 Peter 3:3, 2 Peter 2:17, 1 John 5:15, Revelation 13:17, Revelation 14:12, Genesis 2:24, Genesis 3:5, Genesis 7:16, Genesis 8:22, Genesis 10:30, Genesis 11:10, Genesis 12:13, Genesis 17:15, Genesis 18:26, Genesis 19:5, Genesis 21:22, Genesis 29:20, Genesis 29:27, Genesis 30:25, Genesis 34:29, Genesis 35:6, Genesis 42:1, Genesis 45:16, Genesis 46:18, Genesis 48:2, Exodus 5:22, Exodus 18:11, Exodus 19:17, Exodus 21:14, Exodus 21:20, Exodus 25:18, Exodus 25:37, Exodus 29:29, Leviticus 1:16, Leviticus 11:33, Leviticus 14:32, Leviticus 16:6, Leviticus 20:26, Leviticus 22:7, Leviticus 24:20, Leviticus 25:3, Numbers 2:24, Numbers 3:43, Numbers 4:35, Numbers 4:39, Numbers 13:24, Numbers 19:6, Numbers 19:17, Numbers 21:35, Numbers 31:24, Numbers 32:30, Numbers 35:24, Numbers 35:29, Deuteronomy 28:24, Deuteronomy 28:66, Joshua 9:7, Joshua 10:42, Joshua 21:45, Judges 9:26, Judges 11:5, Judges 13:10, Judges 15:8, Judges 21:11, 1 Samuel 3:2, 1 Samuel 3:21, 1 Samuel 7:11, 1 Samuel 14:48, 1 Samuel 26:13, 1 Samuel 30:4, 2 Samuel 6:15, 2 Samuel 7:2, 2 Samuel 7:16, 2 Samuel 7:24, 2 Samuel 7:28, 2 Samuel 13:17, 2 Samuel 19:25, 2 Samuel 19:36, 1 Kings 1:28, 1 Kings 6:2, 1 Kings 6:31, 1 Kings 11:5, 1 Kings 12:31, 1 Kings 15:14, 1 Kings 19:12, 1 Kings 22:33, 2 Kings 6:13, 2 Kings 9:35, 2 Kings 10:32, 2 Kings 15:1, 2 Kings 18:1, 2 Kings 25:6, 2 Kings 25:10, 1 Chronicles 3:21, 1 Chronicles 11:4, 1 Chronicles 12:14, 1 Chronicles 13:5, 1 Chronicles 20:8, 1 Chronicles 27:2, 1 Chronicles 28:19, 2 Chronicles 6:42, 2 Chronicles 12:16, 2 Chronicles 26:8, 2 Chronicles 29:23, Ezra 10:19, Nehemiah 4:6, Nehemiah 13:31, Esther 1:4, Esther 6:5, Esther 9:30, Job 12:24, Job 22:3, Job 24:13, Job 28:28, Job 34:29, Psalms 4:2, Psalms 9:6, Psalms 17:7, Psalms 22:26, Psalms 37:10, Psalms 43:1, Psalms 49:18, Psalms 68:23, Psalms 86:15, Psalms 95:7, Psalms 102:24, Proverbs 11:10, Proverbs 19:25, Proverbs 24:14, Proverbs 25:20, Proverbs 28:24, Proverbs 30:1, Ecclesiastes 2:18, Ecclesiastes 7:27, Ecclesiastes 9:16, Ecclesiastes 12:13, Isaiah 1:3, Isaiah 1:29, Isaiah 9:9, Isaiah 9:16, Isaiah 14:4, Isaiah 22:1, Isaiah 22:15, Isaiah 40:3, Isaiah 52:6, Isaiah 64:9, Jeremiah 2:21, Jeremiah 2:36, Jeremiah 4:3, Jeremiah 13:18, Jeremiah 25:11, Jeremiah 26:5, Jeremiah 43:7, Jeremiah 45:3, Jeremiah 47:5, Jeremiah 48:47, Jeremiah 50:38, Jeremiah 52:23, Ezekiel 1:25, Ezekiel 4:15, Ezekiel 22:13, Ezekiel 27:6, Ezekiel 29:8, Ezekiel 36:14, Ezekiel 39:8, Ezekiel 43:5, Ezekiel 44:31, Daniel 2:12, Daniel 4:11, Daniel 8:14, Hosea 5:9, Hosea 5:10, Amos 5:18, Obadiah 1:8, Nahum 3:14, Habakkuk 2:7, Zechariah 1:9, Zechariah 7:11, Matthew 5:12, Matthew 13:38, Matthew 15:29, Matthew 19:13, Matthew 20:10, Matthew 21:13, Matthew 25:15, Matthew 25:35, Matthew 26:52, Matthew 27:21, Matthew 28:20, Mark 1:2, Mark 2:9, Mark 5:18, Mark 6:7, Mark 7:26, Mark 11:32, Luke 1:9, Luke 1:76, Luke 2:23, Luke 6:6, Luke 7:3, Luke 7:14, Luke 10:25, Luke 18:34, Luke 22:26, Luke 22:34, Luke 22:55, John 1:47, John 2:16, John 4:38, John 5:2, John 6:21, John 9:7, John 9:30, John 11:25, John 12:2, John 12:19, John 18:11, John 19:40, Acts 2:11, Acts 2:34, Acts 3:11, Acts 5:5, Acts 8:18, Acts 19:10, Acts 21:31, Acts 22:2, Acts 24:26, Acts 27:29, Romans 4:5, Romans 9:23, Romans 14:11, Romans 15:3, 1 Corinthians 2:8, 1 Corinthians 12:21, 2 Corinthians 4:5, 2 Corinthians 11:16, Ephesians 3:9, Philippians 3:18, Colossians 1:11, Colossians 4:6, Colossians 4:8, 1 Timothy 3:8, 2 Timothy 1:1, Hebrews 11:27, James 3:12, 1 Peter 1:24, 1 John 2:5, 1 John 2:29, 3 John 1:2, 3 John 1:11, Revelation 2:8, Revelation 6:14, Revelation 7:8, Revelation 20:1, Genesis 2:14, Genesis 4:11, Genesis 6:15, Genesis 7:19, Genesis 12:11, Genesis 15:7, Genesis 15:14, Genesis 18:7, Genesis 19:21, Genesis 19:22, Genesis 24:23, Genesis 42:4, Genesis 44:12, Genesis 47:28, Genesis 48:1, Genesis 49:13, Exodus 2:22, Exodus 8:13, Exodus 11:6, Exodus 19:10, Exodus 31:3, Exodus 32:28, Exodus 35:16, Leviticus 2:5, Leviticus 4:17, Leviticus 11:28, Leviticus 14:39, Leviticus 15:5, Leviticus 16:28, Leviticus 18:27, Leviticus 18:29, Leviticus 21:20, Leviticus 22:16, Leviticus 25:40, Leviticus 26:21, Numbers 4:43, Numbers 13:18, Numbers 13:27, Numbers 16:29, Numbers 16:45, Numbers 21:11, Numbers 30:9, Numbers 31:5, Numbers 34:9, Deuteronomy 4:18, Deuteronomy 9:8, Deuteronomy 12:8, Deuteronomy 14:6, Deuteronomy 24:17, Deuteronomy 27:5, Deuteronomy 28:60, Deuteronomy 33:26, Joshua 9:5, Joshua 13:10, Judges 9:52, Judges 16:10, Judges 17:7, 1 Samuel 1:4, 1 Samuel 17:38, 2 Samuel 2:17, 2 Samuel 3:36, 1 Kings 1:7, 1 Kings 1:24, 1 Kings 4:23, 1 Kings 8:2, 1 Kings 8:26, 1 Kings 8:51, 1 Kings 9:10, 1 Kings 12:12, 1 Kings 15:8, 2 Kings 6:1, 2 Kings 13:16, 1 Chronicles 15:20, 1 Chronicles 29:24, 2 Chronicles 1:16, 2 Chronicles 4:9, 2 Chronicles 6:31, 2 Chronicles 9:23, 2 Chronicles 10:12, 2 Chronicles 25:11, 2 Chronicles 33:4, Nehemiah 3:11, Nehemiah 3:12, Esther 3:3, Esther 3:11, Job 15:30, Job 18:4, Psalms 9:13, Psalms 15:3, Psalms 18:7, Psalms 38:12, Psalms 88:8, Psalms 104:35, Psalms 108:7, Psalms 110:6, Psalms 115:12, Psalms 137:3, Psalms 140:4, Proverbs 4:16, Proverbs 13:22, Ecclesiastes 5:10, Ecclesiastes 5:11, Ecclesiastes 6:9, Song of Solomon 4:6, Isaiah 2:10, Isaiah 5:1, Isaiah 6:3, Isaiah 13:16, Isaiah 15:7, Isaiah 24:11, Isaiah 32:4, Isaiah 34:9, Isaiah 38:19, Isaiah 45:7, Isaiah 48:9, Jeremiah 3:23, Jeremiah 10:19, Jeremiah 11:23, Jeremiah 13:1, Jeremiah 22:12, Jeremiah 30:23, Jeremiah 31:2, Jeremiah 44:4, Jeremiah 48:27, Jeremiah 48:37, Lamentations 4:5, Ezekiel 12:11, Ezekiel 22:27, Ezekiel 24:12, Ezekiel 27:8, Ezekiel 27:13, Ezekiel 28:10, Ezekiel 30:10, Ezekiel 34:24, Ezekiel 40:20, Ezekiel 44:8, Ezekiel 44:16, Amos 5:14, Malachi 3:8, Matthew 4:3, Matthew 10:5, Matthew 14:3, Matthew 15:11, Matthew 19:9, Matthew 21:1, Matthew 24:1, Matthew 28:10, Matthew 28:12, Mark 4:41, Mark 12:16, Mark 12:31, Mark 13:3, Mark 13:22, Mark 14:11, Luke 2:20, Luke 9:34, Luke 16:21, Luke 20:6, Luke 20:13, Luke 20:36, Luke 22:32, Luke 23:34, John 1:31, John 4:20, John 4:39, John 7:1, John 8:40, John 10:21, John 20:20, Acts 3:8, Acts 7:11, Acts 7:24, Acts 8:30, Acts 12:21, Acts 14:8, Acts 20:31, Romans 2:13, Romans 4:20, 1 Corinthians 8:5, 1 Corinthians 9:17, 1 Corinthians 14:3, 1 Corinthians 14:24, 2 Corinthians 1:7, 2 Corinthians 3:9, 2 Corinthians 10:10, 2 Corinthians 13:3, Galatians 1:23, Galatians 6:4, Ephesians 1:20, Ephesians 5:31, Ephesians 6:22, Colossians 1:5, 1 Thessalonians 3:7, 1 Thessalonians 3:10, 1 Thessalonians 5:14, 2 Thessalonians 2:10, 2 Thessalonians 3:10, 2 Timothy 1:6, 2 Timothy 1:13, Titus 1:10, Hebrews 11:26, James 5:5, 1 Peter 3:14, 1 Peter 4:19, 1 John 1:9, 1 John 2:15, 3 John 1:3, Revelation 9:3, Revelation 9:18, Genesis 1:6, Genesis 1:18, Genesis 6:21, Genesis 12:15, Genesis 14:1, Genesis 14:12, Genesis 17:11, Genesis 19:32, Genesis 25:8, Genesis 33:7, Genesis 35:18, Genesis 36:5, Genesis 48:11, Exodus 12:8, Exodus 32:17, Exodus 37:3, Exodus 37:26, Leviticus 4:29, Leviticus 6:14, Leviticus 8:4, Leviticus 15:28, Leviticus 19:14, Leviticus 22:29, Numbers 3:9, Numbers 13:16, Numbers 16:16, Deuteronomy 1:30, Deuteronomy 2:27, Deuteronomy 7:14, Deuteronomy 8:13, Deuteronomy 9:29, Deuteronomy 10:21, Deuteronomy 21:9, Deuteronomy 27:26, Joshua 11:5, Joshua 11:9, Joshua 14:2, Judges 1:13, Judges 2:6, Judges 3:31, Judges 5:12, Judges 6:17, Judges 9:41, 1 Samuel 4:14, 1 Samuel 15:16, 1 Samuel 17:30, 1 Samuel 25:19, 2 Samuel 2:3, 2 Samuel 2:19, 2 Samuel 4:1, 2 Samuel 8:5, 2 Samuel 13:22, 2 Samuel 18:1, 2 Samuel 19:29, 2 Samuel 20:18, 2 Samuel 24:12, 1 Kings 11:17, 2 Kings 4:9, 2 Kings 9:32, 2 Kings 17:14, 2 Kings 21:21, 1 Chronicles 2:42, 1 Chronicles 3:5, 1 Chronicles 4:18, 1 Chronicles 5:13, 1 Chronicles 6:63, 1 Chronicles 9:25, 1 Chronicles 13:11, 1 Chronicles 13:13, 1 Chronicles 17:20, 1 Chronicles 18:5, 1 Chronicles 21:10, 2 Chronicles 23:16, 2 Chronicles 23:21, 2 Chronicles 27:9, 2 Chronicles 29:3, Ezra 7:1, Ezra 8:26, Nehemiah 9:7, Nehemiah 9:33, Job 6:4, Job 9:24, Job 16:12, Job 31:18, Psalms 10:5, Psalms 14:2, Psalms 19:10, Psalms 22:14, Psalms 25:10, Psalms 31:23, Psalms 35:19, Psalms 37:14, Psalms 42:10, Psalms 45:8, Psalms 48:10, Psalms 51:14, Psalms 55:15, Psalms 68:13, Psalms 77:6, Psalms 77:18, Psalms 142:4, Proverbs 30:9, Ecclesiastes 1:9, Ecclesiastes 10:4, Song of Solomon 8:8, Isaiah 6:6, Isaiah 14:3, Isaiah 16:7, Isaiah 29:3, Isaiah 33:8, Isaiah 44:22, Isaiah 47:3, Isaiah 48:11, Isaiah 65:17, Jeremiah 6:24, Jeremiah 6:28, Jeremiah 15:5, Jeremiah 22:26, Jeremiah 23:19, Jeremiah 34:9, Jeremiah 38:3, Jeremiah 46:4, Jeremiah 47:1, Jeremiah 48:19, Jeremiah 50:36, Ezekiel 3:1, Ezekiel 15:2, Ezekiel 16:42, Ezekiel 21:2, Ezekiel 21:5, Ezekiel 22:10, Ezekiel 27:29, Ezekiel 28:5, Ezekiel 33:20, Ezekiel 45:12, Ezekiel 47:14, Ezekiel 48:17, Daniel 2:16, Daniel 5:26, Daniel 7:2, Daniel 7:26, Daniel 10:4, Hosea 5:3, Hosea 5:6, Joel 1:10, Micah 3:2, Micah 7:8, Zechariah 4:5, Zechariah 8:2, Zechariah 11:11, Malachi 3:4, Matthew 6:19, Matthew 7:4, Matthew 7:24, Matthew 9:14, Matthew 12:5, Matthew 12:43, Matthew 18:13, Matthew 25:30, Matthew 26:57, Matthew 26:62, Matthew 27:22, Mark 3:32, Mark 5:14, Mark 5:38, Mark 7:9, Mark 7:32, Mark 8:35, Mark 10:27, Mark 10:40, Mark 12:7, Mark 12:15, Mark 13:4, Mark 15:24, Luke 1:59, Luke 1:65, Luke 3:3, Luke 5:8, Luke 5:13, Luke 6:21, Luke 9:23, Luke 9:60, Luke 11:4, Luke 11:48, Luke 15:15, Luke 15:32, Luke 18:25, Luke 19:3, Luke 24:24, John 1:19, John 1:22, John 4:15, John 4:50, John 5:43, John 6:63, John 7:3, John 14:2, Acts 4:29, Acts 9:18, Acts 13:29, Acts 16:7, Acts 18:12, Acts 23:8, Acts 23:17, Romans 8:36, Romans 13:2, Romans 16:12, 1 Corinthians 2:10, 1 Corinthians 7:1, 1 Corinthians 7:16, 1 Corinthians 9:27, 2 Corinthians 3:10, 2 Corinthians 7:10, 2 Corinthians 9:7, 2 Corinthians 12:12, Galatians 1:4, Galatians 1:12, Galatians 4:1, Galatians 4:23, Ephesians 5:3, Ephesians 6:6, Philippians 1:6, Philippians 3:1, Colossians 1:7, Hebrews 4:4, Hebrews 6:16, Hebrews 11:28, Hebrews 12:19, James 1:18, 1 Peter 4:14, 1 John 2:21, 1 John 5:13, Revelation 19:5, Genesis 7:7, Genesis 12:18, Genesis 12:19, Genesis 21:30, Genesis 22:19, Genesis 24:13, Genesis 35:12, Genesis 35:26, Genesis 36:12, Genesis 41:19, Genesis 44:10, Genesis 44:23, Exodus 1:18, Exodus 4:3, Exodus 7:1, Exodus 8:18, Exodus 9:16, Exodus 17:10, Exodus 18:3, Exodus 19:4, Exodus 23:9, Exodus 26:17, Exodus 28:23, Exodus 29:14, Exodus 36:5, Exodus 40:20, Leviticus 1:4, Leviticus 1:10, Leviticus 6:11, Leviticus 9:6, Leviticus 18:21, Leviticus 19:21, Leviticus 25:38, Leviticus 26:31, Numbers 1:10, Numbers 3:21, Numbers 7:11, Numbers 10:3, Numbers 11:13, Numbers 11:15, Numbers 14:38, Numbers 19:22, Numbers 20:2, Numbers 20:4, Numbers 20:20, Numbers 26:23, Numbers 28:6, Numbers 32:38, Numbers 34:29, Deuteronomy 4:7, Deuteronomy 9:20, Deuteronomy 18:4, Deuteronomy 28:27, Deuteronomy 29:15, Deuteronomy 29:17, Deuteronomy 29:27, Deuteronomy 31:15, Joshua 2:6, Joshua 13:5, Joshua 23:10, Joshua 24:5, Joshua 24:23, Judges 1:26, Judges 5:8, Judges 8:33, Judges 9:34, Judges 13:12, Judges 13:17, Judges 19:20, Judges 20:43, 1 Samuel 1:28, 1 Samuel 3:3, 1 Samuel 12:24, 1 Samuel 14:18, 1 Samuel 16:20, 1 Samuel 20:7, 2 Samuel 9:1, 2 Samuel 11:9, 2 Samuel 12:15, 2 Samuel 12:23, 2 Samuel 13:37, 2 Samuel 15:15, 2 Samuel 17:1, 2 Samuel 22:31, 1 Kings 5:16, 1 Kings 11:12, 2 Kings 2:18, 2 Kings 6:27, 2 Kings 22:7, 1 Chronicles 2:50, 1 Chronicles 9:31, 1 Chronicles 9:38, 1 Chronicles 13:7, 1 Chronicles 24:30, 2 Chronicles 2:2, 2 Chronicles 3:15, 2 Chronicles 8:12, 2 Chronicles 11:13, 2 Chronicles 17:3, 2 Chronicles 26:1, 2 Chronicles 29:36, Ezra 7:10, Nehemiah 11:23, Esther 4:2, Job 1:6, Job 16:9, Job 24:12, Job 31:7, Job 34:19, Psalms 11:4, Psalms 18:30, Psalms 18:35, Psalms 18:50, Psalms 19:8, Psalms 35:13, Psalms 40:2, Psalms 40:3, Psalms 40:4, Psalms 45:2, Psalms 66:7, Psalms 104:3, Psalms 128:3, Psalms 143:7, Proverbs 9:9, Proverbs 28:19, Ecclesiastes 2:17, Ecclesiastes 5:16, Ecclesiastes 10:10, Song of Solomon 2:12, Song of Solomon 2:17, Isaiah 1:8, Isaiah 1:14, Isaiah 11:8, Isaiah 14:6, Isaiah 53:4, Jeremiah 4:6, Jeremiah 4:14, Jeremiah 5:9, Jeremiah 9:9, Jeremiah 13:19, Jeremiah 13:23, Jeremiah 28:13, Jeremiah 36:24, Jeremiah 39:2, Jeremiah 49:17, Jeremiah 49:33, Lamentations 4:1, Ezekiel 12:15, Ezekiel 19:2, Ezekiel 20:20, Ezekiel 20:35, Ezekiel 23:44, Ezekiel 26:9, Ezekiel 34:17, Ezekiel 34:20, Ezekiel 36:2, Ezekiel 36:7, Ezekiel 39:6, Ezekiel 46:15, Ezekiel 47:20, Daniel 4:1, Hosea 7:10, Joel 2:12, Malachi 1:12, Matthew 1:12, Matthew 1:23, Matthew 2:4, Matthew 6:28, Matthew 11:1, Matthew 11:29, Matthew 13:28, Matthew 13:41, Matthew 15:12, Matthew 15:33, Matthew 21:28, Mark 4:16, Mark 5:2, Mark 7:3, Mark 9:17, Mark 14:40, Mark 14:49, Mark 16:19, Luke 1:48, Luke 2:26, Luke 6:20, Luke 9:52, Luke 14:7, Luke 17:24, Luke 23:49, John 5:13, John 5:44, John 9:41, Acts 1:12, Acts 2:4, Acts 4:1, Acts 5:41, Acts 5:42, Acts 6:13, Acts 9:12, Acts 13:21, Acts 16:20, Acts 18:19, Acts 20:10, Acts 20:19, Acts 23:7, Acts 24:18, Acts 26:31, Acts 28:26, Romans 3:20, Romans 5:9, Romans 8:38, 1 Corinthians 1:18, 1 Corinthians 2:4, 1 Corinthians 11:2, 1 Corinthians 14:12, 2 Corinthians 6:4, Ephesians 2:7, Philippians 2:8, Philippians 3:10, Philippians 3:19, 1 Timothy 3:7, 2 Timothy 2:25, Hebrews 6:19, Hebrews 9:25, Hebrews 12:8, James 1:5, James 4:12, 1 Peter 5:8, 1 John 1:5, 1 John 4:2, 2 John 1:1, Revelation 7:13, Revelation 9:6, Revelation 9:14, Genesis 2:11, Genesis 4:1, Genesis 4:18, Genesis 10:5, Genesis 12:2, Genesis 21:26, Genesis 24:56, Genesis 27:12, Genesis 30:36, Genesis 31:14, Genesis 31:21, Genesis 31:46, Genesis 33:2, Genesis 35:8, Genesis 46:17, Genesis 46:28, Genesis 49:31, Exodus 6:4, Exodus 8:12, Exodus 10:25, Exodus 15:23, Exodus 16:24, Exodus 27:7, Exodus 27:19, Exodus 28:42, Exodus 40:19, Leviticus 7:13, Leviticus 15:2, Leviticus 20:21, Leviticus 25:18, Leviticus 25:54, Leviticus 27:9, Numbers 3:20, Numbers 5:9, Numbers 6:10, Numbers 14:8, Numbers 20:3, Numbers 29:16, Numbers 29:25, Numbers 32:7, Deuteronomy 1:38, Deuteronomy 4:8, Deuteronomy 4:33, Deuteronomy 9:11, Deuteronomy 12:23, Deuteronomy 25:8, Deuteronomy 29:6, Deuteronomy 29:12, Deuteronomy 29:26, Deuteronomy 33:5, Joshua 4:11, Joshua 10:33, Joshua 10:34, Joshua 18:21, Joshua 19:11, Judges 13:21, Judges 20:41, Ruth 1:15, Ruth 3:1, 1 Samuel 8:20, 1 Samuel 14:9, 1 Samuel 25:22, 1 Samuel 27:2, 1 Samuel 28:4, 2 Samuel 5:11, 2 Samuel 12:27, 2 Samuel 19:15, 2 Samuel 19:34, 2 Samuel 22:51, 1 Kings 6:19, 1 Kings 9:23, 1 Kings 13:34, 1 Kings 14:23, 1 Kings 20:41, 2 Kings 6:5, 2 Kings 9:28, 2 Kings 10:4, 2 Kings 12:5, 2 Kings 12:8, 2 Kings 14:21, 2 Kings 15:4, 2 Kings 17:19, 1 Chronicles 12:21, 1 Chronicles 12:39, 1 Chronicles 16:3, 1 Chronicles 26:6, 1 Chronicles 27:28, 1 Chronicles 28:7, 2 Chronicles 11:22, 2 Chronicles 14:6, 2 Chronicles 17:16, 2 Chronicles 20:32, 2 Chronicles 20:33, 2 Chronicles 21:16, 2 Chronicles 26:13, Ezra 6:15, Nehemiah 4:1, Nehemiah 4:12, Job 14:12, Job 21:33, Psalms 44:2, Psalms 87:5, Psalms 100:3, Psalms 106:43, Psalms 109:16, Psalms 112:9, Psalms 115:1, Psalms 122:4, Psalms 131:2, Proverbs 5:19, Proverbs 11:15, Proverbs 25:7, Proverbs 30:15, Isaiah 1:5, Isaiah 8:20, Isaiah 27:6, Isaiah 28:10, Isaiah 34:3, Isaiah 36:17, Isaiah 36:19, Isaiah 43:28, Isaiah 60:22, Isaiah 66:23, Jeremiah 4:20, Jeremiah 5:29, Jeremiah 9:17, Jeremiah 12:8, Jeremiah 27:1, Jeremiah 33:25, Jeremiah 48:10, Jeremiah 52:14, Ezekiel 14:19, Ezekiel 19:5, Ezekiel 24:8, Ezekiel 31:9, Ezekiel 36:1, Ezekiel 40:6, Ezekiel 40:11, Ezekiel 42:8, Ezekiel 45:2, Daniel 7:12, Amos 2:14, Amos 3:4, Nahum 2:1, Haggai 2:5, Zechariah 6:8, Zechariah 9:11, Zechariah 10:8, Malachi 2:4, Matthew 3:4, Matthew 8:24, Matthew 12:46, Matthew 13:2, Matthew 16:22, Matthew 18:3, Matthew 20:19, Matthew 22:32, Matthew 26:74, Matthew 27:1, Mark 6:26, Mark 6:27, Mark 8:3, Mark 11:29, Mark 13:32, Mark 14:16, Mark 14:35, Luke 5:27, Luke 6:18, Luke 9:19, Luke 11:50, Luke 18:24, John 1:29, John 3:20, John 6:14, John 10:29, John 10:32, John 14:24, John 17:13, John 20:18, John 21:1, Acts 4:9, Acts 7:19, Acts 7:33, Acts 8:14, Acts 20:25, Acts 25:12, Romans 2:8, Romans 9:15, Romans 11:3, Romans 11:15, 1 Corinthians 6:1, 1 Corinthians 7:2, 1 Corinthians 15:44, 2 Corinthians 7:2, 2 Corinthians 7:3, 2 Corinthians 11:27, Galatians 2:5, Galatians 5:6, Ephesians 1:7, Ephesians 2:14, Philippians 2:28, 1 Timothy 3:6, 1 Timothy 4:14, 2 Timothy 1:16, Hebrews 2:6, Hebrews 3:17, Hebrews 12:3, 2 John 1:10, Genesis 4:8, Genesis 12:12, Genesis 14:20, Genesis 14:22, Genesis 15:4, Genesis 19:25, Genesis 24:51, Genesis 25:27, Genesis 25:30, Genesis 33:8, Genesis 35:27, Genesis 43:27, Genesis 43:28, Genesis 44:5, Genesis 45:13, Genesis 46:4, Genesis 49:17, Exodus 11:9, Exodus 14:30, Exodus 19:7, Exodus 22:4, Exodus 29:17, Exodus 29:44, Exodus 40:32, Leviticus 1:14, Leviticus 4:23, Leviticus 6:26, Leviticus 14:35, Leviticus 15:4, Leviticus 15:17, Leviticus 16:30, Leviticus 19:32, Leviticus 21:18, Leviticus 23:19, Leviticus 27:29, Numbers 13:17, Numbers 15:2, Numbers 22:37, Numbers 25:5, Numbers 29:3, Numbers 29:34, Numbers 32:16, Numbers 35:16, Numbers 35:31, Deuteronomy 6:23, Deuteronomy 11:1, Deuteronomy 15:22, Deuteronomy 22:16, Deuteronomy 27:1, Joshua 7:22, Joshua 19:48, Judges 11:40, Judges 15:17, Judges 20:8, Ruth 3:2, 1 Samuel 17:32, 1 Samuel 20:33, 1 Samuel 31:8, 2 Samuel 1:1, 2 Samuel 2:8, 2 Samuel 3:32, 2 Samuel 6:8, 2 Samuel 8:3, 2 Samuel 15:6, 2 Samuel 17:19, 2 Samuel 21:22, 1 Kings 1:4, 1 Kings 3:2, 1 Kings 8:19, 1 Kings 17:9, 1 Kings 18:46, 1 Kings 22:46, 2 Kings 4:5, 2 Kings 15:11, 2 Kings 19:31, 1 Chronicles 5:7, 1 Chronicles 6:31, 1 Chronicles 7:10, 1 Chronicles 9:34, 1 Chronicles 14:1, 1 Chronicles 25:7, 1 Chronicles 26:20, 2 Chronicles 14:9, 2 Chronicles 24:17, Ezra 8:13, Nehemiah 11:11, Job 20:25, Job 24:20, Job 34:20, Job 39:25, Psalms 19:14, Psalms 23:6, Psalms 35:14, Psalms 55:21, Psalms 56:13, Psalms 78:21, Psalms 79:9, Psalms 94:23, Psalms 101:8, Psalms 137:6, Proverbs 24:31, Song of Solomon 6:10, Isaiah 1:21, Isaiah 5:28, Isaiah 10:32, Isaiah 23:9, Isaiah 24:1, Isaiah 38:16, Isaiah 40:27, Isaiah 42:17, Isaiah 48:2, Isaiah 55:9, Isaiah 63:10, Jeremiah 2:10, Jeremiah 12:2, Jeremiah 13:20, Jeremiah 15:13, Jeremiah 21:8, Jeremiah 22:5, Jeremiah 25:36, Jeremiah 30:7, Jeremiah 39:11, Jeremiah 46:6, Ezekiel 14:17, Ezekiel 18:14, Ezekiel 23:21, Ezekiel 28:19, Ezekiel 29:11, Ezekiel 35:9, Ezekiel 37:28, Daniel 2:7, Daniel 9:3, Hosea 2:6, Hosea 10:2, Hosea 11:2, Hosea 13:6, Amos 3:10, Amos 8:9, Nahum 2:7, Habakkuk 2:13, Zephaniah 3:2, Matthew 5:24, Matthew 9:13, Matthew 12:7, Matthew 16:9, Matthew 17:22, Matthew 21:8, Matthew 24:51, Matthew 26:40, Matthew 27:55, Mark 3:17, Mark 7:31, Mark 10:47, Mark 16:5, Luke 3:2, Luke 3:21, Luke 6:37, Luke 7:36, Luke 8:17, Luke 14:35, Luke 17:28, Luke 18:15, Luke 20:5, Luke 22:56, Luke 24:47, John 2:6, John 9:3, John 12:1, John 13:27, John 14:31, John 19:17, John 20:7, John 21:19, Acts 1:9, Acts 2:25, Acts 5:17, Acts 7:36, Acts 10:2, Acts 10:37, Acts 10:43, Acts 11:1, Acts 17:24, Acts 18:24, Acts 28:19, Romans 1:28, Romans 9:7, Romans 12:6, 1 Corinthians 1:27, 1 Corinthians 2:1, 1 Corinthians 7:9, 1 Corinthians 9:25, 1 Corinthians 11:24, 2 Corinthians 3:1, 2 Corinthians 13:1, Galatians 1:13, Galatians 2:13, Galatians 4:25, Ephesians 1:19, Ephesians 5:23, Ephesians 6:16, Philippians 1:19, 2 Thessalonians 2:7, 2 Timothy 3:10, Titus 1:16, Hebrews 7:13, Hebrews 10:11, James 2:6, 2 Peter 3:3, 1 John 4:4, 1 John 4:10, Revelation 16:6, Revelation 18:20, Revelation 21:14, Revelation 21:23, Genesis 1:5, Genesis 1:10, Genesis 4:26, Genesis 15:17, Genesis 18:6, Genesis 18:29, Genesis 22:8, Genesis 25:17, Genesis 29:6, Genesis 29:12, Genesis 39:21, Genesis 40:7, Exodus 5:7, Exodus 12:33, Exodus 15:7, Exodus 23:8, Exodus 34:22, Exodus 38:7, Leviticus 8:22, Leviticus 18:18, Leviticus 21:9, Leviticus 22:10, Leviticus 27:24, Numbers 2:20, Numbers 5:4, Numbers 6:4, Numbers 8:2, Numbers 8:9, Numbers 15:36, Numbers 22:3, Numbers 22:16, Numbers 22:41, Numbers 24:11, Numbers 27:12, Numbers 28:28, Numbers 29:7, Numbers 29:31, Numbers 30:6, Numbers 32:6, Deuteronomy 14:25, Deuteronomy 15:20, Deuteronomy 18:7, Deuteronomy 23:17, Deuteronomy 29:8, Deuteronomy 29:16, Joshua 10:4, Joshua 10:14, Joshua 17:13, Joshua 19:31, Judges 4:10, Judges 4:20, Judges 5:27, Judges 11:1, Judges 20:14, Judges 20:47, Judges 21:2, Ruth 2:17, 1 Samuel 11:8, 1 Samuel 14:7, 1 Samuel 15:8, 1 Samuel 30:10, 2 Samuel 2:18, 2 Samuel 3:30, 2 Samuel 13:1, 2 Samuel 13:3, 2 Samuel 23:7, 1 Kings 6:10, 1 Kings 11:6, 1 Kings 21:25, 2 Kings 3:3, 2 Kings 9:10, 2 Kings 14:1, 2 Kings 16:12, 2 Kings 16:19, 2 Kings 18:15, 2 Kings 21:25, 1 Chronicles 4:2, 1 Chronicles 4:9, 1 Chronicles 4:14, 1 Chronicles 9:23, 1 Chronicles 15:3, 1 Chronicles 15:21, 1 Chronicles 21:4, 2 Chronicles 6:12, 2 Chronicles 12:1, 2 Chronicles 14:5, 2 Chronicles 18:32, 2 Chronicles 35:17, Ezra 3:1, Ezra 6:2, Nehemiah 5:10, Esther 2:11, Job 11:20, Psalms 14:1, Psalms 24:4, Psalms 27:12, Psalms 31:17, Psalms 45:1, Psalms 46:9, Psalms 51:1, Psalms 67:4, Psalms 68:2, Psalms 76:5, Psalms 78:55, Psalms 80:1, Psalms 86:14, Psalms 91:4, Psalms 97:10, Psalms 99:4, Proverbs 1:27, Ecclesiastes 8:9, Isaiah 19:12, Isaiah 23:3, Isaiah 45:4, Isaiah 45:12, Isaiah 63:6, Jeremiah 2:22, Jeremiah 7:3, Jeremiah 9:18, Jeremiah 9:25, Jeremiah 26:4, Jeremiah 32:31, Jeremiah 40:2, Ezekiel 5:5, Ezekiel 11:9, Ezekiel 11:22, Ezekiel 14:10, Ezekiel 16:26, Ezekiel 16:30, Ezekiel 18:4, Ezekiel 24:18, Ezekiel 40:12, Ezekiel 45:24, Ezekiel 46:22, Daniel 1:11, Daniel 2:42, Daniel 5:8, Daniel 8:16, Hosea 11:5, Hosea 11:10, Amos 3:6, Amos 6:11, Micah 6:10, Zechariah 5:5, Zechariah 8:22, Matthew 4:25, Matthew 5:17, Matthew 8:3, Matthew 12:22, Matthew 12:34, Matthew 14:22, Matthew 14:31, Matthew 14:35, Matthew 19:1, Matthew 19:14, Matthew 26:3, Mark 1:24, Mark 6:33, Mark 7:33, Mark 9:37, Mark 11:1, Mark 15:31, Mark 16:17, Luke 2:9, Luke 2:46, Luke 4:17, Luke 6:10, Luke 8:42, Luke 9:28, Luke 11:14, Luke 18:9, Luke 20:16, Luke 23:5, John 3:22, John 5:10, John 5:45, John 6:61, John 7:22, John 9:8, John 9:31, John 13:34, John 18:5, John 18:35, Acts 4:17, Acts 7:41, Acts 8:33, Acts 8:34, Acts 16:23, Acts 16:38, Acts 17:32, Acts 19:8, Acts 27:9, Romans 3:8, Romans 3:27, Romans 5:11, Romans 9:20, Romans 13:12, Romans 15:21, 1 Corinthians 9:24, 1 Corinthians 10:7, 1 Corinthians 15:12, 2 Corinthians 1:13, 2 Corinthians 2:16, 2 Corinthians 5:14, 2 Corinthians 8:12, 2 Corinthians 12:1, 2 Corinthians 12:3, Galatians 6:10, Ephesians 1:1, Ephesians 1:4, Ephesians 4:1, Philippians 1:13, Colossians 1:28, 1 Thessalonians 3:2, Titus 3:14, Hebrews 6:9, Hebrews 6:20, Hebrews 7:6, Hebrews 7:8, Hebrews 8:4, Hebrews 9:10, James 5:9, 1 Peter 1:23, 1 Peter 4:4, 1 Peter 4:13, 2 John 1:3, 3 John 1:6, Revelation 12:7, Genesis 7:17, Genesis 12:10, Genesis 18:16, Genesis 24:20, Genesis 24:55, Genesis 30:42, Genesis 34:15, Genesis 38:17, Genesis 43:3, Genesis 46:25, Exodus 2:19, Exodus 3:20, Exodus 8:10, Exodus 8:15, Exodus 14:18, Exodus 21:18, Exodus 23:28, Exodus 24:2, Exodus 28:10, Exodus 28:26, Exodus 34:31, Exodus 35:31, Exodus 36:4, Exodus 39:19, Exodus 40:18, Leviticus 2:3, Leviticus 2:10, Leviticus 13:15, Leviticus 13:19, Leviticus 14:43, Numbers 10:17, Numbers 10:18, Numbers 11:34, Numbers 24:3, Numbers 24:4, Numbers 24:15, Numbers 29:22, Numbers 29:28, Numbers 29:38, Numbers 31:41, Numbers 32:12, Numbers 32:39, Numbers 33:7, Deuteronomy 4:22, Deuteronomy 4:49, Deuteronomy 21:10, Deuteronomy 28:10, Joshua 6:7, Joshua 19:39, Joshua 21:25, Judges 6:34, Judges 7:23, Judges 21:6, Judges 21:17, Ruth 4:13, 1 Samuel 17:22, 1 Samuel 18:7, 1 Samuel 19:13, 1 Samuel 24:20, 2 Samuel 3:17, 2 Samuel 9:12, 2 Samuel 15:3, 2 Samuel 19:21, 1 Kings 12:25, 1 Kings 14:28, 1 Kings 17:5, 1 Kings 18:28, 2 Kings 2:1, 2 Kings 5:16, 2 Kings 8:25, 2 Kings 10:3, 2 Kings 14:17, 2 Kings 22:10, 2 Kings 25:30, 1 Chronicles 4:19, 1 Chronicles 11:17, 1 Chronicles 15:11, 1 Chronicles 16:38, 1 Chronicles 29:4, 2 Chronicles 5:14, 2 Chronicles 15:13, 2 Chronicles 17:6, Nehemiah 6:8, Nehemiah 13:27, Nehemiah 13:29, Nehemiah 13:30, Job 16:4, Job 37:12, Psalms 10:8, Psalms 30:9, Psalms 36:6, Psalms 37:40, Psalms 53:1, Psalms 65:13, Psalms 82:5, Psalms 111:1, Psalms 126:6, Proverbs 3:3, Proverbs 23:29, Ecclesiastes 4:12, Song of Solomon 6:1, Song of Solomon 8:12, Isaiah 8:11, Isaiah 29:15, Isaiah 37:20, Isaiah 38:18, Isaiah 40:5, Isaiah 42:3, Isaiah 42:7, Isaiah 42:9, Isaiah 45:17, Isaiah 47:2, Isaiah 51:12, Isaiah 66:10, Jeremiah 5:10, Jeremiah 7:4, Jeremiah 8:17, Jeremiah 12:11, Jeremiah 18:16, Jeremiah 31:29, Jeremiah 32:15, Jeremiah 42:9, Jeremiah 42:19, Jeremiah 47:7, Lamentations 4:14, Ezekiel 2:4, Ezekiel 4:7, Ezekiel 4:13, Ezekiel 10:3, Ezekiel 11:20, Ezekiel 16:48, Ezekiel 23:20, Ezekiel 33:14, Ezekiel 40:18, Ezekiel 40:32, Ezekiel 41:13, Ezekiel 42:7, Ezekiel 46:3, Daniel 9:1, Daniel 9:8, Daniel 12:5, Hosea 6:9, Hosea 9:13, Hosea 10:15, Joel 3:7, Micah 4:5, Nahum 1:4, Nahum 1:8, Haggai 1:13, Haggai 2:1, Haggai 2:3, Zechariah 6:14, Matthew 2:2, Matthew 5:11, Matthew 11:10, Matthew 16:24, Matthew 22:25, Matthew 22:37, Matthew 26:59, Matthew 28:11, Mark 1:20, Mark 11:3, Mark 12:24, Mark 14:5, Mark 14:7, Luke 2:10, Luke 7:27, Luke 12:8, Luke 13:6, Luke 15:30, Luke 21:16, Luke 21:28, Luke 22:20, Luke 22:54, John 2:11, John 2:23, John 6:12, John 6:57, John 10:25, John 14:3, John 15:22, John 19:14, John 19:25, Acts 4:23, Acts 11:13, Acts 14:14, Acts 16:33, Acts 19:31, Romans 14:17, 1 Corinthians 6:5, 1 Corinthians 7:32, Ephesians 4:17, Philippians 3:15, 1 Timothy 5:17, 1 Timothy 6:15, 2 Timothy 4:2, Titus 2:8, Hebrews 1:13, Hebrews 4:13, 2 Peter 2:11, 2 Peter 3:11, 1 John 3:14, Revelation 2:19, Revelation 21:2, Genesis 2:3, Genesis 8:19, Genesis 12:6, Genesis 13:12, Genesis 20:12, Genesis 24:42, Genesis 26:32, Genesis 27:5, Genesis 30:6, Genesis 31:23, Genesis 36:10, Genesis 40:4, Genesis 41:5, Genesis 46:8, Exodus 8:11, Exodus 13:11, Exodus 20:25, Exodus 25:17, Exodus 25:21, Exodus 31:7, Exodus 34:32, Exodus 37:10, Leviticus 9:12, Leviticus 11:36, Leviticus 16:22, Leviticus 18:14, Leviticus 18:15, Leviticus 19:31, Numbers 1:16, Numbers 11:5, Numbers 12:2, Numbers 15:13, Numbers 26:48, Numbers 32:21, Numbers 34:15, Deuteronomy 4:28, Deuteronomy 14:1, Deuteronomy 16:9, Deuteronomy 16:20, Deuteronomy 20:9, Deuteronomy 22:1, Joshua 1:6, Joshua 1:17, Joshua 2:20, Joshua 4:21, Joshua 5:8, Joshua 13:33, Joshua 19:23, Judges 1:34, Judges 10:16, Ruth 1:4, 1 Samuel 3:18, 1 Samuel 9:11, 1 Samuel 9:17, 1 Samuel 13:10, 1 Samuel 15:4, 1 Samuel 17:42, 1 Samuel 25:5, 2 Samuel 2:6, 2 Samuel 8:12, 2 Samuel 14:4, 2 Samuel 19:16, 2 Samuel 23:15, 1 Kings 1:26, 1 Kings 2:23, 1 Kings 9:26, 1 Kings 9:27, 1 Kings 10:20, 1 Kings 11:23, 1 Kings 17:6, 1 Kings 22:18, 2 Kings 5:3, 2 Kings 11:16, 2 Kings 12:20, 2 Kings 15:32, 2 Kings 18:20, 1 Chronicles 9:13, 1 Chronicles 27:5, 1 Chronicles 27:7, 1 Chronicles 29:8, 2 Chronicles 1:8, 2 Chronicles 1:13, 2 Chronicles 18:17, 2 Chronicles 29:9, 2 Chronicles 32:29, Ezra 4:21, Nehemiah 3:26, Nehemiah 6:19, Nehemiah 11:20, Esther 5:4, Job 7:20, Job 35:6, Psalms 18:43, Psalms 19:6, Psalms 44:1, Psalms 55:19, Psalms 68:6, Psalms 71:15, Proverbs 30:8, Ecclesiastes 3:17, Ecclesiastes 5:12, Ecclesiastes 9:15, Song of Solomon 5:5, Song of Solomon 6:5, Song of Solomon 7:1, Isaiah 1:31, Isaiah 6:7, Isaiah 6:8, Isaiah 6:9, Isaiah 7:16, Isaiah 8:1, Isaiah 8:6, Isaiah 14:16, Isaiah 19:19, Isaiah 21:7, Isaiah 22:2, Isaiah 23:16, Isaiah 27:4, Isaiah 27:8, Isaiah 29:18, Isaiah 30:3, Isaiah 30:24, Isaiah 36:5, Isaiah 44:25, Isaiah 56:1, Jeremiah 1:9, Jeremiah 2:30, Jeremiah 6:17, Jeremiah 8:4, Jeremiah 17:23, Jeremiah 22:20, Jeremiah 29:4, Jeremiah 32:41, Jeremiah 38:13, Jeremiah 49:4, Jeremiah 50:27, Jeremiah 50:41, Ezekiel 16:60, Ezekiel 19:8, Ezekiel 23:34, Ezekiel 23:48, Ezekiel 26:18, Ezekiel 34:21, Ezekiel 48:34, Daniel 2:37, Daniel 6:18, Daniel 9:22, Daniel 10:5, Hosea 6:1, Hosea 11:7, Hosea 12:4, Jonah 2:9, Micah 7:5, Micah 7:20, Zechariah 1:10, Matthew 5:21, Matthew 8:33, Matthew 9:11, Matthew 20:20, Matthew 27:51, Mark 3:14, Mark 5:26, Mark 14:61, Luke 2:24, Luke 3:11, Luke 6:9, Luke 9:3, Luke 9:14, Luke 18:8, Luke 19:21, Luke 19:27, John 3:17, John 3:23, John 4:12, John 9:39, John 11:51, John 13:8, John 18:17, Acts 3:26, Acts 7:17, Acts 7:55, Acts 8:20, Acts 8:38, Acts 16:40, Acts 23:12, Acts 23:29, Acts 23:35, Acts 27:3, Romans 1:24, Romans 2:26, Romans 8:32, Romans 15:31, 1 Corinthians 14:11, 2 Corinthians 1:14, Galatians 3:5, Ephesians 3:20, Colossians 2:14, 2 Thessalonians 3:12, 1 Timothy 5:18, 1 Timothy 6:11, 2 Timothy 2:18, 1 Peter 2:11, 1 Peter 3:10, 1 John 2:22, Revelation 7:3, Genesis 4:22, Genesis 14:23, Genesis 21:7, Genesis 26:31, Genesis 27:14, Genesis 32:29, Genesis 36:15, Genesis 50:25, Exodus 3:5, Exodus 12:7, Exodus 13:16, Exodus 15:11, Exodus 15:15, Exodus 18:6, Exodus 27:17, Exodus 28:6, Exodus 36:29, Exodus 38:10, Exodus 39:16, Leviticus 6:3, Leviticus 8:17, Leviticus 8:27, Leviticus 11:31, Leviticus 11:45, Leviticus 21:5, Leviticus 24:8, Leviticus 27:20, Numbers 3:28, Numbers 3:51, Numbers 5:29, Numbers 12:1, Numbers 29:37, Deuteronomy 1:11, Deuteronomy 9:25, Deuteronomy 19:13, Deuteronomy 28:47, Joshua 5:11, Joshua 15:4, Joshua 17:5, Judges 2:22, Judges 3:16, Judges 5:6, 1 Samuel 1:16, 1 Samuel 15:13, 1 Samuel 30:7, 2 Samuel 16:22, 2 Samuel 22:49, 1 Kings 9:1, 1 Kings 10:27, 1 Kings 14:3, 1 Kings 14:17, 1 Kings 20:11, 1 Kings 22:53, 2 Kings 6:31, 2 Kings 9:34, 2 Kings 13:13, 1 Chronicles 5:17, 1 Chronicles 7:3, 1 Chronicles 15:1, 2 Chronicles 3:7, 2 Chronicles 4:7, 2 Chronicles 4:19, 2 Chronicles 9:19, 2 Chronicles 9:27, 2 Chronicles 15:12, 2 Chronicles 23:19, 2 Chronicles 25:25, 2 Chronicles 26:9, 2 Chronicles 36:7, Nehemiah 4:18, Nehemiah 5:16, Nehemiah 6:11, Nehemiah 8:8, Nehemiah 9:14, Nehemiah 10:32, Job 12:4, Job 20:26, Job 33:26, Job 36:7, Psalms 7:8, Psalms 28:2, Psalms 72:4, Psalms 79:1, Psalms 98:9, Psalms 101:2, Psalms 101:5, Psalms 104:14, Proverbs 17:2, Ecclesiastes 3:5, Ecclesiastes 12:12, Isaiah 10:10, Isaiah 14:8, Isaiah 19:8, Isaiah 48:7, Isaiah 49:12, Isaiah 65:2, Jeremiah 4:18, Jeremiah 6:29, Jeremiah 32:9, Jeremiah 50:30, Ezekiel 7:14, Ezekiel 17:18, Ezekiel 19:10, Ezekiel 29:20, Ezekiel 32:3, Ezekiel 38:19, Ezekiel 39:29, Ezekiel 40:34, Ezekiel 40:37, Ezekiel 48:32, Daniel 2:13, Daniel 4:16, Daniel 8:18, Hosea 7:7, Hosea 11:6, Joel 3:3, Amos 9:12, Habakkuk 3:10, Zechariah 6:11, Zechariah 14:19, Matthew 3:15, Matthew 8:29, Matthew 11:12, Matthew 12:2, Matthew 12:33, Matthew 18:19, Matthew 25:37, Matthew 27:48, Mark 1:10, Mark 2:23, Mark 4:39, Mark 11:9, Mark 14:30, Mark 14:44, Mark 14:55, Mark 16:7, Luke 1:41, Luke 4:2, Luke 7:21, Luke 9:41, Luke 11:18, Luke 22:44, Luke 24:27, John 5:39, John 9:6, John 9:21, John 19:4, Acts 3:20, Acts 4:12, Acts 4:26, Acts 4:30, Acts 5:25, Acts 7:30, Acts 7:32, Acts 9:13, Acts 10:11, Acts 10:32, Acts 12:3, Acts 16:22, Acts 19:24, Acts 26:4, Acts 28:18, Romans 6:5, Romans 15:23, 1 Corinthians 4:19, 1 Corinthians 6:19, 1 Corinthians 9:5, 2 Corinthians 2:5, 2 Corinthians 2:13, Galatians 3:1, Ephesians 3:7, Ephesians 5:6, Ephesians 5:19, Philippians 2:16, Philippians 4:9, Colossians 1:20, 1 Timothy 1:12, 1 Timothy 2:2, 2 Timothy 1:18, Titus 1:11, Hebrews 3:12, Hebrews 7:19, Hebrews 9:6, Hebrews 12:24, James 1:23, James 3:5, 1 Peter 2:8, 2 Peter 3:14, 1 John 5:4, Revelation 3:2, Revelation 17:5, Revelation 22:1, Genesis 1:16, Genesis 9:17, Genesis 24:12, Genesis 31:31, Genesis 39:17, Genesis 47:16, Genesis 48:18, Genesis 49:3, Exodus 3:4, Exodus 9:28, Exodus 10:17, Exodus 18:23, Exodus 18:26, Exodus 19:11, Exodus 23:18, Exodus 27:12, Exodus 32:25, Exodus 34:12, Leviticus 1:8, Leviticus 7:19, Leviticus 19:2, Numbers 1:52, Numbers 2:27, Numbers 4:6, Numbers 13:19, Numbers 15:6, Numbers 36:11, Deuteronomy 10:22, Deuteronomy 11:11, Deuteronomy 13:9, Deuteronomy 22:27, Deuteronomy 31:8, Deuteronomy 31:10, Deuteronomy 32:52, Deuteronomy 33:3, Judges 2:4, Judges 19:13, 1 Samuel 3:10, 1 Samuel 4:9, 1 Samuel 9:25, 1 Samuel 13:20, 1 Samuel 25:23, 1 Samuel 26:9, 2 Samuel 3:6, 2 Samuel 8:1, 2 Samuel 13:26, 2 Samuel 13:30, 2 Samuel 22:7, 2 Samuel 23:3, 1 Kings 8:7, 1 Kings 11:15, 1 Kings 15:34, 1 Kings 17:24, 1 Kings 22:48, 2 Kings 1:18, 2 Kings 6:21, 2 Kings 9:30, 2 Kings 11:10, 2 Kings 12:3, 2 Kings 14:5, 2 Kings 17:18, 2 Kings 19:8, 2 Kings 20:10, 2 Kings 25:9, 1 Chronicles 13:9, 1 Chronicles 19:4, 1 Chronicles 29:27, 2 Chronicles 17:19, 2 Chronicles 18:25, 2 Chronicles 24:16, 2 Chronicles 24:26, 2 Chronicles 30:2, Ezra 5:13, Ezra 7:22, Nehemiah 2:14, Job 4:16, Job 23:12, Psalms 7:5, Psalms 7:6, Psalms 7:17, Psalms 27:1, Psalms 31:13, Psalms 71:6, Psalms 78:20, Psalms 101:3, Psalms 102:2, Psalms 119:78, Psalms 144:12, Psalms 146:9, Proverbs 28:10, Isaiah 13:3, Isaiah 14:12, Isaiah 19:6, Isaiah 42:4, Isaiah 46:4, Isaiah 49:20, Isaiah 52:2, Isaiah 57:9, Isaiah 65:4, Isaiah 66:6, Isaiah 66:16, Jeremiah 1:19, Jeremiah 12:7, Jeremiah 14:6, Jeremiah 18:10, Jeremiah 26:24, Jeremiah 31:14, Jeremiah 31:22, Jeremiah 35:16, Jeremiah 40:6, Jeremiah 46:19, Ezekiel 17:8, Ezekiel 18:8, Ezekiel 23:14, Ezekiel 24:2, Ezekiel 40:27, Ezekiel 40:43, Ezekiel 42:4, Ezekiel 46:23, Daniel 3:18, Daniel 6:25, Hosea 9:9, Hosea 12:9, Joel 2:10, Amos 9:2, Micah 4:9, Haggai 2:10, Zechariah 13:6, Zechariah 14:11, Matthew 2:20, Matthew 4:4, Matthew 7:26, Matthew 8:11, Matthew 8:20, Matthew 9:36, Matthew 10:15, Matthew 11:8, Matthew 12:35, Matthew 16:18, Matthew 18:32, Matthew 19:23, Matthew 20:1, Matthew 20:31, Matthew 25:43, Matthew 26:42, Matthew 27:31, Mark 3:4, Mark 5:39, Mark 8:25, Mark 11:31, Mark 12:32, Luke 4:34, Luke 5:1, Luke 7:43, Luke 9:58, Luke 11:49, Luke 12:20, Luke 17:4, Luke 21:26, Luke 23:12, Luke 23:28, John 4:11, John 6:13, John 7:31, John 11:47, John 13:16, John 15:10, John 16:22, John 17:14, John 19:26, John 19:41, John 20:29, Acts 1:2, Acts 2:20, Acts 4:36, Acts 5:23, Acts 7:7, Acts 7:25, Acts 15:25, Acts 17:22, Acts 19:6, Acts 24:15, Acts 27:28, Romans 1:17, Romans 11:23, Romans 15:5, 1 Corinthians 10:4, 2 Corinthians 10:16, Galatians 1:1, Galatians 3:15, Philippians 1:29, Colossians 3:1, 2 Thessalonians 1:9, 1 Timothy 5:5, Titus 2:3, Philemon 1:22, James 3:1, James 4:8, 1 Peter 2:10, 2 Peter 1:21, 2 Peter 2:16, 3 John 1:9, Revelation 1:13, Revelation 21:1, Genesis 12:1, Genesis 18:18, Genesis 20:1, Genesis 20:17, Genesis 21:19, Genesis 30:26, Genesis 39:12, Genesis 40:19, Genesis 41:10, Genesis 45:5, Exodus 6:3, Exodus 6:26, Exodus 9:20, Exodus 9:35, Exodus 16:14, Exodus 22:1, Exodus 22:24, Exodus 29:10, Exodus 34:30, Exodus 40:36, Leviticus 3:17, Leviticus 17:2, Leviticus 23:4, Leviticus 26:35, Numbers 11:23, Numbers 14:12, Numbers 15:9, Numbers 18:5, Numbers 19:8, Numbers 21:25, Numbers 21:30, Numbers 29:19, Deuteronomy 6:21, Deuteronomy 10:2, Deuteronomy 15:16, Deuteronomy 28:18, Joshua 8:10, Joshua 8:32, Joshua 11:22, Joshua 17:12, Judges 6:1, Judges 6:14, Judges 21:13, 1 Samuel 4:12, 1 Samuel 8:9, 1 Samuel 18:13, 1 Samuel 31:1, 2 Samuel 1:24, 2 Samuel 12:17, 2 Samuel 15:11, 2 Samuel 16:12, 2 Samuel 20:9, 2 Samuel 22:44, 1 Kings 3:13, 1 Kings 13:16, 1 Kings 16:10, 1 Kings 22:26, 2 Kings 8:7, 2 Kings 8:28, 2 Kings 15:8, 2 Kings 15:10, 2 Kings 18:6, 2 Kings 25:3, 1 Chronicles 6:33, 1 Chronicles 10:1, 1 Chronicles 26:4, 2 Chronicles 13:4, 2 Chronicles 15:18, 2 Chronicles 24:10, 2 Chronicles 25:26, 2 Chronicles 30:13, Ezra 5:9, Nehemiah 7:71, Nehemiah 12:1, Nehemiah 12:25, Esther 2:5, Esther 8:6, Job 16:8, Psalms 13:2, Psalms 22:27, Psalms 28:5, Psalms 37:34, Psalms 40:16, Psalms 40:17, Psalms 41:6, Psalms 42:6, Psalms 49:11, Psalms 52:9, Psalms 59:3, Psalms 68:17, Psalms 70:2, Psalms 79:8, Psalms 127:5, Psalms 132:12, Proverbs 6:22, Proverbs 14:14, Ecclesiastes 4:10, Ecclesiastes 12:11, Song of Solomon 5:16, Isaiah 19:16, Isaiah 26:1, Isaiah 40:6, Isaiah 47:5, Isaiah 62:12, Jeremiah 1:2, Jeremiah 11:3, Jeremiah 14:4, Jeremiah 17:5, Jeremiah 23:26, Jeremiah 33:6, Jeremiah 34:4, Jeremiah 50:43, Jeremiah 51:1, Jeremiah 52:6, Jeremiah 52:13, Lamentations 4:16, Ezekiel 2:5, Ezekiel 3:10, Ezekiel 6:5, Ezekiel 11:23, Ezekiel 16:59, Ezekiel 18:9, Ezekiel 22:15, Ezekiel 27:25, Ezekiel 38:2, Ezekiel 38:21, Ezekiel 43:9, Ezekiel 46:24, Daniel 1:1, Hosea 4:2, Joel 1:17, Jonah 1:17, Habakkuk 1:16, Habakkuk 2:15, Habakkuk 3:11, Zephaniah 2:10, Zechariah 5:8, Matthew 5:39, Matthew 12:13, Matthew 12:24, Matthew 14:23, Matthew 17:1, Matthew 21:27, Matthew 24:9, Matthew 28:1, Mark 5:21, Mark 6:50, Mark 10:51, Luke 2:43, Luke 3:15, Luke 6:23, Luke 15:21, Luke 19:26, John 3:5, John 4:25, John 5:37, John 7:37, John 9:17, John 13:3, John 16:30, John 19:29, Acts 2:47, Acts 5:39, Acts 8:3, Acts 8:10, Acts 12:14, Acts 16:6, Acts 17:16, Acts 20:20, Acts 22:19, Acts 25:3, Acts 25:14, Acts 26:1, Acts 27:34, Romans 2:25, Romans 6:21, Romans 8:18, Romans 9:32, Romans 10:8, Romans 16:4, 1 Corinthians 10:33, 1 Corinthians 11:23, 1 Corinthians 16:11, 2 Corinthians 1:10, 2 Corinthians 9:6, 2 Corinthians 11:25, Ephesians 5:4, 1 Thessalonians 2:6, 1 Timothy 4:12, 2 Timothy 4:21, Hebrews 1:8, Hebrews 2:11, Hebrews 11:19, James 1:26, 1 Peter 1:10, 1 Peter 3:22, Jude 1:23, Genesis 2:17, Genesis 3:13, Genesis 4:12, Genesis 12:4, Genesis 24:33, Genesis 27:21, Genesis 32:30, Genesis 34:11, Genesis 42:27, Genesis 46:1, Exodus 4:27, Exodus 6:9, Exodus 6:27, Exodus 14:23, Exodus 21:26, Exodus 23:25, Exodus 25:36, Exodus 28:33, Exodus 29:18, Exodus 33:22, Exodus 36:34, Exodus 37:22, Leviticus 7:8, Leviticus 7:33, Leviticus 14:22, Leviticus 20:10, Leviticus 27:2, Numbers 1:3, Numbers 2:5, Numbers 10:31, Numbers 12:15, Numbers 13:31, Numbers 14:6, Numbers 14:31, Numbers 20:13, Numbers 21:28, Numbers 28:27, Numbers 29:18, Numbers 29:21, Numbers 29:24, Numbers 29:27, Numbers 29:30, Numbers 29:33, Numbers 32:15, Deuteronomy 13:8, Deuteronomy 31:4, Deuteronomy 34:6, Joshua 21:8, Judges 17:5, Judges 18:15, 1 Samuel 1:26, 1 Samuel 3:15, 1 Samuel 10:12, 1 Samuel 17:4, 1 Samuel 17:43, 1 Samuel 18:26, 2 Samuel 5:9, 2 Samuel 13:23, 2 Samuel 14:18, 2 Samuel 19:10, 1 Kings 1:31, 1 Kings 5:17, 1 Kings 6:35, 1 Kings 7:47, 1 Kings 8:11, 1 Kings 11:25, 1 Kings 11:43, 1 Kings 19:8, 1 Kings 21:26, 2 Kings 19:13, 2 Kings 24:4, 1 Chronicles 8:40, 1 Chronicles 12:33, 1 Chronicles 27:23, 1 Chronicles 27:29, 1 Chronicles 29:23, 2 Chronicles 7:5, 2 Chronicles 9:31, 2 Chronicles 12:8, 2 Chronicles 15:6, 2 Chronicles 18:20, 2 Chronicles 19:6, 2 Chronicles 20:19, 2 Chronicles 23:12, 2 Chronicles 24:21, 2 Chronicles 34:18, Ezra 7:19, Ezra 10:7, Nehemiah 7:65, Nehemiah 9:31, Esther 2:22, Job 16:10, Job 30:1, Psalms 11:2, Psalms 20:6, Psalms 21:9, Psalms 28:1, Psalms 31:20, Psalms 32:9, Psalms 57:6, Psalms 64:6, Psalms 66:12, Psalms 78:5, Psalms 89:1, Psalms 106:48, Psalms 143:3, Ecclesiastes 1:17, Ecclesiastes 8:11, Ecclesiastes 8:13, Song of Solomon 4:3, Song of Solomon 4:4, Isaiah 3:17, Isaiah 13:18, Isaiah 25:7, Isaiah 37:13, Isaiah 38:20, Isaiah 41:12, Isaiah 51:14, Isaiah 56:4, Isaiah 56:8, Isaiah 64:4, Jeremiah 3:10, Jeremiah 3:20, Jeremiah 14:21, Jeremiah 20:16, Jeremiah 37:19, Jeremiah 44:24, Jeremiah 51:60, Ezekiel 11:11, Ezekiel 12:20, Ezekiel 20:46, Ezekiel 26:4, Ezekiel 27:10, Ezekiel 27:21, Ezekiel 33:26, Ezekiel 34:23, Ezekiel 38:6, Daniel 10:14, Daniel 11:23, Hosea 5:4, Hosea 5:5, Hosea 9:3, Joel 2:9, Amos 5:6, Jonah 3:4, Micah 1:12, Zephaniah 1:5, Zephaniah 1:7, Zechariah 14:7, Matthew 5:28, Matthew 9:16, Matthew 10:28, Matthew 11:16, Matthew 13:24, Matthew 16:11, Matthew 19:5, Matthew 20:6, Matthew 24:6, Mark 1:19, Mark 2:2, Mark 2:25, Mark 6:38, Mark 8:20, Mark 16:20, Luke 3:23, Luke 9:10, Luke 10:16, Luke 11:5, John 3:4, John 3:16, John 8:20, John 8:41, John 11:28, John 12:48, John 19:7, John 19:35, Acts 5:40, Acts 7:51, Acts 12:15, Acts 13:14, Romans 8:28, Romans 10:12, Romans 11:33, Romans 15:12, 1 Corinthians 1:12, 1 Corinthians 7:31, 1 Corinthians 10:20, 1 Corinthians 11:5, 1 Corinthians 14:7, 1 Corinthians 15:24, 2 Corinthians 1:16, 2 Corinthians 1:20, 2 Corinthians 11:7, Colossians 4:7, 2 Thessalonians 1:8, 1 Timothy 5:14, Hebrews 3:1, Hebrews 6:6, Hebrews 7:14, James 2:2, Revelation 18:1, Revelation 19:7, Revelation 19:12, Genesis 1:22, Genesis 7:3, Genesis 16:4, Genesis 16:10, Genesis 17:27, Genesis 18:21, Genesis 24:31, Genesis 25:34, Genesis 30:1, Genesis 30:8, Genesis 34:8, Genesis 38:22, Genesis 40:11, Genesis 42:15, Genesis 50:3, Exodus 4:11, Exodus 4:23, Exodus 7:18, Exodus 8:1, Exodus 10:8, Exodus 12:34, Exodus 15:8, Exodus 15:27, Exodus 19:21, Exodus 23:29, Exodus 24:5, Exodus 29:24, Exodus 31:11, Exodus 36:13, Leviticus 2:12, Leviticus 22:32, Leviticus 27:30, Numbers 3:7, Numbers 13:30, Numbers 14:13, Numbers 16:10, Numbers 26:37, Deuteronomy 4:45, Deuteronomy 7:20, Deuteronomy 18:15, Deuteronomy 19:12, Deuteronomy 27:6, Deuteronomy 33:23, Judges 8:11, Judges 18:5, Judges 18:20, Judges 19:26, Ruth 2:15, 1 Samuel 1:18, 1 Samuel 8:16, 1 Samuel 11:4, 1 Samuel 17:44, 1 Samuel 26:17, 1 Samuel 29:1, 1 Samuel 30:19, 2 Samuel 9:4, 2 Samuel 13:12, 2 Samuel 13:31, 2 Samuel 17:6, 2 Samuel 20:14, 1 Kings 3:3, 1 Kings 6:34, 1 Kings 8:31, 1 Kings 8:34, 1 Kings 12:23, 1 Kings 14:14, 1 Kings 15:26, 2 Kings 6:2, 2 Kings 9:9, 2 Kings 19:1, 1 Chronicles 21:28, 1 Chronicles 26:10, 2 Chronicles 1:1, 2 Chronicles 4:5, 2 Chronicles 6:22, 2 Chronicles 19:3, Nehemiah 1:8, Nehemiah 3:10, Esther 3:10, Job 20:18, Psalms 8:2, Psalms 40:11, Psalms 72:17, Psalms 127:2, Psalms 132:11, Psalms 138:8, Psalms 144:14, Proverbs 28:2, Song of Solomon 8:9, Isaiah 4:3, Isaiah 8:3, Isaiah 9:4, Isaiah 9:5, Isaiah 9:19, Isaiah 14:11, Isaiah 21:8, Isaiah 37:1, Jeremiah 5:4, Jeremiah 15:14, Jeremiah 17:10, Jeremiah 18:17, Jeremiah 19:2, Jeremiah 29:11, Jeremiah 36:22, Jeremiah 37:9, Jeremiah 41:3, Jeremiah 41:7, Jeremiah 46:11, Lamentations 4:9, Ezekiel 1:5, Ezekiel 6:4, Ezekiel 7:21, Ezekiel 8:14, Ezekiel 9:7, Ezekiel 10:5, Ezekiel 12:10, Ezekiel 20:12, Ezekiel 29:6, Ezekiel 32:20, Ezekiel 36:18, Ezekiel 36:34, Ezekiel 42:10, Ezekiel 48:35, Daniel 2:1, Daniel 2:39, Daniel 9:10, Daniel 11:19, Hosea 5:15, Joel 1:18, Joel 1:19, Joel 2:7, Amos 4:3, Amos 7:7, Micah 2:2, Micah 3:7, Micah 7:16, Habakkuk 1:4, Zechariah 1:15, Matthew 13:13, Matthew 13:55, Matthew 14:26, Matthew 21:38, Matthew 24:7, Mark 4:5, Mark 4:11, Mark 4:12, Mark 9:19, Mark 10:49, Mark 14:22, Mark 14:36, Luke 1:80, Luke 4:14, Luke 6:8, Luke 7:16, Luke 8:23, Luke 9:5, Luke 10:20, Luke 12:47, Luke 14:17, Luke 14:28, Luke 20:21, Luke 21:7, Luke 23:50, John 3:21, John 6:58, John 8:54, Acts 11:16, Acts 13:5, Acts 13:8, Acts 13:13, Acts 13:26, Acts 14:26, Acts 16:17, Acts 17:1, Acts 17:7, Acts 20:1, Acts 21:39, Acts 22:18, Romans 15:28, Romans 16:23, 1 Corinthians 5:5, 1 Corinthians 13:8, 1 Corinthians 14:22, 1 Corinthians 15:6, 1 Corinthians 15:39, 1 Thessalonians 1:3, 1 Thessalonians 1:6, 2 Thessalonians 3:17, Titus 3:12, Hebrews 10:26, Hebrews 13:3, 1 Peter 1:21, Revelation 11:17, Revelation 12:6, Revelation 12:13, Revelation 22:11, Genesis 15:2, Genesis 22:16, Genesis 23:15, Genesis 24:2, Genesis 31:26, Genesis 37:33, Genesis 38:1, Genesis 38:20, Genesis 40:10, Genesis 44:15, Genesis 49:1, Genesis 49:33, Genesis 50:14, Exodus 2:7, Exodus 6:15, Exodus 7:11, Exodus 12:37, Exodus 20:7, Exodus 25:23, Exodus 27:4, Exodus 32:7, Exodus 32:31, Exodus 39:26, Leviticus 13:23, Leviticus 13:54, Leviticus 14:16, Leviticus 23:12, Leviticus 23:15, Leviticus 26:15, Leviticus 26:46, Leviticus 27:32, Numbers 4:8, Numbers 10:12, Numbers 15:35, Numbers 18:29, Numbers 20:15, Numbers 21:9, Numbers 33:40, Numbers 34:17, Deuteronomy 4:12, Deuteronomy 10:9, Deuteronomy 22:7, Deuteronomy 24:20, Deuteronomy 25:6, Deuteronomy 27:10, Deuteronomy 30:12, Deuteronomy 31:5, Deuteronomy 31:18, Deuteronomy 33:24, Joshua 2:15, Joshua 13:25, Joshua 14:15, Joshua 21:9, Joshua 24:20, Judges 3:5, Judges 8:25, Judges 8:32, Judges 20:12, Judges 20:20, 1 Samuel 4:5, 1 Samuel 11:10, 1 Samuel 12:1, 1 Samuel 13:8, 1 Samuel 13:17, 1 Samuel 17:18, 1 Samuel 24:2, 1 Samuel 30:20, 2 Samuel 3:16, 2 Samuel 3:37, 2 Samuel 16:16, 1 Kings 1:15, 1 Kings 4:34, 1 Kings 9:24, 1 Kings 14:20, 1 Kings 16:3, 1 Kings 16:22, 1 Kings 18:37, 1 Kings 19:18, 2 Kings 2:7, 2 Kings 8:10, 2 Kings 8:24, 2 Kings 9:16, 2 Kings 11:7, 2 Kings 15:13, 2 Kings 18:7, 2 Kings 23:21, 1 Chronicles 4:22, 1 Chronicles 7:11, 1 Chronicles 9:26, 1 Chronicles 9:27, 1 Chronicles 16:2, 2 Chronicles 24:19, 2 Chronicles 28:11, 2 Chronicles 30:12, Nehemiah 13:17, Esther 9:5, Job 14:5, Job 37:4, Psalms 2:2, Psalms 16:11, Psalms 18:48, Psalms 31:7, Psalms 31:10, Psalms 40:9, Psalms 41:2, Psalms 42:5, Psalms 68:35, Psalms 144:13, Proverbs 20:16, Ecclesiastes 1:8, Isaiah 10:17, Isaiah 30:5, Isaiah 31:5, Isaiah 37:8, Isaiah 37:32, Isaiah 50:8, Isaiah 60:15, Isaiah 65:11, Jeremiah 9:7, Jeremiah 13:25, Jeremiah 35:19, Jeremiah 48:46, Jeremiah 50:31, Lamentations 4:11, Ezekiel 4:17, Ezekiel 7:12, Ezekiel 22:9, Ezekiel 27:17, Ezekiel 36:37, Ezekiel 37:2, Ezekiel 44:29, Ezekiel 48:14, Daniel 3:16, Hosea 2:19, Hosea 12:2, Hosea 12:8, Joel 1:9, Amos 7:2, Micah 2:9, Nahum 3:13, Zechariah 2:2, Zechariah 8:17, Zechariah 9:4, Zechariah 9:17, Matthew 2:1, Matthew 16:13, Matthew 25:40, Matthew 26:56, Matthew 28:19, Mark 7:27, Mark 7:37, Mark 9:39, Mark 14:25, Luke 1:32, Luke 1:38, Luke 6:44, Luke 7:47, Luke 11:22, Luke 11:33, Luke 12:54, Luke 23:53, John 1:23, John 2:12, John 4:6, John 5:6, John 12:17, John 13:20, John 18:23, Acts 2:2, Acts 2:39, Acts 2:40, Acts 4:19, Acts 5:26, Acts 7:20, Acts 8:40, Acts 13:45, Acts 17:10, Acts 20:11, Acts 27:35, Acts 28:22, Romans 3:21, Romans 5:19, Romans 8:21, Romans 9:26, 1 Corinthians 4:3, 1 Corinthians 6:7, 1 Corinthians 12:13, 1 Corinthians 14:2, 1 Corinthians 15:50, Galatians 1:17, Ephesians 2:10, Ephesians 4:25, Philippians 2:1, Colossians 3:17, 2 Timothy 3:2, Titus 3:9, Hebrews 1:12, Hebrews 4:16, Hebrews 11:22, Hebrews 11:29, James 2:8, 2 Peter 1:11, 2 Peter 3:2, 2 Peter 3:8, Jude 1:24, Revelation 9:11, Revelation 17:6, Genesis 13:18, Genesis 15:10, Genesis 17:9, Genesis 24:19, Genesis 25:18, Genesis 34:14, Genesis 40:15, Genesis 41:50, Genesis 42:32, Genesis 43:2, Genesis 46:7, Exodus 2:16, Exodus 10:10, Exodus 12:46, Exodus 23:13, Exodus 27:10, Exodus 30:3, Exodus 32:5, Exodus 34:2, Exodus 36:35, Leviticus 4:33, Leviticus 7:4, Leviticus 17:9, Leviticus 23:11, Leviticus 24:2, Numbers 3:46, Numbers 20:26, Numbers 22:29, Numbers 23:14, Numbers 24:14, Numbers 26:5, Numbers 27:22, Numbers 31:49, Numbers 36:5, Deuteronomy 5:11, Deuteronomy 11:23, Joshua 4:24, Joshua 8:3, Joshua 9:22, Joshua 17:8, Judges 1:8, Judges 16:8, 1 Samuel 2:9, 1 Samuel 3:5, 1 Samuel 7:17, 1 Samuel 11:12, 1 Samuel 15:2, 1 Samuel 15:19, 1 Samuel 17:48, 1 Samuel 17:58, 1 Samuel 21:15, 1 Samuel 23:28, 1 Samuel 28:13, 2 Samuel 24:5, 1 Kings 16:14, 1 Kings 19:3, 1 Kings 20:16, 2 Kings 3:23, 2 Kings 4:4, 2 Kings 8:4, 2 Kings 12:19, 2 Kings 16:20, 1 Chronicles 3:4, 1 Chronicles 6:67, 1 Chronicles 12:4, 1 Chronicles 16:29, 1 Chronicles 16:36, 1 Chronicles 16:39, 2 Chronicles 5:8, 2 Chronicles 6:9, 2 Chronicles 11:18, 2 Chronicles 28:25, 2 Chronicles 29:10, 2 Chronicles 32:19, 2 Chronicles 34:16, Nehemiah 3:19, Nehemiah 5:17, Job 7:11, Job 34:33, Psalms 9:16, Psalms 15:4, Psalms 87:4, Psalms 90:17, Psalms 98:1, Psalms 118:27, Psalms 137:7, Psalms 140:5, Psalms 144:11, Proverbs 1:22, Ecclesiastes 1:6, Ecclesiastes 2:23, Isaiah 2:12, Isaiah 9:2, Isaiah 10:7, Isaiah 15:4, Isaiah 31:7, Isaiah 32:10, Isaiah 40:10, Isaiah 41:4, Isaiah 43:3, Isaiah 45:2, Isaiah 50:6, Isaiah 62:9, Isaiah 65:19, Jeremiah 7:9, Jeremiah 8:22, Jeremiah 9:11, Jeremiah 20:2, Jeremiah 22:23, Jeremiah 38:12, Jeremiah 49:34, Jeremiah 52:10, Lamentations 4:2, Lamentations 4:18, Ezekiel 3:22, Ezekiel 3:24, Ezekiel 5:9, Ezekiel 10:20, Ezekiel 16:10, Ezekiel 16:38, Ezekiel 18:12, Ezekiel 18:15, Ezekiel 18:23, Ezekiel 18:28, Ezekiel 20:23, Ezekiel 27:19, Ezekiel 28:4, Ezekiel 30:16, Ezekiel 36:29, Ezekiel 39:13, Ezekiel 40:47, Daniel 8:1, Hosea 6:5, Hosea 9:8, Hosea 12:14, Joel 3:9, Joel 3:13, Micah 5:1, Micah 5:13, Micah 6:9, Zechariah 10:4, Matthew 5:20, Matthew 6:20, Matthew 6:34, Matthew 10:14, Matthew 13:11, Matthew 16:8, Matthew 16:28, Matthew 18:21, Matthew 24:21, Matthew 24:32, Matthew 26:29, Matthew 26:73, Matthew 27:11, Matthew 27:27, Mark 11:33, Mark 13:27, Mark 13:28, Mark 14:9, Mark 14:62, Luke 5:15, Luke 9:18, Luke 11:53, Luke 12:5, Luke 12:18, Luke 13:1, Luke 18:5, Luke 19:42, Luke 20:14, Luke 22:35, Luke 22:53, Luke 24:49, John 4:46, John 4:52, John 5:14, John 7:32, John 12:27, Acts 2:31, Acts 9:10, Acts 9:22, Acts 10:41, Acts 15:30, Acts 15:38, Acts 17:28, Acts 24:12, Romans 4:10, Romans 5:2, Romans 8:13, Romans 9:21, Romans 10:5, Romans 11:18, Romans 14:14, 1 Corinthians 1:30, 1 Corinthians 7:21, 1 Corinthians 8:1, 1 Corinthians 10:21, 1 Corinthians 15:48, 2 Corinthians 4:15, 2 Corinthians 5:15, 2 Corinthians 8:11, 2 Corinthians 10:5, 2 Corinthians 11:6, 2 Corinthians 12:13, Galatians 2:8, Ephesians 2:19, Ephesians 3:16, Ephesians 6:13, Colossians 3:11, 2 Thessalonians 2:15, 2 Thessalonians 2:16, 2 Timothy 2:2, Hebrews 3:13, Hebrews 13:15, 2 Peter 1:12, 2 Peter 2:9, Revelation 12:3, Revelation 13:6, Revelation 19:8, Genesis 1:9, Genesis 4:4, Genesis 13:3, Genesis 27:22, Genesis 32:18, Genesis 34:2, Genesis 34:23, Genesis 35:16, Genesis 40:1, Exodus 5:4, Exodus 5:10, Exodus 6:5, Exodus 7:2, Exodus 10:28, Exodus 15:13, Exodus 15:21, Exodus 18:4, Exodus 19:6, Exodus 26:12, Exodus 29:30, Exodus 29:32, Exodus 31:16, Exodus 37:27, Leviticus 4:21, Leviticus 9:17, Leviticus 11:2, Leviticus 16:20, Leviticus 20:20, Leviticus 21:8, Leviticus 23:28, Leviticus 27:19, Numbers 2:32, Numbers 4:11, Numbers 18:4, Numbers 21:4, Numbers 21:8, Numbers 23:4, Numbers 25:7, Numbers 28:15, Numbers 32:4, Deuteronomy 4:16, Deuteronomy 4:39, Deuteronomy 15:5, Deuteronomy 19:17, Deuteronomy 32:4, Deuteronomy 33:10, Joshua 6:19, Joshua 10:8, Joshua 21:16, Judges 11:22, Judges 15:4, Judges 16:11, Judges 18:26, Ruth 1:11, Ruth 3:9, 1 Samuel 1:13, 1 Samuel 3:14, 1 Samuel 14:29, 1 Samuel 16:3, 1 Samuel 18:19, 1 Samuel 20:26, 1 Samuel 24:18, 1 Samuel 28:12, 2 Samuel 3:10, 2 Samuel 8:11, 2 Samuel 24:1, 1 Kings 1:40, 1 Kings 2:37, 1 Kings 3:27, 1 Kings 11:10, 1 Kings 15:15, 1 Kings 15:31, 1 Kings 17:20, 1 Kings 18:45, 2 Kings 1:8, 2 Kings 3:22, 2 Kings 4:7, 2 Kings 4:24, 2 Kings 8:23, 2 Kings 14:16, 2 Kings 15:36, 2 Kings 23:28, 2 Kings 25:15, 1 Chronicles 2:18, 1 Chronicles 9:2, 1 Chronicles 9:28, 1 Chronicles 18:1, 1 Chronicles 18:13, 1 Chronicles 19:13, 1 Chronicles 22:15, 1 Chronicles 26:8, 1 Chronicles 26:16, 2 Chronicles 9:10, 2 Chronicles 12:2, 2 Chronicles 12:11, 2 Chronicles 23:4, 2 Chronicles 23:15, 2 Chronicles 32:3, 2 Chronicles 35:1, Nehemiah 5:3, Nehemiah 9:20, Nehemiah 12:28, Nehemiah 12:42, Nehemiah 13:4, Job 42:14, Psalms 20:5, Psalms 22:23, Psalms 28:3, Psalms 37:20, Psalms 111:10, Psalms 148:14, Proverbs 25:13, Proverbs 30:17, Ecclesiastes 1:11, Isaiah 5:9, Isaiah 5:13, Isaiah 13:22, Isaiah 14:26, Isaiah 16:3, Isaiah 25:2, Isaiah 26:17, Isaiah 42:15, Isaiah 46:1, Isaiah 53:6, Isaiah 54:6, Isaiah 59:3, Jeremiah 6:4, Jeremiah 10:3, Jeremiah 10:21, Jeremiah 22:9, Jeremiah 24:2, Jeremiah 31:31, Jeremiah 44:11, Jeremiah 48:5, Jeremiah 48:35, Lamentations 4:4, Lamentations 4:13, Ezekiel 7:2, Ezekiel 20:16, Ezekiel 33:16, Ezekiel 44:28, Ezekiel 47:15, Daniel 2:11, Daniel 4:10, Daniel 6:27, Daniel 11:32, Hosea 4:10, Joel 1:5, Jonah 1:11, Micah 1:14, Micah 2:8, Habakkuk 1:5, Habakkuk 1:15, Zephaniah 1:9, Haggai 1:8, Zechariah 5:2, Zechariah 5:6, Zechariah 7:1, Matthew 4:10, Matthew 6:7, Matthew 7:5, Matthew 8:12, Matthew 12:31, Matthew 15:23, Matthew 15:28, Matthew 16:26, Matthew 19:24, Matthew 25:27, Matthew 25:41, Matthew 26:7, Matthew 26:36, Mark 1:35, Mark 7:25, Mark 9:41, Mark 12:38, Mark 14:68, Mark 15:15, Luke 8:3, Luke 8:33, Luke 11:17, Luke 14:23, Luke 24:33, John 4:36, John 5:23, John 5:29, John 6:35, John 6:39, John 7:17, John 7:26, John 10:24, John 11:50, John 12:47, John 21:12, Acts 8:6, Acts 9:36, Acts 10:9, Acts 15:21, Acts 18:5, Acts 21:7, Acts 22:14, Acts 27:24, Romans 2:3, Romans 3:9, Romans 15:13, 1 Corinthians 7:11, 1 Corinthians 11:18, 2 Corinthians 6:17, Galatians 1:8, Galatians 4:14, Philippians 1:1, Philippians 3:3, Philippians 3:5, 2 Thessalonians 1:7, 2 Timothy 1:3, 2 Timothy 3:6, 2 Timothy 3:16, Philemon 1:13, 1 Peter 3:6, 2 Peter 1:9, 2 Peter 2:19, 1 John 4:9, Revelation 2:11, Revelation 4:9, Revelation 18:15, Genesis 1:31, Genesis 13:8, Genesis 14:9, Genesis 20:11, Genesis 26:25, Genesis 27:4, Genesis 28:17, Genesis 39:15, Genesis 43:26, Genesis 49:7, Exodus 10:11, Exodus 18:20, Exodus 29:35, Exodus 31:10, Exodus 36:15, Exodus 37:8, Exodus 39:23, Exodus 39:43, Leviticus 4:9, Leviticus 7:7, Leviticus 8:14, Leviticus 13:46, Leviticus 15:22, Leviticus 16:3, Leviticus 16:26, Leviticus 22:11, Leviticus 23:16, Leviticus 27:26, Numbers 3:47, Numbers 9:19, Numbers 15:23, Numbers 16:28, Numbers 18:31, Numbers 20:14, Numbers 29:9, Deuteronomy 2:6, Deuteronomy 2:28, Deuteronomy 2:34, Deuteronomy 3:10, Deuteronomy 6:17, Deuteronomy 29:5, Deuteronomy 32:25, Joshua 11:1, Joshua 13:4, Joshua 15:47, Joshua 21:3, Joshua 22:12, Judges 1:4, Judges 5:19, Judges 8:19, Judges 9:9, Judges 10:12, Judges 10:15, Judges 13:2, Judges 15:16, Judges 16:6, Ruth 2:4, 1 Samuel 2:17, 1 Samuel 6:20, 1 Samuel 18:18, 1 Samuel 25:40, 1 Samuel 29:5, 1 Samuel 30:3, 2 Samuel 7:21, 2 Samuel 18:7, 2 Samuel 19:31, 2 Samuel 24:6, 1 Kings 1:32, 1 Kings 2:11, 1 Kings 2:40, 1 Kings 3:17, 1 Kings 4:28, 1 Kings 11:41, 1 Kings 22:27, 2 Kings 4:36, 2 Kings 5:24, 2 Kings 19:11, 2 Kings 25:5, 2 Kings 25:18, 1 Chronicles 6:57, 1 Chronicles 9:9, 1 Chronicles 9:44, 1 Chronicles 10:14, 1 Chronicles 27:30, 2 Chronicles 7:13, 2 Chronicles 17:10, 2 Chronicles 21:1, 2 Chronicles 33:12, Nehemiah 7:1, Nehemiah 11:13, Esther 3:14, Esther 5:3, Esther 6:14, Esther 8:12, Job 24:5, Job 24:18, Psalms 1:1, Psalms 35:4, Psalms 51:19, Psalms 77:2, Psalms 106:47, Proverbs 27:13, Isaiah 5:29, Isaiah 21:11, Isaiah 21:17, Isaiah 24:15, Isaiah 24:22, Isaiah 26:5, Isaiah 30:8, Isaiah 37:11, Isaiah 41:23, Isaiah 43:4, Isaiah 51:19, Isaiah 65:10, Jeremiah 20:1, Jeremiah 23:34, Jeremiah 39:17, Jeremiah 48:28, Jeremiah 49:31, Ezekiel 1:15, Ezekiel 19:7, Ezekiel 20:42, Ezekiel 27:34, Ezekiel 44:10, Daniel 2:15, Daniel 5:14, Amos 7:16, Jonah 1:4, Jonah 4:9, Zechariah 3:10, Zechariah 13:4, Malachi 1:7, Matthew 6:23, Matthew 7:6, Matthew 7:13, Matthew 9:22, Matthew 12:44, Matthew 17:24, Matthew 19:8, Matthew 26:13, Matthew 27:17, Mark 5:33, Mark 6:4, Mark 7:11, Mark 9:35, Mark 9:45, Mark 14:13, Mark 14:27, Luke 5:26, Luke 5:30, Luke 13:11, Luke 13:16, Luke 18:43, Luke 20:26, Luke 22:60, Luke 23:48, Luke 24:5, Luke 24:23, John 3:11, John 6:10, John 11:42, John 11:55, Acts 2:36, Acts 2:37, Acts 14:20, Acts 14:21, Acts 15:16, Acts 23:1, Acts 24:27, Acts 28:3, Romans 9:29, Romans 10:15, Romans 11:8, Romans 14:8, 1 Corinthians 3:18, 1 Corinthians 7:22, 1 Corinthians 9:22, 1 Corinthians 11:17, 1 Corinthians 14:25, 1 Corinthians 14:35, 1 Corinthians 15:41, 2 Corinthians 7:15, Philippians 2:17, Colossians 1:22, Colossians 2:16, 1 Thessalonians 1:1, 1 Thessalonians 4:14, 1 Timothy 4:16, Titus 2:5, Hebrews 4:14, Hebrews 9:22, Hebrews 13:7, James 1:13, Jude 1:1, Revelation 3:21, Revelation 5:1, Revelation 7:12, Revelation 13:16, Revelation 16:5, Revelation 22:3, Genesis 2:2, Genesis 14:16, Genesis 23:2, Genesis 24:37, Genesis 24:41, Genesis 24:61, Genesis 25:9, Genesis 25:21, Genesis 27:15, Genesis 30:2, Genesis 32:12, Genesis 35:5, Genesis 39:19, Exodus 5:23, Exodus 21:32, Exodus 22:14, Exodus 25:11, Exodus 27:2, Leviticus 3:10, Leviticus 3:15, Leviticus 7:9, Leviticus 10:13, Leviticus 11:22, Leviticus 14:4, Leviticus 14:23, Leviticus 14:42, Leviticus 18:11, Leviticus 19:17, Leviticus 27:7, Numbers 4:34, Numbers 9:11, Numbers 14:45, Numbers 15:5, Numbers 16:11, Numbers 35:11, Deuteronomy 6:25, Deuteronomy 9:27, Deuteronomy 16:13, Deuteronomy 17:3, Deuteronomy 22:4, Deuteronomy 23:7, Joshua 9:15, Joshua 10:26, Joshua 22:21, Judges 3:6, Judges 6:3, Judges 6:32, Judges 21:18, Ruth 1:7, Ruth 3:11, Ruth 3:17, 1 Samuel 2:34, 1 Samuel 5:5, 1 Samuel 10:10, 1 Samuel 12:18, 1 Samuel 14:10, 1 Samuel 20:19, 1 Samuel 20:38, 2 Samuel 5:13, 2 Samuel 15:7, 2 Samuel 18:23, 2 Samuel 20:11, 2 Samuel 24:18, 1 Kings 8:61, 1 Kings 10:1, 1 Kings 13:1, 1 Kings 14:18, 1 Kings 14:29, 1 Kings 15:17, 1 Kings 15:25, 1 Kings 16:12, 1 Kings 17:16, 1 Kings 18:34, 1 Kings 19:7, 1 Kings 21:21, 1 Kings 22:12, 2 Kings 3:4, 2 Kings 6:9, 2 Kings 15:6, 2 Kings 17:1, 2 Kings 17:33, 1 Chronicles 2:24, 1 Chronicles 3:19, 1 Chronicles 6:77, 1 Chronicles 9:8, 1 Chronicles 12:29, 1 Chronicles 12:37, 1 Chronicles 15:15, 2 Chronicles 1:15, 2 Chronicles 4:11, 2 Chronicles 7:18, 2 Chronicles 8:7, 2 Chronicles 18:11, 2 Chronicles 30:19, 2 Chronicles 36:3, Ezra 6:1, Nehemiah 3:20, Nehemiah 5:2, Nehemiah 8:5, Nehemiah 9:2, Nehemiah 12:29, Job 10:15, Psalms 31:22, Psalms 39:6, Psalms 48:8, Psalms 50:23, Psalms 59:12, Psalms 68:4, Psalms 133:2, Psalms 142:7, Psalms 143:12, Ecclesiastes 9:14, Song of Solomon 3:10, Isaiah 7:23, Isaiah 13:5, Isaiah 14:32, Isaiah 21:16, Isaiah 33:6, Isaiah 43:17, Isaiah 44:20, Isaiah 48:13, Isaiah 52:9, Isaiah 59:5, Isaiah 59:11, Isaiah 66:11, Jeremiah 1:5, Jeremiah 2:11, Jeremiah 4:13, Jeremiah 6:3, Jeremiah 7:11, Jeremiah 7:27, Jeremiah 18:8, Jeremiah 22:17, Jeremiah 25:4, Jeremiah 44:13, Jeremiah 48:17, Jeremiah 49:26, Jeremiah 51:26, Ezekiel 1:7, Ezekiel 27:15, Ezekiel 29:13, Ezekiel 30:5, Ezekiel 31:3, Ezekiel 31:5, Ezekiel 31:10, Ezekiel 36:25, Ezekiel 39:20, Ezekiel 43:23, Daniel 8:6, Hosea 10:10, Obadiah 1:4, Nahum 2:12, Zechariah 3:1, Zechariah 12:5, Malachi 2:12, Matthew 7:27, Matthew 8:13, Matthew 23:30, Matthew 24:45, Mark 8:1, Mark 9:22, Mark 12:30, Mark 12:44, Mark 16:9, Luke 1:66, Luke 2:39, Luke 4:20, Luke 4:27, Luke 7:19, Luke 7:29, Luke 16:31, Luke 17:10, Luke 18:16, Luke 18:39, Luke 19:43, Luke 23:7, John 4:53, John 8:21, John 8:26, John 11:48, Acts 8:7, Acts 10:7, Acts 11:23, Acts 13:31, Acts 17:19, Acts 17:21, Acts 17:34, Acts 18:7, Acts 21:33, Acts 22:26, Acts 25:20, Acts 26:7, Acts 28:11, Romans 3:26, Romans 8:39, 1 Corinthians 12:8, 1 Corinthians 12:12, 1 Corinthians 12:15, 1 Corinthians 12:24, Galatians 1:6, Galatians 2:17, Ephesians 3:10, Colossians 2:1, 1 Timothy 1:10, 1 Timothy 6:5, 2 Timothy 2:14, Titus 2:12, Hebrews 2:2, Hebrews 4:1, Hebrews 6:10, James 1:6, James 5:20, 1 John 3:23, Jude 1:8, Revelation 9:15, Revelation 14:20, Revelation 16:17, Genesis 10:25, Genesis 17:5, Genesis 22:5, Genesis 23:4, Genesis 24:63, Genesis 27:9, Genesis 27:40, Genesis 31:5, Genesis 31:36, Genesis 31:53, Genesis 36:14, Genesis 39:4, Genesis 40:14, Genesis 44:33, Genesis 47:12, Exodus 13:12, Exodus 16:20, Exodus 18:18, Exodus 20:20, Exodus 21:13, Exodus 32:18, Exodus 34:16, Exodus 34:27, Exodus 38:25, Leviticus 3:4, Leviticus 7:25, Leviticus 9:5, Leviticus 15:20, Leviticus 16:5, Leviticus 19:13, Leviticus 22:14, Leviticus 25:44, Numbers 4:23, Numbers 4:45, Numbers 18:12, Numbers 24:21, Deuteronomy 1:42, Deuteronomy 4:27, Deuteronomy 6:22, Deuteronomy 10:15, Deuteronomy 14:28, Deuteronomy 21:6, Deuteronomy 26:1, Deuteronomy 26:8, Joshua 4:19, Joshua 8:34, Joshua 10:21, Joshua 19:13, Joshua 21:7, Judges 3:2, Judges 21:3, Ruth 2:21, Ruth 3:4, 1 Samuel 1:20, 1 Samuel 4:16, 1 Samuel 9:14, 1 Samuel 15:1, 1 Samuel 25:33, 1 Samuel 28:17, 1 Samuel 29:11, 2 Samuel 2:15, 2 Samuel 2:25, 2 Samuel 23:12, 1 Kings 1:21, 1 Kings 2:35, 2 Kings 4:30, 2 Kings 14:3, 2 Kings 15:21, 2 Kings 20:11, 2 Kings 21:1, 1 Chronicles 3:2, 1 Chronicles 7:9, 1 Chronicles 8:13, 1 Chronicles 27:27, 2 Chronicles 7:16, 2 Chronicles 13:5, Ezra 4:1, Ezra 10:15, Nehemiah 2:15, Esther 6:8, Job 42:10, Psalms 2:12, Psalms 19:4, Psalms 30:5, Psalms 71:20, Psalms 85:8, Psalms 86:17, Psalms 133:3, Proverbs 30:14, Isaiah 7:14, Isaiah 11:3, Isaiah 13:19, Isaiah 41:14, Isaiah 49:2, Isaiah 59:14, Isaiah 64:11, Isaiah 65:14, Isaiah 65:18, Jeremiah 2:35, Jeremiah 3:5, Jeremiah 3:7, Jeremiah 6:13, Jeremiah 25:7, Jeremiah 27:19, Jeremiah 32:39, Jeremiah 35:3, Jeremiah 37:18, Jeremiah 46:13, Jeremiah 51:3, Jeremiah 52:24, Ezekiel 1:19, Ezekiel 13:17, Ezekiel 18:27, Ezekiel 24:3, Ezekiel 27:18, Ezekiel 36:10, Ezekiel 38:18, Ezekiel 39:19, Ezekiel 40:28, Ezekiel 41:5, Ezekiel 41:9, Ezekiel 44:6, Ezekiel 45:14, Daniel 2:8, Daniel 2:34, Daniel 4:20, Daniel 8:9, Daniel 11:44, Hosea 5:7, Hosea 7:14, Joel 1:6, Amos 7:14, Obadiah 1:17, Jonah 3:5, Micah 4:6, Micah 6:15, Micah 7:19, Malachi 3:2, Matthew 5:18, Matthew 6:18, Matthew 10:35, Matthew 10:37, Matthew 12:10, Matthew 12:11, Matthew 16:12, Matthew 18:18, Matthew 23:29, Matthew 24:22, Matthew 25:9, Matthew 25:45, Matthew 26:69, Matthew 27:6, Mark 3:18, Mark 4:38, Mark 6:45, Mark 10:23, Mark 10:35, Mark 11:27, Mark 12:17, Luke 2:37, Luke 5:18, Luke 6:29, Luke 7:28, Luke 8:32, Luke 16:10, John 1:50, John 3:36, John 6:19, John 10:36, John 11:33, John 13:5, John 13:21, John 16:2, John 18:38, Acts 7:58, Acts 13:7, Acts 15:17, Acts 15:39, Acts 17:25, Acts 19:25, Acts 25:25, Romans 5:18, Romans 7:5, Romans 9:3, Romans 9:30, 1 Corinthians 7:25, 1 Corinthians 11:3, 1 Corinthians 15:3, 2 Corinthians 7:5, Galatians 1:16, Galatians 3:22, Philippians 1:14, Philippians 3:21, 1 Thessalonians 4:10, 1 Timothy 6:19, 1 Timothy 6:20, 2 Timothy 2:15, 2 Timothy 2:22, Philemon 1:14, Hebrews 9:8, Hebrews 11:31, Hebrews 11:32, James 4:13, Revelation 1:17, Revelation 3:17, Genesis 2:21, Genesis 6:18, Genesis 12:3, Genesis 14:15, Genesis 18:14, Genesis 20:8, Genesis 28:22, Genesis 29:15, Genesis 31:24, Genesis 32:22, Genesis 41:3, Genesis 41:24, Genesis 41:49, Genesis 41:51, Genesis 45:6, Genesis 46:3, Genesis 47:30, Genesis 49:8, Exodus 1:11, Exodus 12:35, Exodus 14:29, Exodus 16:22, Exodus 23:33, Exodus 24:10, Exodus 32:24, Exodus 35:30, Exodus 36:9, Exodus 40:5, Exodus 40:35, Leviticus 8:9, Leviticus 9:10, Leviticus 15:12, Leviticus 16:32, Leviticus 18:10, Leviticus 18:24, Leviticus 19:29, Leviticus 24:7, Leviticus 25:27, Leviticus 25:41, Leviticus 27:11, Numbers 2:12, Numbers 8:24, Numbers 17:9, Numbers 22:20, Numbers 22:26, Numbers 32:2, Deuteronomy 13:7, Deuteronomy 26:7, Deuteronomy 28:21, Deuteronomy 28:39, Deuteronomy 29:28, Deuteronomy 30:4, Joshua 15:12, Joshua 22:3, Joshua 24:30, Judges 3:13, Judges 8:16, Judges 11:23, 1 Samuel 3:11, 1 Samuel 10:27, 1 Samuel 26:10, 2 Samuel 1:13, 2 Samuel 5:5, 2 Samuel 13:29, 2 Samuel 13:33, 1 Kings 1:20, 1 Kings 7:26, 1 Kings 7:48, 1 Kings 8:22, 1 Kings 10:25, 1 Kings 16:8, 1 Kings 22:16, 2 Kings 15:31, 2 Kings 15:38, 2 Kings 17:28, 2 Kings 18:13, 2 Kings 19:19, 2 Kings 24:5, 1 Chronicles 1:19, 1 Chronicles 4:4, 1 Chronicles 15:26, 1 Chronicles 26:17, 1 Chronicles 26:25, 1 Chronicles 27:6, 2 Chronicles 7:9, 2 Chronicles 18:15, 2 Chronicles 20:29, 2 Chronicles 24:1, 2 Chronicles 28:26, 2 Chronicles 32:24, Nehemiah 4:15, Nehemiah 9:12, Nehemiah 9:13, Job 32:3, Psalms 52:7, Psalms 71:22, Psalms 84:11, Psalms 90:2, Proverbs 19:7, Ecclesiastes 3:18, Ecclesiastes 4:4, Ecclesiastes 9:5, Ecclesiastes 12:9, Isaiah 30:12, Isaiah 35:9, Isaiah 36:1, Isaiah 38:11, Isaiah 51:2, Isaiah 52:10, Jeremiah 2:34, Jeremiah 4:26, Jeremiah 7:16, Jeremiah 8:8, Jeremiah 15:18, Jeremiah 23:27, Jeremiah 27:4, Jeremiah 31:3, Jeremiah 38:26, Jeremiah 51:31, Jeremiah 51:50, Jeremiah 52:9, Lamentations 4:19, Ezekiel 1:23, Ezekiel 2:8, Ezekiel 18:16, Ezekiel 24:7, Ezekiel 27:32, Ezekiel 34:30, Ezekiel 37:10, Ezekiel 46:13, Ezekiel 47:16, Ezekiel 48:16, Daniel 8:15, Daniel 8:26, Daniel 11:12, Hosea 10:4, Joel 1:2, Joel 1:11, Amos 5:19, Jonah 2:2, Habakkuk 3:3, Zechariah 7:10, Malachi 2:3, Matthew 13:5, Matthew 18:7, Matthew 27:42, Matthew 27:60, Mark 10:24, Mark 12:41, Mark 15:16, Mark 15:44, Luke 4:43, Luke 8:2, Luke 12:56, Luke 21:9, Luke 22:11, Luke 22:25, Luke 24:17, Luke 24:32, Luke 24:39, John 4:21, John 6:15, John 6:45, John 7:42, John 8:39, John 19:10, Acts 1:14, Acts 2:6, Acts 2:30, Acts 8:22, Acts 10:24, Acts 12:9, Acts 19:40, Acts 22:13, Acts 25:17, Acts 26:13, Acts 27:20, Acts 28:2, Romans 5:21, Romans 7:2, Romans 7:8, Romans 9:4, Romans 9:5, Romans 10:6, 1 Corinthians 12:17, 1 Corinthians 14:34, 1 Corinthians 15:34, 2 Corinthians 1:11, 2 Corinthians 5:20, 2 Corinthians 9:12, Colossians 1:25, 1 Thessalonians 4:13, Titus 1:5, Philemon 1:7, Hebrews 12:7, Hebrews 13:5, James 4:5, James 4:14, 1 Peter 1:22, 1 John 3:17, Revelation 15:7, Genesis 7:21, Genesis 17:1, Genesis 17:10, Genesis 21:10, Genesis 23:19, Genesis 30:27, Genesis 30:37, Genesis 31:16, Genesis 32:28, Genesis 35:29, Genesis 37:3, Genesis 41:44, Genesis 45:21, Genesis 47:3, Genesis 48:6, Genesis 48:21, Exodus 4:28, Exodus 6:20, Exodus 9:11, Exodus 16:31, Exodus 18:5, Exodus 18:9, Exodus 18:25, Exodus 24:17, Exodus 26:11, Exodus 36:32, Exodus 38:31, Exodus 39:33, Leviticus 13:53, Leviticus 19:16, Leviticus 26:8, Numbers 22:13, Numbers 23:10, Numbers 28:20, Numbers 35:17, Numbers 35:18, Deuteronomy 4:43, Deuteronomy 5:25, Deuteronomy 8:14, Deuteronomy 12:29, Deuteronomy 15:15, Deuteronomy 17:17, Deuteronomy 23:24, Deuteronomy 29:11, Deuteronomy 34:8, Joshua 2:4, Joshua 2:13, Joshua 6:11, Joshua 15:21, Joshua 23:2, Joshua 23:9, Judges 6:38, Judges 8:6, Judges 8:34, Ruth 1:17, 1 Samuel 12:22, 1 Samuel 19:9, 1 Samuel 23:12, 1 Samuel 24:15, 1 Samuel 30:2, 1 Samuel 30:11, 2 Samuel 19:27, 1 Kings 7:24, 1 Kings 8:52, 1 Kings 10:11, 1 Kings 11:9, 1 Kings 13:29, 1 Kings 20:20, 2 Kings 1:15, 2 Kings 3:12, 2 Kings 6:29, 2 Kings 18:34, 1 Chronicles 6:61, 1 Chronicles 9:11, 1 Chronicles 11:14, 2 Chronicles 3:16, 2 Chronicles 18:26, 2 Chronicles 22:10, 2 Chronicles 25:21, 2 Chronicles 33:23, Ezra 1:8, Ezra 4:6, Ezra 10:10, Nehemiah 1:4, Nehemiah 9:36, Esther 1:7, Job 3:6, Job 21:17, Psalms 5:9, Psalms 10:9, Psalms 40:6, Psalms 52:5, Psalms 69:20, Psalms 95:10, Psalms 143:8, Ecclesiastes 6:8, Ecclesiastes 9:6, Song of Solomon 6:6, Isaiah 5:26, Isaiah 7:22, Isaiah 8:22, Isaiah 19:25, Isaiah 23:8, Isaiah 26:20, Isaiah 29:9, Isaiah 46:13, Isaiah 51:10, Isaiah 54:11, Isaiah 59:15, Jeremiah 10:12, Jeremiah 22:8, Jeremiah 23:39, Jeremiah 25:6, Jeremiah 33:14, Jeremiah 36:28, Jeremiah 38:15, Jeremiah 41:13, Jeremiah 50:24, Jeremiah 50:35, Lamentations 4:12, Ezekiel 5:14, Ezekiel 22:19, Ezekiel 27:12, Ezekiel 30:7, Ezekiel 38:23, Ezekiel 43:24, Ezekiel 46:4, Hosea 3:4, Joel 1:20, Jonah 1:13, Nahum 2:2, Zechariah 4:6, Zechariah 14:15, Matthew 18:25, Matthew 26:75, Mark 9:26, Mark 14:58, Mark 15:39, Mark 16:1, Luke 2:51, Luke 5:21, Luke 5:29, Luke 8:22, Luke 8:41, Luke 9:49, Luke 13:35, Luke 19:5, Luke 21:11, Luke 24:10, Luke 24:21, John 9:15, John 9:24, John 12:26, John 16:23, Acts 3:21, Acts 6:14, Acts 10:42, Acts 11:12, Acts 13:36, Acts 21:29, Acts 26:3, Acts 27:41, Romans 4:18, Romans 5:12, Romans 9:25, Romans 14:23, 1 Corinthians 1:20, 1 Corinthians 10:11, 1 Corinthians 12:16, 1 Corinthians 13:12, 1 Corinthians 14:19, 2 Corinthians 8:10, 2 Corinthians 8:14, Galatians 1:14, Ephesians 1:17, Philippians 2:27, Colossians 3:5, 2 Thessalonians 3:14, 2 Timothy 4:10, Titus 1:3, Hebrews 8:13, Hebrews 11:11, Hebrews 12:26, James 3:17, 1 Peter 1:1, 1 Peter 2:21, 1 Peter 4:12, 2 Peter 2:14, 2 Peter 2:15, 2 Peter 3:15, 1 John 2:28, Revelation 13:5, Genesis 24:8, Genesis 28:18, Genesis 32:4, Genesis 34:16, Genesis 37:4, Genesis 40:17, Genesis 41:43, Genesis 44:2, Exodus 4:1, Exodus 9:15, Exodus 18:19, Exodus 19:1, Exodus 19:20, Exodus 29:2, Exodus 29:23, Exodus 30:8, Exodus 36:38, Exodus 39:8, Exodus 39:30, Leviticus 13:36, Leviticus 15:18, Leviticus 18:26, Leviticus 22:9, Leviticus 23:6, Leviticus 25:2, Leviticus 25:49, Numbers 10:11, Numbers 18:27, Numbers 23:11, Numbers 33:9, Deuteronomy 5:32, Deuteronomy 8:11, Deuteronomy 10:3, Deuteronomy 15:21, Deuteronomy 20:16, Deuteronomy 27:19, Deuteronomy 30:13, Deuteronomy 32:2, Deuteronomy 32:6, Joshua 2:7, Joshua 3:14, Joshua 7:18, Joshua 7:23, Joshua 8:27, Joshua 9:19, Joshua 19:22, Joshua 22:15, Joshua 24:4, Ruth 3:16, Ruth 3:18, 1 Samuel 14:2, 1 Samuel 22:19, 1 Samuel 23:20, 1 Samuel 24:19, 1 Samuel 26:2, 1 Samuel 30:9, 2 Samuel 15:22, 2 Samuel 19:2, 2 Samuel 21:13, 1 Kings 3:8, 1 Kings 3:14, 1 Kings 5:12, 1 Kings 6:29, 1 Kings 8:42, 1 Kings 11:1, 1 Kings 13:12, 1 Kings 15:4, 1 Kings 17:21, 1 Kings 22:23, 2 Kings 11:20, 2 Kings 12:17, 2 Kings 15:7, 2 Kings 18:35, 1 Chronicles 8:38, 1 Chronicles 15:13, 2 Chronicles 1:10, 2 Chronicles 21:11, 2 Chronicles 28:19, 2 Chronicles 30:23, Ezra 2:63, Ezra 6:7, Ezra 7:18, Ezra 8:20, Nehemiah 1:1, Nehemiah 9:21, Nehemiah 13:14, Esther 9:20, Job 2:7, Job 36:16, Psalms 5:7, Psalms 7:9, Psalms 28:7, Psalms 39:11, Psalms 43:2, Psalms 59:13, Psalms 71:3, Psalms 72:15, Proverbs 30:19, Song of Solomon 2:7, Song of Solomon 2:13, Song of Solomon 3:5, Song of Solomon 4:10, Song of Solomon 4:11, Isaiah 6:2, Isaiah 16:12, Isaiah 20:3, Isaiah 32:11, Isaiah 33:18, Isaiah 38:15, Isaiah 48:3, Isaiah 50:9, Isaiah 52:4, Isaiah 56:12, Jeremiah 4:9, Jeremiah 4:16, Jeremiah 9:13, Jeremiah 17:20, Jeremiah 17:22, Jeremiah 18:12, Jeremiah 18:13, Jeremiah 22:7, Jeremiah 23:24, Jeremiah 33:8, Jeremiah 41:12, Jeremiah 41:14, Jeremiah 42:21, Jeremiah 48:29, Jeremiah 51:15, Jeremiah 51:43, Jeremiah 52:8, Ezekiel 3:12, Ezekiel 3:14, Ezekiel 7:16, Ezekiel 9:11, Ezekiel 12:14, Ezekiel 17:5, Ezekiel 18:22, Ezekiel 20:14, Ezekiel 20:33, Ezekiel 21:27, Ezekiel 22:14, Ezekiel 23:3, Ezekiel 27:7, Ezekiel 27:31, Ezekiel 27:35, Ezekiel 30:26, Ezekiel 40:23, Ezekiel 40:26, Ezekiel 48:31, Daniel 1:15, Daniel 2:46, Daniel 8:10, Daniel 10:9, Daniel 12:2, Joel 1:7, Joel 3:12, Amos 6:7, Jonah 2:3, Jonah 3:6, Micah 3:9, Micah 6:4, Nahum 3:18, Zephaniah 1:10, Haggai 2:6, Zechariah 1:14, Zechariah 9:16, Matthew 8:8, Matthew 13:57, Matthew 24:14, Matthew 24:15, Matthew 24:24, Matthew 25:22, Mark 1:7, Mark 1:16, Mark 5:42, Mark 7:15, Mark 9:38, Mark 10:52, Mark 14:60, Luke 3:19, Luke 4:6, Luke 9:54, Luke 10:7, Luke 10:19, Luke 11:36, John 18:39, Acts 2:23, Acts 3:22, Acts 4:33, Acts 11:20, Acts 16:36, Acts 17:4, Acts 19:34, Romans 1:7, Romans 5:5, Romans 11:26, Romans 16:7, 1 Corinthians 6:12, 1 Corinthians 8:4, 1 Corinthians 9:9, 1 Corinthians 15:40, 2 Corinthians 10:13, 2 Corinthians 11:15, 2 Corinthians 11:20, Galatians 3:14, Galatians 3:28, Galatians 4:29, Galatians 5:11, Ephesians 2:15, Ephesians 3:8, Colossians 2:5, Colossians 4:9, 1 Timothy 1:13, 1 Timothy 3:13, 2 Timothy 4:1, 2 Timothy 4:18, Hebrews 4:6, Hebrews 7:16, Hebrews 8:3, Hebrews 12:10, Hebrews 13:4, 1 Peter 1:18, 2 Peter 3:1, 2 Peter 3:18, Revelation 16:1, Revelation 18:16, Genesis 13:16, Genesis 15:1, Genesis 17:14, Genesis 20:14, Genesis 23:8, Genesis 29:7, Genesis 31:55, Genesis 35:7, Genesis 43:12, Genesis 46:27, Genesis 50:23, Exodus 8:31, Exodus 9:8, Exodus 23:2, Exodus 30:9, Exodus 34:3, Exodus 39:7, Exodus 39:25, Leviticus 11:29, Leviticus 25:25, Numbers 7:2, Numbers 8:15, Numbers 11:4, Numbers 14:7, Numbers 14:30, Numbers 24:20, Numbers 25:15, Numbers 26:29, Numbers 26:63, Deuteronomy 3:1, Deuteronomy 24:18, Deuteronomy 32:11, Deuteronomy 33:13, Joshua 21:41, Judges 2:3, Judges 4:13, Judges 8:35, Judges 9:23, Judges 9:29, Judges 9:57, Judges 15:10, 1 Samuel 8:22, 1 Samuel 12:6, 1 Samuel 17:2, 1 Samuel 18:1, 1 Samuel 23:22, 1 Samuel 25:11, 1 Samuel 27:12, 1 Samuel 31:2, 2 Samuel 1:22, 2 Samuel 6:6, 2 Samuel 6:18, 2 Samuel 10:12, 2 Samuel 14:29, 2 Samuel 20:23, 1 Kings 2:13, 1 Kings 2:34, 1 Kings 9:13, 1 Kings 12:9, 1 Kings 19:6, 1 Kings 22:49, 2 Kings 5:25, 2 Kings 12:1, 2 Kings 18:28, 2 Kings 25:7, 1 Chronicles 4:40, 1 Chronicles 7:8, 1 Chronicles 10:2, 1 Chronicles 12:2, 1 Chronicles 22:11, 2 Chronicles 5:5, 2 Chronicles 9:24, 2 Chronicles 10:9, 2 Chronicles 17:5, 2 Chronicles 29:28, Nehemiah 11:5, Nehemiah 11:24, Nehemiah 12:46, Nehemiah 13:11, Esther 1:13, Esther 9:17, Esther 9:29, Job 42:15, Psalms 4:1, Psalms 37:28, Psalms 47:9, Psalms 79:2, Psalms 81:7, Psalms 96:10, Psalms 102:26, Ecclesiastes 2:12, Isaiah 5:11, Isaiah 6:1, Isaiah 8:18, Isaiah 10:27, Isaiah 13:9, Isaiah 13:14, Isaiah 24:20, Isaiah 32:15, Isaiah 33:16, Isaiah 42:19, Isaiah 43:6, Isaiah 45:6, Jeremiah 1:13, Jeremiah 6:22, Jeremiah 12:10, Jeremiah 14:7, Jeremiah 23:18, Jeremiah 23:35, Jeremiah 25:28, Jeremiah 34:11, Jeremiah 37:2, Jeremiah 46:22, Jeremiah 50:28, Jeremiah 51:28, Lamentations 4:7, Ezekiel 3:9, Ezekiel 3:11, Ezekiel 16:6, Ezekiel 18:25, Ezekiel 28:14, Ezekiel 32:9, Ezekiel 36:8, Ezekiel 46:6, Ezekiel 48:29, Daniel 1:3, Daniel 8:22, Hosea 7:6, Hosea 13:10, Amos 2:10, Amos 9:15, Micah 1:4, Nahum 3:7, Habakkuk 1:3, Zephaniah 1:8, Haggai 2:17, Zechariah 8:16, Zechariah 14:17, Malachi 2:10, Malachi 4:3, Matthew 10:21, Matthew 17:9, Mark 6:21, Mark 8:19, Mark 13:1, Mark 14:18, Mark 15:20, Mark 15:41, Luke 1:36, Luke 2:22, Luke 4:22, Luke 8:49, Luke 9:36, Luke 9:43, Luke 15:22, Luke 20:35, Luke 22:59, John 6:42, John 8:33, John 12:49, John 19:39, John 21:2, John 21:8, Acts 2:46, Acts 6:12, Acts 9:8, Acts 12:25, Acts 13:6, Acts 16:12, Acts 19:32, Acts 21:32, Acts 24:24, Acts 27:10, Romans 2:27, Romans 7:1, Romans 8:30, Romans 10:20, Romans 12:19, Romans 15:20, 1 Corinthians 4:10, 1 Corinthians 5:7, 1 Corinthians 13:11, Philippians 3:12, Philippians 4:6, Colossians 1:18, 2 Thessalonians 1:12, 1 Timothy 1:3, Hebrews 1:2, Hebrews 2:4, Hebrews 7:1, Hebrews 10:25, Hebrews 11:17, James 1:21, James 2:16, 1 Peter 5:9, Revelation 12:11, Revelation 18:6, Revelation 22:15, Genesis 1:7, Genesis 2:23, Genesis 3:3, Genesis 3:7, Genesis 11:3, Genesis 24:11, Genesis 32:19, Genesis 33:18, Genesis 33:19, Genesis 39:20, Genesis 43:5, Genesis 44:30, Genesis 45:22, Genesis 46:20, Genesis 49:4, Exodus 10:23, Exodus 14:16, Exodus 23:22, Exodus 24:1, Exodus 26:25, Exodus 32:26, Exodus 35:23, Exodus 36:17, Exodus 39:29, Exodus 40:10, Exodus 40:33, Leviticus 14:3, Leviticus 15:29, Leviticus 19:6, Leviticus 23:34, Leviticus 24:14, Numbers 3:8, Numbers 4:46, Numbers 8:11, Numbers 10:22, Numbers 10:35, Numbers 16:32, Numbers 31:48, Deuteronomy 2:23, Deuteronomy 3:6, Deuteronomy 4:29, Deuteronomy 12:25, Deuteronomy 16:7, Deuteronomy 18:5, Deuteronomy 28:40, Deuteronomy 29:7, Joshua 6:16, Joshua 15:18, Joshua 21:43, Joshua 22:34, Joshua 24:9, Judges 1:9, Judges 10:17, Judges 11:3, Judges 14:2, Judges 20:37, 1 Samuel 2:3, 1 Samuel 10:22, 1 Samuel 22:9, 2 Samuel 5:12, 2 Samuel 7:18, 2 Samuel 11:3, 2 Samuel 18:19, 2 Samuel 19:14, 2 Samuel 21:3, 1 Kings 5:18, 1 Kings 8:18, 1 Kings 12:4, 1 Kings 13:17, 1 Kings 21:16, 1 Kings 22:20, 2 Kings 5:27, 2 Kings 7:3, 2 Kings 14:7, 2 Kings 14:26, 2 Kings 15:26, 2 Kings 18:24, 2 Kings 23:18, 2 Kings 25:26, 1 Chronicles 5:14, 1 Chronicles 5:23, 1 Chronicles 8:6, 1 Chronicles 17:16, 1 Chronicles 23:4, 2 Chronicles 6:8, 2 Chronicles 8:15, 2 Chronicles 10:4, 2 Chronicles 13:13, 2 Chronicles 13:14, 2 Chronicles 18:30, 2 Chronicles 27:7, Ezra 2:69, Ezra 7:20, Nehemiah 13:24, Job 31:35, Psalms 15:5, Psalms 18:6, Psalms 45:4, Psalms 68:16, Psalms 68:27, Proverbs 23:35, Ecclesiastes 2:14, Ecclesiastes 8:16, Song of Solomon 5:7, Isaiah 7:18, Isaiah 9:10, Isaiah 19:4, Isaiah 21:1, Isaiah 29:10, Isaiah 34:13, Isaiah 36:9, Isaiah 36:13, Isaiah 36:20, Isaiah 40:21, Isaiah 51:18, Isaiah 52:8, Isaiah 54:3, Isaiah 57:5, Isaiah 63:12, Jeremiah 2:15, Jeremiah 5:12, Jeremiah 9:1, Jeremiah 10:11, Jeremiah 11:15, Jeremiah 25:18, Jeremiah 28:8, Jeremiah 31:6, Jeremiah 36:16, Jeremiah 36:27, Jeremiah 40:16, Jeremiah 43:13, Jeremiah 49:8, Jeremiah 49:24, Jeremiah 51:7, Ezekiel 13:5, Ezekiel 25:17, Ezekiel 31:11, Ezekiel 32:31, Ezekiel 38:9, Ezekiel 42:5, Daniel 3:13, Daniel 6:2, Hosea 8:10, Hosea 11:12, Hosea 14:8, Micah 1:8, Nahum 2:4, Zephaniah 1:14, Zechariah 11:2, Matthew 2:15, Matthew 5:16, Matthew 5:33, Matthew 8:10, Matthew 8:16, Matthew 9:20, Matthew 9:33, Matthew 20:22, Matthew 22:24, Matthew 24:26, Mark 9:5, Mark 12:36, Mark 14:65, Mark 15:29, Luke 3:7, Luke 6:1, Luke 6:22, Luke 19:17, Luke 23:46, John 1:48, John 5:30, John 12:24, John 21:24, Acts 3:6, Acts 7:16, Acts 10:23, Acts 10:39, Acts 12:23, Acts 21:1, Acts 21:37, Acts 21:38, Romans 1:5, Romans 4:9, Romans 11:20, Romans 14:10, Romans 15:24, 1 Corinthians 5:3, 1 Corinthians 7:15, 1 Corinthians 9:16, 1 Corinthians 14:37, 2 Corinthians 1:9, Galatians 1:9, Ephesians 5:14, Philippians 1:18, 1 Thessalonians 5:8, 2 Timothy 3:8, Hebrews 12:22, James 3:2, James 5:15, 1 Peter 2:7, 1 Peter 2:24, 1 John 4:17, Revelation 12:1, Revelation 13:3, Revelation 17:15, Revelation 20:11, Revelation 21:10, Genesis 1:20, Genesis 13:6, Genesis 16:8, Genesis 18:8, Genesis 19:4, Genesis 26:8, Genesis 45:9, Genesis 48:9, Genesis 48:10, Exodus 6:23, Exodus 7:5, Exodus 18:7, Exodus 29:26, Exodus 30:23, Exodus 30:37, Exodus 33:9, Leviticus 11:46, Leviticus 14:40, Leviticus 14:53, Leviticus 15:27, Leviticus 21:17, Leviticus 22:24, Numbers 4:30, Numbers 10:14, Numbers 12:5, Numbers 23:23, Numbers 24:6, Numbers 27:4, Numbers 35:3, Deuteronomy 8:16, Deuteronomy 8:20, Deuteronomy 10:17, Deuteronomy 21:19, Deuteronomy 32:5, Deuteronomy 32:32, Deuteronomy 33:27, Joshua 6:21, Joshua 8:16, Joshua 14:3, Joshua 19:10, Joshua 19:33, Joshua 21:38, Joshua 22:14, Joshua 24:12, Judges 1:25, Judges 3:7, Judges 5:31, Judges 10:7, Judges 11:25, 1 Samuel 8:5, 1 Samuel 8:18, 1 Samuel 10:23, 1 Samuel 17:3, 1 Samuel 20:9, 1 Samuel 25:20, 1 Samuel 26:1, 2 Samuel 3:25, 2 Samuel 3:28, 2 Samuel 6:11, 2 Samuel 12:1, 2 Samuel 12:13, 2 Samuel 16:9, 2 Samuel 18:25, 2 Samuel 21:5, 1 Kings 12:8, 1 Kings 16:33, 2 Kings 15:2, 2 Kings 18:19, 2 Kings 20:18, 1 Chronicles 2:49, 1 Chronicles 7:23, 1 Chronicles 12:3, 1 Chronicles 26:14, 1 Chronicles 29:15, 2 Chronicles 4:8, 2 Chronicles 14:15, 2 Chronicles 17:11, 2 Chronicles 18:22, 2 Chronicles 34:17, Ezra 4:24, Job 7:21, Psalms 35:8, Psalms 53:6, Psalms 65:5, Psalms 79:13, Psalms 103:17, Psalms 131:1, Ecclesiastes 6:10, Ecclesiastes 7:28, Song of Solomon 8:11, Isaiah 5:4, Isaiah 7:6, Isaiah 10:18, Isaiah 24:5, Isaiah 34:5, Isaiah 36:4, Isaiah 37:19, Isaiah 43:12, Isaiah 44:6, Isaiah 44:18, Isaiah 57:16, Isaiah 59:2, Isaiah 65:15, Isaiah 66:22, Jeremiah 16:12, Jeremiah 31:38, Jeremiah 32:1, Jeremiah 46:18, Jeremiah 51:55, Lamentations 1:19, Ezekiel 12:22, Ezekiel 13:7, Ezekiel 17:13, Ezekiel 41:8, Ezekiel 48:33, Daniel 2:4, Daniel 2:29, Daniel 11:45, Daniel 12:4, Amos 3:5, Amos 4:4, Amos 4:6, Obadiah 1:15, Nahum 2:11, Zechariah 6:1, Malachi 2:9, Matthew 2:23, Matthew 7:21, Matthew 9:10, Matthew 13:31, Matthew 19:17, Matthew 20:12, Matthew 26:71, Matthew 28:2, Mark 1:13, Mark 15:21, Luke 7:34, Luke 11:52, Luke 15:17, Luke 17:22, Luke 23:11, John 15:2, Acts 4:34, Acts 21:27, Romans 2:12, Romans 9:8, Romans 10:9, Romans 11:2, Romans 11:28, 1 Corinthians 2:13, 1 Corinthians 4:15, Galatians 3:13, Ephesians 1:3, 1 Thessalonians 3:13, 1 Thessalonians 4:9, 1 Timothy 2:7, Hebrews 3:6, Hebrews 11:3, James 4:2, 1 John 5:1, Jude 1:14, Revelation 3:14, Revelation 13:1, Revelation 18:4, Revelation 22:14, Genesis 2:4, Genesis 7:2, Genesis 25:22, Genesis 26:15, Genesis 31:38, Genesis 32:7, Exodus 2:15, Exodus 3:9, Exodus 4:15, Exodus 8:28, Exodus 13:2, Exodus 16:33, Exodus 22:16, Exodus 22:31, Exodus 26:8, Exodus 27:3, Exodus 33:17, Exodus 35:1, Exodus 36:36, Leviticus 1:12, Leviticus 19:36, Leviticus 20:9, Leviticus 26:4, Numbers 3:10, Numbers 5:3, Numbers 12:4, Numbers 12:6, Numbers 14:25, Numbers 19:14, Numbers 22:28, Numbers 35:12, Numbers 35:34, Deuteronomy 1:4, Deuteronomy 1:44, Deuteronomy 12:26, Deuteronomy 17:18, Deuteronomy 18:9, Deuteronomy 27:20, Deuteronomy 28:26, Deuteronomy 32:38, Deuteronomy 33:12, Joshua 2:21, Joshua 11:19, Judges 1:31, Judges 4:24, Judges 5:17, Judges 9:1, Judges 11:24, Judges 12:15, Judges 18:29, Ruth 2:8, 1 Samuel 18:4, 1 Samuel 19:1, 1 Samuel 21:4, 1 Samuel 23:24, 1 Samuel 24:7, 1 Samuel 25:30, 2 Samuel 2:7, 2 Samuel 6:10, 2 Samuel 12:28, 2 Samuel 13:24, 2 Samuel 14:16, 2 Samuel 24:7, 1 Kings 1:34, 1 Kings 4:25, 1 Kings 17:17, 2 Kings 5:21, 2 Kings 9:33, 2 Kings 9:37, 2 Kings 14:19, 2 Kings 15:17, 2 Kings 15:23, 2 Kings 16:13, 2 Kings 19:18, 2 Kings 23:7, 2 Kings 24:1, 1 Chronicles 1:32, 1 Chronicles 16:42, 1 Chronicles 17:19, 1 Chronicles 22:10, 2 Chronicles 2:18, 2 Chronicles 4:3, 2 Chronicles 7:8, 2 Chronicles 10:8, 2 Chronicles 12:3, 2 Chronicles 13:19, 2 Chronicles 17:7, Ezra 4:20, Nehemiah 4:3, Nehemiah 7:45, Job 1:1, Psalms 27:5, Psalms 35:15, Psalms 42:11, Psalms 43:5, Psalms 59:5, Psalms 71:24, Psalms 98:3, Psalms 125:3, Isaiah 1:2, Isaiah 2:11, Isaiah 3:8, Isaiah 16:6, Isaiah 20:1, Isaiah 22:22, Isaiah 23:12, Isaiah 25:5, Isaiah 25:10, Isaiah 26:15, Isaiah 28:9, Isaiah 30:21, Isaiah 34:15, Isaiah 43:19, Isaiah 44:2, Isaiah 52:14, Isaiah 59:18, Jeremiah 2:3, Jeremiah 2:5, Jeremiah 3:3, Jeremiah 19:1, Jeremiah 30:20, Jeremiah 49:7, Jeremiah 51:36, Ezekiel 1:20, Ezekiel 3:25, Ezekiel 9:1, Ezekiel 17:10, Ezekiel 19:11, Ezekiel 21:32, Ezekiel 40:9, Ezekiel 48:20, Daniel 2:26, Daniel 3:17, Daniel 3:20, Daniel 12:6, Amos 2:15, Zephaniah 2:13, Zechariah 10:9, Matthew 3:10, Matthew 22:10, Matthew 25:32, Matthew 26:17, Mark 4:8, Mark 5:35, Mark 9:9, Mark 13:2, Luke 6:7, Luke 8:15, Luke 8:45, Luke 14:5, Luke 15:27, Luke 16:16, Luke 18:20, Luke 19:47, Luke 20:1, John 1:42, John 6:24, John 8:6, John 18:10, Acts 6:3, Acts 17:17, Acts 22:11, Acts 23:14, Acts 25:8, Romans 8:27, 1 Corinthians 2:9, 1 Corinthians 6:2, 1 Corinthians 6:16, 1 Corinthians 7:17, 1 Corinthians 7:29, 1 Corinthians 9:18, 1 Corinthians 16:19, 2 Corinthians 4:11, Galatians 5:13, Philippians 3:4, Colossians 2:20, James 2:25, 1 John 3:24, 1 John 5:9, Jude 1:16, Revelation 1:16, Revelation 3:20, Revelation 4:3, Revelation 6:2, Revelation 11:8, Genesis 4:17, Genesis 7:13, Genesis 12:16, Genesis 15:9, Genesis 27:38, Genesis 31:50, Genesis 34:12, Genesis 36:35, Genesis 41:40, Genesis 42:2, Genesis 42:37, Exodus 9:34, Exodus 22:30, Exodus 23:21, Exodus 32:2, Exodus 32:10, Exodus 36:37, Leviticus 13:8, Leviticus 20:12, Leviticus 20:22, Leviticus 25:22, Leviticus 26:20, Leviticus 26:37, Leviticus 27:5, Numbers 4:5, Numbers 9:12, Numbers 27:8, Numbers 28:31, Deuteronomy 4:30, Deuteronomy 5:26, Deuteronomy 7:10, Deuteronomy 9:2, Deuteronomy 10:5, Deuteronomy 19:10, Deuteronomy 23:10, Deuteronomy 24:21, Deuteronomy 32:41, Joshua 4:12, Joshua 8:26, Joshua 9:16, Joshua 11:4, Joshua 18:10, Judges 3:1, Judges 7:16, Judges 8:14, Judges 16:26, Ruth 2:23, 1 Samuel 5:6, 1 Samuel 7:12, 1 Samuel 17:5, 1 Samuel 19:8, 1 Samuel 29:2, 2 Samuel 11:12, 2 Samuel 11:17, 1 Kings 7:40, 1 Kings 15:33, 2 Kings 5:2, 2 Kings 12:15, 2 Kings 21:18, 1 Chronicles 1:46, 1 Chronicles 12:32, 1 Chronicles 28:6, 2 Chronicles 1:9, 2 Chronicles 6:25, 2 Chronicles 7:19, 2 Chronicles 13:18, 2 Chronicles 21:15, Nehemiah 9:1, Nehemiah 9:38, Nehemiah 12:8, Job 1:15, Psalms 25:7, Psalms 55:12, Psalms 99:6, Psalms 127:1, Proverbs 8:29, Isaiah 7:19, Isaiah 18:3, Isaiah 29:17, Isaiah 56:10, Isaiah 58:1, Jeremiah 7:33, Jeremiah 10:2, Jeremiah 10:22, Jeremiah 13:6, Jeremiah 25:38, Jeremiah 39:6, Jeremiah 43:1, Jeremiah 49:9, Lamentations 4:3, Lamentations 4:10, Ezekiel 4:8, Ezekiel 5:8, Ezekiel 9:5, Ezekiel 13:16, Ezekiel 21:10, Ezekiel 23:47, Ezekiel 25:12, Daniel 2:21, Daniel 7:28, Daniel 10:21, Hosea 3:3, Hosea 10:9, Hosea 13:13, Joel 2:14, Amos 8:3, Micah 4:12, Zechariah 5:11, Zechariah 12:2, Malachi 3:14, Matthew 16:4, Matthew 16:17, Matthew 18:15, Matthew 23:18, Matthew 26:63, Mark 3:27, Mark 13:12, Luke 2:21, Luke 2:38, Luke 3:9, Luke 8:51, Luke 10:11, Luke 13:2, Luke 16:18, Luke 21:6, Luke 23:33, Luke 24:29, John 1:14, John 6:53, John 8:7, John 10:1, John 15:4, John 15:6, John 16:20, John 18:22, John 19:21, John 20:31, Acts 2:29, Acts 4:25, Acts 5:2, Acts 9:38, Acts 14:1, Acts 18:15, Acts 20:38, Acts 25:9, Acts 28:13, Romans 1:4, Romans 7:23, Romans 8:35, Romans 10:18, Romans 14:5, 1 Corinthians 2:6, 1 Corinthians 3:3, 1 Corinthians 7:39, 2 Corinthians 1:19, 2 Corinthians 3:13, 1 Timothy 1:4, 2 Timothy 2:10, 2 Timothy 2:20, Hebrews 5:1, Hebrews 5:14, Hebrews 10:5, James 2:18, 2 Peter 2:18, 1 John 3:9, Revelation 12:5, Genesis 18:24, Genesis 24:44, Genesis 25:13, Genesis 25:26, Genesis 27:19, Genesis 28:9, Genesis 30:3, Genesis 38:28, Genesis 41:21, Genesis 41:54, Genesis 47:27, Genesis 49:9, Genesis 49:15, Genesis 50:20, Exodus 9:6, Exodus 9:18, Exodus 10:21, Exodus 14:22, Exodus 19:8, Exodus 26:29, Exodus 37:1, Leviticus 4:10, Leviticus 9:19, Leviticus 11:13, Leviticus 11:21, Leviticus 13:7, Leviticus 20:14, Leviticus 22:23, Leviticus 25:8, Leviticus 25:55, Numbers 7:9, Numbers 10:2, Numbers 15:20, Numbers 23:27, Numbers 32:14, Deuteronomy 3:3, Deuteronomy 3:19, Deuteronomy 4:3, Deuteronomy 4:20, Deuteronomy 4:31, Deuteronomy 5:27, Deuteronomy 21:3, Deuteronomy 23:19, Deuteronomy 28:61, Deuteronomy 29:10, Deuteronomy 32:7, Joshua 8:5, Joshua 23:3, Judges 9:6, Judges 13:11, Judges 18:23, Judges 21:16, Ruth 4:14, 1 Samuel 1:2, 1 Samuel 13:16, 1 Samuel 14:26, 1 Samuel 23:4, 1 Samuel 25:37, 2 Samuel 2:27, 2 Samuel 2:29, 2 Samuel 3:19, 2 Samuel 5:23, 2 Samuel 11:24, 2 Samuel 12:5, 2 Samuel 15:35, 1 Kings 1:8, 1 Kings 1:33, 1 Kings 15:24, 1 Kings 16:5, 1 Kings 18:7, 2 Kings 1:4, 2 Kings 3:1, 2 Kings 8:15, 2 Kings 15:28, 2 Kings 23:10, 1 Chronicles 2:21, 1 Chronicles 5:25, 1 Chronicles 17:13, 1 Chronicles 27:16, 2 Chronicles 2:16, 2 Chronicles 17:14, 2 Chronicles 35:6, 2 Chronicles 35:10, 2 Chronicles 35:11, Ezra 4:14, Ezra 10:5, Nehemiah 6:2, Nehemiah 6:12, Job 26:14, Psalms 39:5, Psalms 45:7, Psalms 135:7, Proverbs 6:3, Song of Solomon 8:1, Isaiah 2:17, Isaiah 11:9, Isaiah 18:4, Isaiah 30:10, Isaiah 38:14, Isaiah 40:4, Isaiah 65:5, Jeremiah 7:12, Jeremiah 15:4, Jeremiah 48:26, Jeremiah 50:11, Ezekiel 3:17, Ezekiel 17:17, Ezekiel 20:24, Ezekiel 25:15, Daniel 12:11, Hosea 6:4, Amos 3:1, Amos 6:12, Micah 2:7, Zephaniah 2:4, Zephaniah 2:8, Zechariah 2:6, Zechariah 8:4, Malachi 3:18, Matthew 8:26, Matthew 12:1, Matthew 13:12, Matthew 17:17, Matthew 22:21, Matthew 25:29, Matthew 26:65, Mark 2:14, Mark 5:30, Mark 14:70, Mark 15:34, Luke 1:19, Luke 2:27, Luke 5:7, Luke 8:16, Luke 10:24, Luke 11:39, Luke 13:17, Luke 23:29, John 6:26, John 15:5, John 17:23, John 18:26, John 20:13, John 21:11, Acts 5:38, Acts 8:13, Acts 16:19, Acts 16:34, Acts 19:1, Acts 20:15, Acts 21:4, Acts 25:21, Romans 1:26, Romans 8:4, Romans 10:3, Romans 16:18, Romans 16:19, 1 Corinthians 2:12, 1 Corinthians 6:15, 1 Corinthians 6:18, 2 Corinthians 1:17, 2 Corinthians 2:10, 2 Corinthians 5:11, 2 Corinthians 8:2, 2 Corinthians 11:3, Galatians 6:13, Galatians 6:14, Ephesians 3:5, Colossians 1:10, Colossians 2:11, 1 Timothy 1:15, 1 Timothy 3:2, Hebrews 2:3, 1 Peter 3:9, 1 Peter 3:12, 2 Peter 2:3, Revelation 2:27, Revelation 6:16, Revelation 11:1, Revelation 15:6, Revelation 16:3, Revelation 16:12, Genesis 6:16, Genesis 7:1, Genesis 16:13, Genesis 19:20, Genesis 19:31, Genesis 21:32, Genesis 22:14, Genesis 24:16, Genesis 25:16, Genesis 26:34, Genesis 27:20, Genesis 31:54, Genesis 32:5, Genesis 38:23, Genesis 38:26, Exodus 2:6, Exodus 16:6, Exodus 18:16, Exodus 25:19, Exodus 26:2, Exodus 26:24, Exodus 28:25, Leviticus 3:6, Leviticus 7:35, Leviticus 13:17, Leviticus 14:44, Leviticus 15:7, Leviticus 20:4, Leviticus 20:27, Numbers 10:8, Numbers 12:10, Numbers 13:3, Numbers 21:33, Numbers 22:25, Numbers 22:27, Numbers 24:7, Numbers 31:21, Numbers 33:2, Deuteronomy 4:14, Deuteronomy 4:15, Deuteronomy 4:37, Deuteronomy 9:15, Deuteronomy 28:62, Deuteronomy 32:15, Joshua 13:13, Judges 2:9, Judges 8:8, Judges 8:22, Judges 11:38, Judges 19:4, Judges 20:22, Judges 21:7, Ruth 2:6, 1 Samuel 3:1, 1 Samuel 14:32, 1 Samuel 15:21, 1 Samuel 16:4, 1 Samuel 19:23, 1 Samuel 20:37, 1 Samuel 25:41, 1 Samuel 28:24, 2 Samuel 4:6, 1 Kings 8:27, 1 Kings 16:20, 1 Kings 19:9, 1 Kings 21:18, 1 Kings 21:27, 2 Kings 5:10, 2 Kings 6:6, 2 Kings 14:8, 2 Kings 17:25, 2 Kings 18:10, 2 Kings 25:21, 1 Chronicles 4:27, 1 Chronicles 4:33, 1 Chronicles 6:76, 1 Chronicles 11:6, 1 Chronicles 16:4, 1 Chronicles 19:12, 1 Chronicles 21:21, 1 Chronicles 29:16, 2 Chronicles 1:6, 2 Chronicles 2:11, 2 Chronicles 26:3, Ezra 5:15, Nehemiah 3:17, Nehemiah 6:13, Nehemiah 9:23, Esther 2:13, Job 14:13, Job 34:10, Psalms 39:12, Psalms 96:13, Psalms 144:2, Ecclesiastes 5:15, Song of Solomon 1:8, Song of Solomon 3:2, Song of Solomon 4:9, Isaiah 1:24, Isaiah 9:20, Isaiah 25:1, Isaiah 33:9, Isaiah 42:14, Isaiah 45:24, Isaiah 66:15, Jeremiah 4:1, Jeremiah 5:31, Jeremiah 12:15, Jeremiah 22:10, Jeremiah 28:12, Jeremiah 29:28, Jeremiah 32:17, Jeremiah 32:25, Jeremiah 42:22, Jeremiah 49:18, Ezekiel 1:22, Ezekiel 12:27, Ezekiel 16:33, Ezekiel 26:21, Ezekiel 27:33, Ezekiel 35:8, Ezekiel 37:8, Ezekiel 44:23, Ezekiel 48:12, Daniel 2:14, Daniel 6:5, Daniel 8:19, Hosea 7:4, Matthew 13:36, Matthew 17:15, Matthew 24:38, Matthew 25:10, Matthew 26:58, Mark 7:18, Luke 2:44, Luke 5:33, Luke 8:5, Luke 15:9, John 1:15, John 8:9, Acts 5:12, Acts 7:60, Acts 11:17, Acts 13:47, Acts 17:27, Acts 18:17, Acts 21:3, Acts 24:22, Acts 26:2, Romans 1:16, Romans 7:25, Romans 9:22, Romans 14:22, 1 Corinthians 15:32, 2 Corinthians 2:17, 2 Corinthians 9:8, Galatians 4:24, Ephesians 1:21, Ephesians 3:6, Philippians 1:28, 2 Thessalonians 1:5, Titus 1:15, Hebrews 1:9, Hebrews 3:3, Hebrews 3:10, Hebrews 7:25, 2 Peter 1:10, Revelation 3:4, Revelation 6:1, Revelation 8:11, Revelation 12:16, Revelation 18:14, Revelation 19:4, Revelation 22:5, Genesis 8:20, Genesis 31:27, Genesis 33:17, Genesis 41:34, Genesis 45:26, Genesis 46:32, Exodus 11:2, Exodus 20:22, Exodus 21:4, Exodus 22:8, Exodus 23:24, Exodus 25:12, Exodus 26:36, Exodus 33:3, Exodus 38:3, Leviticus 4:15, Leviticus 10:18, Leviticus 13:10, Leviticus 19:18, Leviticus 25:52, Numbers 7:85, Numbers 16:2, Numbers 16:39, Numbers 21:29, Numbers 26:42, Numbers 32:32, Numbers 33:4, Deuteronomy 1:43, Deuteronomy 2:31, Deuteronomy 4:2, Deuteronomy 13:4, Deuteronomy 22:15, Deuteronomy 32:30, Joshua 13:14, Joshua 18:1, Joshua 21:20, Judges 1:24, Judges 4:16, Judges 6:15, Judges 6:18, Judges 7:6, Judges 12:2, Judges 16:7, Judges 20:30, 1 Samuel 1:7, 1 Samuel 2:19, 1 Samuel 15:17, 1 Samuel 17:34, 2 Samuel 1:16, 2 Samuel 3:24, 2 Samuel 3:34, 2 Samuel 7:25, 2 Samuel 11:15, 2 Samuel 19:32, 1 Kings 1:37, 1 Kings 1:48, 1 Kings 10:17, 1 Kings 13:9, 2 Kings 6:8, 2 Kings 12:16, 2 Kings 19:22, 1 Chronicles 17:5, 1 Chronicles 22:12, 1 Chronicles 24:5, 1 Chronicles 26:21, 1 Chronicles 28:17, 2 Chronicles 9:16, 2 Chronicles 13:15, 2 Chronicles 15:5, Nehemiah 1:7, Esther 8:2, Esther 9:4, Job 1:18, Psalms 14:7, Psalms 62:9, Psalms 89:19, Ecclesiastes 7:18, Ecclesiastes 9:10, Song of Solomon 2:9, Song of Solomon 7:13, Isaiah 14:31, Isaiah 22:13, Isaiah 22:14, Isaiah 22:24, Isaiah 28:27, Isaiah 28:28, Isaiah 33:21, Isaiah 34:1, Isaiah 54:16, Jeremiah 4:28, Jeremiah 12:9, Jeremiah 13:4, Jeremiah 17:21, Jeremiah 32:21, Jeremiah 37:1, Jeremiah 41:11, Jeremiah 48:39, Jeremiah 51:24, Jeremiah 52:27, Ezekiel 16:15, Ezekiel 21:11, Ezekiel 22:3, Ezekiel 23:18, Ezekiel 26:3, Ezekiel 36:19, Ezekiel 39:1, Ezekiel 45:13, Daniel 4:3, Daniel 11:33, Hosea 9:16, Amos 8:12, Zechariah 1:3, Zechariah 2:8, Zechariah 11:3, Zechariah 12:13, Malachi 1:2, Matthew 4:16, Matthew 26:26, Mark 1:5, Mark 13:20, Luke 12:39, Luke 13:33, Luke 14:18, Luke 16:7, Luke 17:20, Luke 22:10, John 1:51, John 3:19, John 5:20, John 9:18, John 13:12, John 13:38, John 14:23, Acts 1:18, Acts 1:19, Acts 5:16, Acts 7:49, Acts 8:36, Acts 9:15, Acts 14:23, Acts 16:9, Acts 20:6, Romans 13:13, 2 Corinthians 4:13, 2 Corinthians 10:14, 1 Thessalonians 2:12, 1 Thessalonians 3:4, 1 Timothy 1:7, 2 Timothy 1:8, Philemon 1:6, Hebrews 11:35, Hebrews 13:20, Jude 1:13, Revelation 11:7, Revelation 11:12, Genesis 1:2, Genesis 6:5, Genesis 8:5, Genesis 14:24, Genesis 16:12, Genesis 19:12, Genesis 32:25, Genesis 36:40, Genesis 42:22, Genesis 42:24, Genesis 43:15, Genesis 43:30, Genesis 45:8, Genesis 46:12, Exodus 6:8, Exodus 9:9, Exodus 16:9, Exodus 22:3, Exodus 26:6, Exodus 26:31, Exodus 27:20, Exodus 35:5, Exodus 39:18, Leviticus 6:6, Leviticus 14:24, Leviticus 17:8, Leviticus 17:12, Leviticus 23:8, Numbers 1:45, Numbers 3:35, Numbers 14:10, Numbers 14:27, Numbers 21:2, Numbers 26:64, Numbers 28:7, Numbers 34:3, Numbers 35:4, Deuteronomy 18:12, Deuteronomy 25:18, Deuteronomy 32:50, Joshua 13:22, Joshua 14:11, Joshua 15:6, Joshua 21:10, Joshua 22:2, Joshua 22:24, Joshua 23:1, Joshua 24:3, Joshua 24:18, Judges 8:28, Judges 10:4, Judges 19:2, Ruth 1:9, 1 Samuel 1:9, 1 Samuel 9:1, 1 Samuel 19:2, 1 Samuel 23:3, 1 Samuel 23:10, 2 Samuel 13:19, 2 Samuel 23:4, 1 Kings 5:11, 1 Kings 16:4, 1 Kings 16:23, 2 Kings 11:5, 2 Kings 15:24, 2 Kings 15:27, 2 Kings 21:15, 1 Chronicles 6:62, 1 Chronicles 13:8, 1 Chronicles 14:2, 1 Chronicles 16:37, 1 Chronicles 17:25, 1 Chronicles 27:32, 2 Chronicles 4:16, 2 Chronicles 34:20, Ezra 7:15, Nehemiah 2:2, Nehemiah 12:26, Esther 7:10, Job 2:13, Job 31:34, Psalms 12:5, Psalms 71:18, Psalms 101:6, Ecclesiastes 8:1, Isaiah 5:20, Isaiah 22:3, Isaiah 23:11, Isaiah 32:7, Isaiah 37:23, Isaiah 44:21, Isaiah 48:21, Jeremiah 1:10, Jeremiah 15:17, Jeremiah 16:21, Jeremiah 22:21, Jeremiah 31:36, Jeremiah 32:33, Jeremiah 51:14, Ezekiel 16:16, Ezekiel 18:29, Ezekiel 27:22, Ezekiel 35:10, Ezekiel 37:24, Daniel 1:17, Daniel 2:27, Daniel 4:22, Daniel 7:22, Amos 1:2, Micah 3:12, Nahum 3:3, Haggai 2:7, Zechariah 13:1, Malachi 2:5, Matthew 7:25, Matthew 12:29, Matthew 12:39, Matthew 23:4, Matthew 25:26, Matthew 27:40, Mark 3:22, Mark 4:24, Mark 6:25, Mark 8:27, Luke 6:34, Luke 12:10, Luke 12:27, Luke 20:17, Luke 23:25, John 8:12, John 8:42, John 17:26, Acts 20:18, Acts 23:5, Acts 26:23, Acts 28:20, Romans 2:29, Romans 6:22, Romans 7:18, Romans 11:1, Romans 14:15, Romans 15:18, 1 Corinthians 7:35, 2 Corinthians 6:14, Galatians 4:15, Galatians 5:10, Ephesians 1:13, Ephesians 6:21, 1 Timothy 3:15, 1 Timothy 4:3, 1 Timothy 6:16, Philemon 1:16, Hebrews 11:9, Hebrews 11:34, Hebrews 12:23, James 5:14, 1 Peter 1:11, 2 Peter 2:8, 1 John 4:18, Revelation 5:12, Revelation 9:1, Revelation 14:1, Revelation 16:9, Genesis 2:7, Genesis 24:22, Genesis 31:34, Genesis 34:19, Genesis 34:22, Genesis 36:7, Genesis 37:17, Genesis 38:8, Genesis 40:16, Genesis 45:4, Genesis 49:11, Genesis 49:24, Exodus 1:7, Exodus 4:5, Exodus 4:25, Exodus 19:2, Exodus 23:5, Exodus 33:2, Exodus 35:25, Leviticus 4:8, Leviticus 4:24, Leviticus 7:2, Leviticus 11:26, Leviticus 13:11, Leviticus 14:11, Leviticus 20:6, Numbers 3:40, Numbers 11:29, Numbers 14:16, Numbers 15:31, Numbers 16:18, Numbers 16:37, Numbers 18:13, Numbers 23:9, Numbers 23:21, Numbers 33:1, Numbers 36:12, Deuteronomy 4:13, Deuteronomy 9:14, Deuteronomy 11:12, Deuteronomy 15:4, Deuteronomy 23:23, Joshua 1:18, Joshua 9:17, Joshua 11:10, Joshua 20:3, Joshua 21:11, Judges 1:14, Judges 5:16, Judges 10:10, Judges 19:28, 1 Samuel 4:7, 1 Samuel 9:8, 1 Samuel 16:12, 1 Samuel 17:7, 1 Samuel 24:16, 1 Samuel 25:15, 1 Samuel 28:22, 2 Samuel 1:23, 2 Samuel 1:26, 2 Samuel 2:10, 2 Samuel 3:3, 2 Samuel 6:7, 2 Samuel 10:4, 2 Samuel 17:22, 2 Samuel 19:39, 2 Samuel 24:15, 1 Kings 1:3, 1 Kings 1:23, 1 Kings 7:38, 1 Kings 8:15, 1 Kings 14:7, 1 Kings 16:18, 1 Kings 18:1, 1 Kings 18:32, 1 Kings 22:50, 2 Kings 10:14, 2 Kings 14:2, 2 Kings 14:24, 2 Kings 14:27, 2 Kings 19:16, 2 Kings 25:14, 1 Chronicles 6:70, 1 Chronicles 11:5, 1 Chronicles 13:10, 2 Chronicles 6:4, 2 Chronicles 10:7, 2 Chronicles 18:34, 2 Chronicles 30:26, 2 Chronicles 30:27, 2 Chronicles 33:9, Ezra 3:4, Nehemiah 7:2, Nehemiah 12:23, Esther 1:15, Esther 4:13, Psalms 16:4, Psalms 22:29, Psalms 23:4, Psalms 39:1, Psalms 50:21, Psalms 65:9, Psalms 78:38, Ecclesiastes 2:24, Ecclesiastes 7:12, Ecclesiastes 12:6, Song of Solomon 4:2, Song of Solomon 8:7, Isaiah 1:15, Isaiah 12:2, Isaiah 14:30, Isaiah 17:14, Isaiah 19:14, Isaiah 30:25, Isaiah 39:8, Isaiah 41:11, Isaiah 41:20, Isaiah 42:1, Isaiah 46:3, Isaiah 51:5, Isaiah 51:7, Isaiah 52:11, Isaiah 53:9, Isaiah 54:8, Isaiah 63:14, Isaiah 66:18, Jeremiah 2:26, Jeremiah 2:37, Jeremiah 8:9, Jeremiah 9:21, Jeremiah 17:16, Jeremiah 19:8, Jeremiah 22:24, Jeremiah 27:12, Jeremiah 50:14, Jeremiah 50:25, Jeremiah 52:34, Lamentations 4:20, Ezekiel 6:8, Ezekiel 14:14, Ezekiel 15:4, Ezekiel 21:23, Ezekiel 24:24, Ezekiel 32:13, Ezekiel 33:7, Ezekiel 39:21, Ezekiel 43:21, Amos 4:8, Jonah 2:6, Jonah 3:3, Micah 6:6, Habakkuk 3:14, Zechariah 1:1, Zechariah 6:6, Malachi 2:7, Malachi 4:2, Matthew 13:27, Matthew 16:27, Matthew 18:16, Luke 1:3, Luke 11:34, Luke 15:7, Luke 15:8, Luke 20:9, John 6:11, John 7:12, John 10:33, John 11:9, John 18:31, John 20:27, Acts 1:3, Acts 8:25, Acts 15:4, Acts 16:10, Acts 20:13, Acts 21:16, Romans 1:18, Romans 1:25, Romans 2:4, Romans 9:27, Romans 13:11, 2 Corinthians 9:3, 2 Corinthians 10:7, 2 Corinthians 12:2, Philippians 3:13, 1 Thessalonians 2:4, Titus 1:6, Titus 1:7, Hebrews 9:2, James 2:23, 1 John 1:7, Revelation 9:19, Revelation 13:18, Revelation 16:10, Revelation 22:18, Genesis 6:19, Genesis 28:20, Genesis 29:8, Genesis 35:10, Genesis 35:14, Genesis 35:22, Genesis 36:2, Genesis 37:13, Genesis 39:22, Exodus 5:16, Exodus 14:8, Exodus 15:2, Exodus 15:20, Exodus 26:27, Exodus 27:1, Exodus 32:30, Exodus 34:25, Exodus 38:15, Leviticus 4:6, Leviticus 8:11, Numbers 22:8, Numbers 22:35, Numbers 32:5, Numbers 34:12, Deuteronomy 8:7, Deuteronomy 9:6, Deuteronomy 13:14, Deuteronomy 17:5, Deuteronomy 23:3, Deuteronomy 25:1, Deuteronomy 28:59, Deuteronomy 30:18, Deuteronomy 31:26, Joshua 9:23, Joshua 11:2, Joshua 11:11, Joshua 13:29, Judges 4:19, Judges 6:4, Judges 8:12, Judges 13:1, 1 Samuel 9:9, 1 Samuel 14:37, 1 Samuel 14:50, 1 Samuel 19:18, 2 Samuel 6:5, 2 Samuel 15:4, 1 Kings 3:4, 1 Kings 9:20, 1 Kings 11:19, 1 Kings 18:6, 2 Kings 3:2, 2 Kings 3:20, 2 Kings 8:19, 2 Kings 9:13, 2 Kings 23:9, 2 Kings 23:20, 1 Chronicles 14:14, 1 Chronicles 18:17, 1 Chronicles 22:3, 1 Chronicles 23:11, 1 Chronicles 28:5, 2 Chronicles 7:21, 2 Chronicles 9:25, 2 Chronicles 30:7, 2 Chronicles 36:19, Ezra 1:11, Ezra 4:16, Nehemiah 3:29, Nehemiah 4:4, Nehemiah 6:9, Nehemiah 11:30, Esther 1:12, Esther 2:1, Psalms 1:3, Psalms 22:24, Psalms 63:1, Psalms 65:8, Song of Solomon 6:11, Isaiah 3:1, Isaiah 7:9, Isaiah 9:18, Isaiah 10:33, Isaiah 13:20, Isaiah 19:22, Isaiah 40:15, Isaiah 40:20, Isaiah 44:17, Isaiah 48:18, Isaiah 52:12, Isaiah 59:12, Isaiah 60:2, Isaiah 65:9, Jeremiah 1:17, Jeremiah 10:14, Jeremiah 11:11, Jeremiah 23:6, Jeremiah 25:14, Jeremiah 28:15, Jeremiah 33:15, Jeremiah 39:13, Jeremiah 51:17, Ezekiel 16:22, Ezekiel 17:19, Ezekiel 20:32, Ezekiel 23:49, Ezekiel 25:10, Ezekiel 28:9, Ezekiel 32:7, Ezekiel 37:7, Ezekiel 40:2, Ezekiel 40:17, Ezekiel 40:25, Ezekiel 41:26, Ezekiel 44:3, Ezekiel 47:3, Daniel 2:31, Daniel 4:6, Hosea 8:4, Hosea 10:6, Amos 5:15, Micah 2:1, Zechariah 6:7, Zechariah 11:12, Matthew 11:7, Matthew 14:2, Matthew 20:18, Matthew 24:31, Mark 2:21, Mark 4:19, Mark 5:7, Mark 10:17, Mark 13:19, Mark 15:32, Luke 4:9, Luke 8:1, Luke 8:8, Luke 10:34, Luke 13:32, Luke 16:1, Luke 16:2, Luke 16:9, Luke 21:8, Luke 22:47, Luke 23:22, John 9:27, John 11:56, John 11:57, Acts 8:26, Acts 8:39, Acts 19:2, Acts 19:4, Acts 26:5, Romans 9:33, Romans 15:30, 1 Corinthians 11:27, 2 Corinthians 3:6, 2 Corinthians 7:4, 2 Corinthians 9:10, 2 Corinthians 10:8, Ephesians 4:18, Ephesians 5:27, 2 Thessalonians 3:8, Hebrews 12:15, Hebrews 13:11, 2 Peter 1:8, 1 John 4:1, 1 John 4:16, Jude 1:11, Jude 1:25, Revelation 6:9, Revelation 9:9, Revelation 13:7, Revelation 17:10, Revelation 19:21, Revelation 21:21, Genesis 19:3, Genesis 29:35, Genesis 34:5, Genesis 41:30, Genesis 42:9, Exodus 1:22, Exodus 4:4, Exodus 4:20, Exodus 6:16, Exodus 9:7, Exodus 10:24, Exodus 14:24, Exodus 21:28, Exodus 22:25, Exodus 26:9, Exodus 29:46, Leviticus 2:11, Leviticus 3:14, Leviticus 6:22, Leviticus 7:24, Leviticus 8:13, Leviticus 13:39, Leviticus 18:7, Leviticus 20:11, Leviticus 20:13, Leviticus 20:23, Leviticus 22:6, Leviticus 26:42, Numbers 9:1, Numbers 16:33, Deuteronomy 4:38, Deuteronomy 11:14, Deuteronomy 20:11, Deuteronomy 23:13, Deuteronomy 23:16, Deuteronomy 31:6, Deuteronomy 32:17, Joshua 2:24, Joshua 5:9, Joshua 8:4, Joshua 8:8, Joshua 16:3, Joshua 18:6, Judges 1:1, Judges 6:20, Ruth 4:12, 1 Samuel 2:21, 1 Samuel 7:2, 1 Samuel 15:28, 1 Samuel 19:7, 1 Samuel 19:21, 1 Samuel 20:15, 1 Samuel 24:21, 1 Samuel 25:24, 1 Samuel 25:42, 2 Samuel 9:9, 2 Samuel 15:23, 2 Samuel 15:32, 2 Samuel 19:40, 2 Samuel 22:3, 1 Kings 2:38, 1 Kings 3:20, 1 Kings 6:3, 1 Kings 7:7, 1 Kings 7:45, 1 Kings 8:24, 1 Kings 13:5, 1 Kings 18:29, 1 Kings 19:17, 1 Kings 22:24, 2 Kings 7:7, 2 Kings 10:34, 2 Kings 13:8, 2 Kings 13:10, 2 Kings 17:35, 2 Kings 18:23, 2 Kings 20:8, 2 Kings 22:3, 2 Kings 22:6, 1 Chronicles 2:23, 1 Chronicles 26:12, 1 Chronicles 29:30, 2 Chronicles 6:15, 2 Chronicles 10:2, 2 Chronicles 23:9, 2 Chronicles 29:32, 2 Chronicles 36:12, 2 Chronicles 36:15, Ezra 4:5, Nehemiah 13:28, Esther 1:11, Esther 5:5, Job 24:24, Psalms 57:3, Psalms 66:15, Psalms 88:5, Psalms 106:5, Ecclesiastes 10:17, Song of Solomon 6:13, Isaiah 5:12, Isaiah 12:1, Isaiah 15:9, Isaiah 17:12, Isaiah 29:5, Isaiah 36:8, Isaiah 48:19, Isaiah 49:15, Isaiah 60:10, Isaiah 62:2, Isaiah 63:5, Jeremiah 7:29, Jeremiah 9:15, Jeremiah 9:23, Jeremiah 19:14, Jeremiah 33:18, Jeremiah 36:8, Jeremiah 37:5, Jeremiah 46:12, Jeremiah 46:23, Jeremiah 50:32, Jeremiah 51:29, Lamentations 4:8, Ezekiel 3:26, Ezekiel 10:12, Ezekiel 10:17, Ezekiel 18:26, Ezekiel 20:36, Ezekiel 21:4, Ezekiel 22:7, Ezekiel 22:18, Ezekiel 23:11, Ezekiel 36:30, Ezekiel 36:31, Ezekiel 43:10, Ezekiel 43:12, Daniel 1:18, Daniel 3:21, Daniel 3:22, Daniel 12:3, Hosea 11:11, Amos 9:9, Micah 3:4, Habakkuk 3:19, Matthew 2:18, Matthew 9:9, Matthew 21:5, Mark 4:20, Mark 7:5, Mark 8:12, Mark 9:50, Mark 10:14, Mark 14:14, Luke 4:16, Luke 5:37, Luke 15:12, Luke 17:7, Luke 23:26, John 5:25, John 8:55, John 16:33, Acts 1:22, Acts 5:3, Acts 12:8, Acts 13:41, Acts 13:48, Acts 19:33, Acts 21:8, Acts 21:30, Acts 28:8, Romans 2:14, Romans 11:12, Romans 15:14, 1 Corinthians 5:10, 1 Corinthians 15:29, 2 Corinthians 9:4, 2 Corinthians 12:10, Galatians 3:17, Colossians 3:13, Titus 2:14, Hebrews 6:17, Hebrews 7:26, 1 Peter 2:23, Revelation 21:27, Genesis 16:6, Genesis 17:16, Genesis 28:5, Genesis 31:13, Genesis 32:6, Genesis 32:11, Genesis 37:27, Genesis 45:18, Genesis 47:23, Exodus 1:12, Exodus 2:11, Exodus 5:2, Exodus 9:10, Exodus 21:35, Exodus 28:3, Exodus 29:37, Exodus 29:40, Exodus 34:26, Exodus 38:30, Leviticus 1:15, Leviticus 6:28, Leviticus 9:3, Leviticus 9:4, Leviticus 19:15, Leviticus 25:15, Leviticus 27:3, Numbers 2:25, Numbers 7:10, Numbers 15:4, Numbers 16:1, Numbers 29:14, Numbers 31:14, Deuteronomy 4:47, Deuteronomy 8:19, Deuteronomy 10:1, Deuteronomy 16:1, Deuteronomy 21:20, Deuteronomy 21:21, Deuteronomy 27:9, Deuteronomy 27:12, Deuteronomy 28:14, Deuteronomy 32:10, Deuteronomy 32:35, Joshua 10:2, Joshua 16:9, Joshua 19:29, Joshua 21:21, Judges 3:22, Judges 6:10, 1 Samuel 7:8, 1 Samuel 13:7, 1 Samuel 17:47, 1 Samuel 21:7, 2 Samuel 7:22, 2 Samuel 8:4, 2 Samuel 14:9, 2 Samuel 16:18, 1 Kings 5:14, 1 Kings 19:15, 1 Kings 20:35, 1 Kings 22:31, 2 Kings 9:24, 2 Kings 13:4, 2 Kings 15:33, 2 Kings 17:31, 2 Kings 19:9, 2 Kings 21:9, 1 Chronicles 7:16, 1 Chronicles 11:20, 2 Chronicles 5:11, 2 Chronicles 26:5, 2 Chronicles 33:2, Ezra 6:16, Ezra 8:30, Nehemiah 3:23, Nehemiah 4:5, Nehemiah 5:9, Nehemiah 10:35, Esther 6:1, Psalms 35:10, Psalms 51:4, Psalms 84:3, Psalms 106:23, Ecclesiastes 3:16, Ecclesiastes 11:5, Ecclesiastes 11:8, Song of Solomon 3:6, Isaiah 1:1, Isaiah 5:8, Isaiah 10:22, Isaiah 19:13, Isaiah 22:4, Isaiah 36:3, Isaiah 36:10, Isaiah 54:5, Isaiah 60:21, Isaiah 66:9, Jeremiah 1:7, Jeremiah 2:25, Jeremiah 3:24, Jeremiah 6:7, Jeremiah 9:4, Jeremiah 9:5, Jeremiah 22:28, Jeremiah 24:10, Jeremiah 32:43, Jeremiah 50:26, Jeremiah 51:51, Ezekiel 2:10, Ezekiel 8:18, Ezekiel 16:28, Ezekiel 24:11, Ezekiel 37:1, Ezekiel 44:22, Hosea 2:8, Hosea 4:15, Hosea 14:3, Amos 9:11, Micah 2:11, Micah 7:12, Zechariah 3:2, Zechariah 6:10, Malachi 2:6, Matthew 6:6, Matthew 13:33, Matthew 18:10, Mark 4:15, Mark 9:2, Mark 15:40, Luke 9:11, Luke 9:32, Luke 11:7, Luke 14:9, Luke 14:15, Luke 15:6, Luke 18:13, Luke 24:12, Acts 7:43, Acts 10:4, Acts 15:20, Acts 27:13, Acts 27:39, Romans 4:13, Romans 8:17, Romans 8:29, Romans 14:3, Romans 14:13, Romans 15:8, 1 Corinthians 1:26, 1 Corinthians 14:6, Philippians 2:25, Colossians 1:27, 1 Timothy 6:1, Hebrews 8:1, Hebrews 10:2, Hebrews 12:28, James 1:17, Revelation 19:19, Genesis 3:15, Genesis 4:7, Genesis 12:7, Genesis 31:25, Genesis 32:16, Genesis 35:1, Exodus 2:13, Exodus 12:21, Exodus 12:36, Exodus 13:7, Exodus 22:7, Exodus 25:2, Exodus 25:10, Exodus 25:29, Exodus 27:9, Exodus 29:1, Exodus 35:15, Exodus 38:8, Exodus 40:21, Leviticus 2:9, Leviticus 3:13, Leviticus 6:16, Leviticus 19:8, Leviticus 22:5, Leviticus 25:5, Leviticus 25:29, Numbers 1:44, Numbers 2:10, Numbers 5:22, Numbers 7:8, Numbers 10:6, Numbers 11:24, Numbers 13:28, Numbers 21:16, Numbers 24:9, Numbers 28:13, Numbers 29:2, Numbers 31:3, Deuteronomy 27:22, Deuteronomy 32:47, Deuteronomy 33:11, Joshua 1:9, Joshua 17:6, Joshua 18:15, Joshua 19:50, Judges 6:9, Judges 6:22, Judges 10:11, Judges 11:20, Judges 18:24, Judges 20:25, Ruth 2:22, 1 Samuel 13:18, 1 Samuel 14:14, 1 Samuel 15:18, 1 Samuel 21:1, 1 Samuel 22:1, 1 Samuel 25:14, 2 Samuel 3:7, 2 Samuel 16:6, 1 Kings 7:35, 1 Kings 11:22, 1 Kings 13:31, 1 Kings 16:21, 1 Kings 20:40, 1 Kings 21:24, 2 Kings 2:17, 2 Kings 4:6, 2 Kings 4:41, 2 Kings 10:22, 2 Kings 15:15, 2 Kings 24:3, 1 Chronicles 2:53, 2 Chronicles 6:39, 2 Chronicles 9:14, 2 Chronicles 12:12, 2 Chronicles 13:2, Ezra 7:13, Nehemiah 1:5, Nehemiah 13:16, Esther 2:16, Psalms 18:2, Psalms 27:9, Psalms 90:10, Isaiah 14:23, Isaiah 15:1, Isaiah 22:11, Isaiah 24:13, Isaiah 29:22, Isaiah 37:17, Isaiah 41:19, Isaiah 42:13, Isaiah 44:9, Isaiah 49:1, Isaiah 51:4, Isaiah 54:14, Isaiah 55:1, Isaiah 55:3, Isaiah 57:10, Isaiah 59:4, Isaiah 59:8, Isaiah 60:20, Jeremiah 9:8, Jeremiah 16:6, Jeremiah 18:4, Jeremiah 20:12, Jeremiah 22:2, Jeremiah 23:4, Jeremiah 25:15, Jeremiah 28:5, Jeremiah 29:7, Jeremiah 32:42, Jeremiah 36:20, Jeremiah 40:3, Jeremiah 42:8, Jeremiah 46:9, Ezekiel 7:3, Ezekiel 14:15, Ezekiel 15:5, Ezekiel 23:12, Ezekiel 29:9, Ezekiel 29:21, Ezekiel 31:17, Ezekiel 36:32, Ezekiel 40:10, Ezekiel 41:17, Daniel 1:19, Joel 2:25, Micah 4:4, Matthew 10:19, Matthew 12:25, Matthew 13:21, Matthew 18:31, Matthew 21:24, Matthew 26:51, Mark 1:34, Luke 2:7, Luke 3:22, Luke 9:7, Luke 12:15, Luke 12:22, Luke 14:8, Luke 17:8, John 10:16, John 11:32, John 13:36, John 14:27, John 15:24, John 17:6, Acts 1:20, Acts 6:2, Acts 8:12, Acts 13:2, Acts 13:33, Acts 14:11, Acts 15:1, Acts 16:1, Acts 24:5, Romans 1:32, Romans 5:10, 1 Corinthians 14:15, 2 Corinthians 2:14, 2 Corinthians 7:13, 2 Corinthians 8:23, 2 Corinthians 11:21, Galatians 6:8, Philippians 4:10, Colossians 4:16, 1 Timothy 4:10, 1 Timothy 6:3, Hebrews 5:5, 3 John 1:12, Revelation 2:22, Revelation 4:11, Revelation 9:5, Revelation 11:5, Revelation 14:19, Revelation 18:13, Revelation 19:11, Genesis 9:12, Genesis 19:35, Genesis 26:10, Genesis 32:17, Genesis 38:21, Genesis 49:28, Exodus 9:1, Exodus 15:22, Exodus 22:29, Exodus 23:19, Exodus 30:2, Exodus 30:32, Exodus 33:10, Leviticus 11:34, Leviticus 13:33, Leviticus 13:37, Leviticus 14:29, Leviticus 23:43, Numbers 6:13, Numbers 13:33, Numbers 18:21, Numbers 20:11, Numbers 22:36, Numbers 24:1, Numbers 36:13, Deuteronomy 3:17, Deuteronomy 11:9, Deuteronomy 16:8, Deuteronomy 21:1, Deuteronomy 22:5, Deuteronomy 22:9, Deuteronomy 31:11, Joshua 5:10, Joshua 21:40, Joshua 24:6, Joshua 24:22, Judges 3:20, Judges 6:24, Judges 6:33, Judges 11:12, 1 Samuel 11:1, 2 Samuel 13:9, 2 Samuel 13:16, 2 Samuel 15:36, 2 Samuel 22:1, 1 Kings 1:27, 1 Kings 7:49, 1 Kings 11:27, 1 Kings 14:19, 1 Kings 15:3, 1 Kings 16:27, 1 Kings 17:18, 2 Kings 7:5, 2 Kings 18:5, 2 Kings 18:25, 2 Kings 19:7, 2 Kings 19:12, 2 Kings 19:14, 2 Kings 22:16, 1 Chronicles 16:41, 1 Chronicles 17:23, 1 Chronicles 19:9, 1 Chronicles 21:2, 1 Chronicles 21:29, 1 Chronicles 29:14, 2 Chronicles 20:7, 2 Chronicles 25:1, 2 Chronicles 32:25, Esther 2:20, Job 11:6, Job 42:9, Psalms 32:6, Psalms 35:27, Psalms 55:3, Psalms 79:10, Song of Solomon 4:16, Song of Solomon 5:9, Isaiah 4:2, Isaiah 6:11, Isaiah 8:9, Isaiah 10:3, Isaiah 11:10, Isaiah 11:12, Isaiah 11:16, Isaiah 12:4, Isaiah 13:21, Isaiah 14:22, Isaiah 27:12, Isaiah 37:7, Isaiah 37:12, Isaiah 48:17, Isaiah 58:4, Jeremiah 7:10, Jeremiah 18:22, Jeremiah 20:8, Jeremiah 22:22, Jeremiah 28:9, Jeremiah 33:16, Jeremiah 34:19, Jeremiah 48:8, Ezekiel 3:6, Ezekiel 7:7, Ezekiel 14:18, Ezekiel 18:7, Ezekiel 23:32, Ezekiel 29:7, Ezekiel 33:4, Ezekiel 33:29, Ezekiel 34:28, Ezekiel 39:2, Ezekiel 42:20, Daniel 6:14, Hosea 14:2, Amos 2:11, Micah 6:8, Micah 7:2, Habakkuk 1:6, Zechariah 6:5, Zechariah 8:8, Matthew 10:2, Matthew 20:25, Matthew 27:46, Mark 6:17, Luke 4:42, Luke 5:3, John 3:31, John 7:52, John 9:11, John 12:40, John 13:18, John 15:26, Acts 5:24, Acts 7:2, Acts 10:30, Acts 12:12, Acts 14:19, Acts 15:24, Acts 18:26, Acts 19:17, Acts 25:5, Acts 25:10, Acts 27:27, Romans 5:14, Romans 13:1, Romans 14:20, 1 Corinthians 5:8, 1 Corinthians 7:12, 1 Corinthians 12:23, 1 Corinthians 15:58, 2 Thessalonians 1:10, 1 Timothy 4:1, 1 Timothy 5:21, 2 Timothy 3:15, Hebrews 7:21, 1 Peter 1:17, 1 Peter 4:1, 2 Peter 3:7, 2 Peter 3:17, 1 John 5:18, Revelation 15:1, Revelation 16:15, Genesis 18:31, Genesis 25:6, Genesis 25:20, Genesis 30:31, Genesis 31:10, Genesis 33:15, Genesis 46:6, Genesis 46:26, Genesis 48:22, Exodus 1:10, Exodus 12:6, Exodus 12:18, Exodus 24:16, Exodus 38:12, Leviticus 1:11, Leviticus 6:7, Leviticus 8:16, Leviticus 14:20, Leviticus 14:45, Leviticus 17:6, Leviticus 19:9, Numbers 14:44, Numbers 26:44, Numbers 29:1, Numbers 35:32, Deuteronomy 6:24, Deuteronomy 20:7, Deuteronomy 23:25, Deuteronomy 27:2, Deuteronomy 28:33, Deuteronomy 30:2, Joshua 2:5, Joshua 10:3, Joshua 21:13, Judges 9:4, Judges 10:1, Judges 13:9, Judges 14:5, Judges 19:6, Judges 19:17, Judges 20:3, 1 Samuel 12:11, 1 Samuel 14:52, 1 Samuel 17:35, 1 Samuel 20:25, 1 Samuel 25:7, 2 Samuel 10:11, 2 Samuel 12:10, 2 Samuel 12:22, 2 Samuel 13:8, 2 Samuel 17:11, 2 Samuel 19:13, 1 Kings 5:1, 1 Kings 7:36, 1 Kings 8:63, 1 Kings 11:36, 1 Kings 13:8, 2 Kings 8:3, 2 Kings 9:12, 2 Kings 11:17, 2 Kings 13:5, 2 Kings 17:37, 2 Kings 18:11, 2 Kings 21:24, 2 Kings 22:2, 2 Kings 25:16, 1 Chronicles 4:21, 1 Chronicles 6:71, 1 Chronicles 11:11, 1 Chronicles 19:15, 2 Chronicles 3:17, 2 Chronicles 6:18, 2 Chronicles 25:7, 2 Chronicles 25:8, 2 Chronicles 30:14, 2 Chronicles 33:25, Ezra 3:6, Ezra 4:11, Nehemiah 3:14, Nehemiah 3:21, Nehemiah 9:18, Nehemiah 13:7, Psalms 19:13, Psalms 37:7, Psalms 57:4, Psalms 62:4, Psalms 93:1, Psalms 110:3, Ecclesiastes 2:19, Ecclesiastes 3:22, Ecclesiastes 8:12, Song of Solomon 7:8, Isaiah 23:1, Isaiah 28:22, Isaiah 28:25, Isaiah 30:13, Isaiah 35:6, Isaiah 50:7, Isaiah 51:20, Isaiah 61:8, Jeremiah 7:22, Jeremiah 7:25, Jeremiah 10:18, Jeremiah 11:6, Jeremiah 11:7, Jeremiah 15:11, Jeremiah 17:1, Jeremiah 17:6, Jeremiah 31:27, Jeremiah 37:15, Jeremiah 46:8, Jeremiah 48:7, Jeremiah 52:11, Ezekiel 16:47, Ezekiel 20:1, Ezekiel 23:28, Ezekiel 26:15, Ezekiel 29:14, Ezekiel 33:5, Ezekiel 34:26, Ezekiel 42:15, Ezekiel 45:20, Daniel 8:23, Daniel 10:8, Hosea 8:1, Joel 2:1, Joel 2:22, Nahum 1:2, Matthew 9:6, Matthew 13:17, Matthew 15:36, Mark 3:8, Mark 5:19, Luke 4:36, Luke 10:1, Luke 21:25, Luke 22:27, Luke 22:36, John 1:45, John 4:9, John 4:45, John 8:19, John 11:4, John 19:13, Acts 27:1, Romans 2:5, Romans 6:17, Romans 8:34, 2 Corinthians 12:18, Colossians 4:3, 1 Thessalonians 1:9, 1 Timothy 4:8, 1 Timothy 5:8, Hebrews 9:13, 2 Peter 2:22, 2 John 1:5, Revelation 9:7, Revelation 11:11, Genesis 18:30, Genesis 19:13, Genesis 19:33, Genesis 27:1, Genesis 36:43, Genesis 41:27, Genesis 43:34, Genesis 45:3, Genesis 48:15, Exodus 6:12, Exodus 9:27, Exodus 11:10, Exodus 14:28, Exodus 19:5, Exodus 24:14, Leviticus 2:1, Leviticus 2:8, Leviticus 8:29, Leviticus 9:23, Leviticus 11:9, Leviticus 11:47, Leviticus 15:24, Leviticus 20:16, Leviticus 21:1, Leviticus 25:11, Leviticus 27:14, Numbers 2:18, Numbers 16:22, Numbers 18:3, Numbers 19:4, Numbers 26:15, Numbers 26:33, Numbers 36:9, Deuteronomy 2:1, Deuteronomy 13:2, Deuteronomy 19:8, Deuteronomy 28:9, Deuteronomy 31:2, Deuteronomy 32:20, Joshua 10:25, Joshua 13:1, Joshua 14:14, Joshua 21:5, Joshua 21:34, Joshua 24:33, Judges 4:5, Judges 5:4, Judges 7:18, Judges 8:20, Judges 14:14, Judges 18:12, Judges 20:35, Judges 20:38, Judges 21:24, Ruth 4:3, Ruth 4:6, 1 Samuel 1:8, 1 Samuel 17:50, 2 Samuel 11:20, 2 Samuel 18:13, 2 Samuel 21:18, 1 Kings 1:52, 1 Kings 4:7, 1 Kings 11:7, 1 Kings 18:4, 1 Kings 18:38, 1 Kings 20:15, 1 Kings 20:30, 2 Kings 1:14, 2 Kings 15:12, 2 Kings 17:8, 2 Kings 18:2, 1 Chronicles 5:9, 1 Chronicles 7:4, 1 Chronicles 11:15, 1 Chronicles 29:25, 2 Chronicles 6:19, 2 Chronicles 7:12, 2 Chronicles 8:9, 2 Chronicles 17:9, 2 Chronicles 34:13, 2 Chronicles 35:20, Nehemiah 6:3, Nehemiah 9:34, Job 1:4, Psalms 17:3, Psalms 55:23, Psalms 69:13, Psalms 126:2, Psalms 138:7, Psalms 141:4, Isaiah 14:21, Isaiah 28:17, Isaiah 33:19, Isaiah 37:14, Isaiah 40:14, Isaiah 41:10, Isaiah 46:6, Isaiah 46:10, Isaiah 49:9, Isaiah 59:16, Isaiah 62:10, Isaiah 65:23, Jeremiah 9:16, Jeremiah 9:20, Jeremiah 20:3, Jeremiah 22:15, Jeremiah 24:9, Jeremiah 30:15, Jeremiah 38:10, Jeremiah 39:1, Jeremiah 43:4, Jeremiah 46:14, Lamentations 1:11, Ezekiel 10:9, Ezekiel 13:8, Ezekiel 18:18, Ezekiel 22:11, Ezekiel 26:11, Ezekiel 38:14, Ezekiel 43:22, Daniel 4:30, Hosea 2:9, Hosea 7:13, Amos 2:8, Amos 3:11, Amos 6:4, Amos 7:4, Jonah 4:10, Nahum 3:4, Haggai 2:18, Zechariah 1:19, Zechariah 2:9, Matthew 9:28, Matthew 10:42, Matthew 19:21, Matthew 21:2, Mark 2:19, Mark 5:40, Mark 9:43, Mark 9:47, Mark 10:1, Mark 12:12, Mark 13:34, Mark 16:6, Luke 9:39, Luke 15:13, Luke 19:30, John 1:39, John 4:35, John 5:7, John 17:1, Acts 1:4, Acts 9:26, Acts 16:16, Acts 16:27, Acts 25:19, Acts 27:30, Acts 28:21, Romans 3:4, 1 Corinthians 1:17, 2 Corinthians 5:1, 2 Corinthians 10:1, Galatians 5:21, Colossians 2:13, 2 Timothy 1:5, Hebrews 11:6, Hebrews 12:9, Hebrews 12:17, 2 Peter 2:4, 2 Peter 3:5, Jude 1:10, Revelation 1:3, Revelation 8:8, Genesis 24:46, Genesis 24:54, Genesis 36:24, Genesis 50:7, Exodus 8:19, Exodus 19:3, Exodus 22:27, Exodus 27:18, Exodus 28:8, Exodus 30:15, Exodus 30:34, Exodus 32:20, Leviticus 7:14, Leviticus 14:34, Leviticus 25:4, Numbers 1:2, Numbers 3:32, Numbers 5:17, Numbers 6:2, Numbers 16:15, Numbers 22:7, Numbers 26:59, Numbers 26:65, Numbers 27:2, Numbers 29:36, Numbers 35:23, Deuteronomy 2:21, Deuteronomy 6:20, Deuteronomy 7:7, Deuteronomy 12:5, Deuteronomy 13:15, Deuteronomy 15:17, Deuteronomy 17:4, Deuteronomy 18:6, Deuteronomy 25:3, Deuteronomy 26:11, Deuteronomy 28:7, Deuteronomy 31:9, Joshua 1:5, Joshua 2:12, Joshua 8:11, Joshua 17:17, Judges 4:2, Judges 4:3, Judges 8:2, Judges 9:35, Judges 9:37, Judges 11:9, 1 Samuel 13:19, 1 Samuel 25:10, 1 Samuel 28:2, 2 Samuel 4:9, 2 Samuel 12:24, 2 Samuel 16:13, 1 Kings 1:53, 1 Kings 8:58, 1 Kings 9:5, 1 Kings 10:15, 1 Kings 11:40, 1 Kings 12:2, 1 Kings 14:4, 1 Kings 15:30, 1 Kings 20:10, 1 Kings 22:51, 2 Kings 4:16, 2 Kings 8:2, 1 Chronicles 17:11, 2 Chronicles 1:4, 2 Chronicles 14:14, 2 Chronicles 18:23, 2 Chronicles 19:7, 2 Chronicles 22:2, 2 Chronicles 22:4, 2 Chronicles 24:9, 2 Chronicles 27:1, 2 Chronicles 36:9, Ezra 8:1, Nehemiah 12:31, Job 1:21, Job 2:1, Job 42:12, Psalms 106:38, Psalms 139:16, Ecclesiastes 7:2, Song of Solomon 8:2, Isaiah 6:13, Isaiah 26:10, Isaiah 29:6, Isaiah 30:2, Isaiah 32:14, Isaiah 37:9, Isaiah 40:11, Isaiah 44:3, Isaiah 48:6, Isaiah 51:1, Isaiah 56:2, Isaiah 57:4, Isaiah 60:18, Isaiah 66:1, Jeremiah 2:18, Jeremiah 6:9, Jeremiah 14:8, Jeremiah 15:6, Jeremiah 15:7, Jeremiah 15:10, Jeremiah 15:16, Jeremiah 35:2, Jeremiah 50:19, Ezekiel 10:22, Ezekiel 13:23, Ezekiel 14:6, Ezekiel 18:31, Ezekiel 22:22, Ezekiel 39:26, Ezekiel 41:4, Daniel 9:6, Joel 2:27, Jonah 3:10, Zechariah 3:8, Zechariah 4:7, Zechariah 9:8, Zechariah 14:14, Matthew 3:9, Matthew 7:22, Matthew 10:1, Mark 5:23, Mark 6:31, Mark 11:25, Luke 11:1, Luke 11:27, Luke 13:15, John 2:10, John 13:29, John 17:21, John 18:1, John 19:20, Acts 7:44, Acts 11:18, Acts 19:16, Acts 25:7, 1 Corinthians 1:21, 1 Corinthians 8:10, 1 Corinthians 9:7, 2 Corinthians 8:9, Galatians 4:30, Ephesians 4:29, 1 Timothy 1:18, 1 Timothy 6:9, Hebrews 4:2, Hebrews 10:16, Hebrews 11:37, 1 Peter 3:4, Revelation 2:1, Revelation 6:10, Revelation 14:14, Revelation 17:2, Revelation 17:7, Revelation 18:17, Revelation 22:8, Revelation 22:16, Genesis 14:14, Genesis 19:11, Genesis 24:5, Genesis 29:33, Genesis 31:39, Genesis 33:11, Genesis 35:2, Genesis 37:32, Genesis 38:29, Genesis 43:24, Genesis 44:1, Exodus 7:10, Exodus 7:22, Exodus 16:35, Exodus 28:39, Exodus 32:6, Exodus 33:8, Exodus 36:2, Exodus 36:11, Leviticus 4:4, Leviticus 7:36, Leviticus 18:9, Leviticus 23:38, Leviticus 25:9, Leviticus 26:33, Numbers 7:5, Numbers 11:10, Numbers 16:19, Numbers 26:4, Numbers 31:52, Deuteronomy 3:8, Deuteronomy 11:31, Deuteronomy 19:11, Deuteronomy 23:5, Deuteronomy 26:18, Deuteronomy 28:4, Deuteronomy 34:11, Joshua 3:7, Joshua 23:7, Joshua 24:31, Judges 8:27, Judges 9:19, Judges 11:11, Judges 11:19, Ruth 2:12, 1 Samuel 2:31, 1 Samuel 14:13, 1 Samuel 15:35, 1 Samuel 26:14, 2 Samuel 17:3, 2 Samuel 19:38, 2 Samuel 24:14, 1 Kings 1:17, 1 Kings 2:27, 1 Kings 4:27, 1 Kings 8:4, 1 Kings 18:19, 1 Kings 20:5, 1 Kings 20:17, 2 Kings 13:18, 2 Kings 17:20, 2 Kings 21:14, 2 Kings 23:22, 1 Chronicles 3:1, 1 Chronicles 7:7, 1 Chronicles 9:29, 1 Chronicles 25:5, 2 Chronicles 16:8, 2 Chronicles 21:4, 2 Chronicles 28:7, 2 Chronicles 29:15, 2 Chronicles 30:10, 2 Chronicles 34:2, Ezra 7:14, Ezra 9:5, Nehemiah 3:6, Nehemiah 7:64, Esther 9:15, Job 42:3, Psalms 65:4, Psalms 84:10, Isaiah 2:20, Isaiah 3:7, Isaiah 13:10, Isaiah 34:7, Isaiah 43:20, Isaiah 57:17, Isaiah 62:5, Jeremiah 7:24, Jeremiah 10:10, Jeremiah 11:20, Jeremiah 12:12, Jeremiah 25:32, Jeremiah 30:6, Jeremiah 32:20, Jeremiah 44:1, Jeremiah 48:41, Ezekiel 7:15, Ezekiel 11:19, Ezekiel 16:20, Ezekiel 16:49, Ezekiel 18:2, Ezekiel 23:7, Ezekiel 27:16, Ezekiel 34:25, Ezekiel 44:18, Ezekiel 45:3, Ezekiel 45:18, Daniel 11:16, Amos 5:5, Micah 1:16, Micah 4:8, Zephaniah 1:15, Matthew 17:4, Matthew 19:18, Matthew 23:25, Mark 7:24, Mark 14:54, Luke 1:15, Luke 3:17, Luke 8:39, John 10:38, John 18:3, John 20:1, Acts 7:40, Acts 7:45, Acts 10:45, Acts 15:10, Acts 22:20, Romans 6:6, Romans 15:9, Romans 16:17, 1 Corinthians 4:7, 1 Corinthians 4:17, 1 Corinthians 5:1, 1 Corinthians 6:11, 1 Corinthians 16:2, 2 Corinthians 5:16, 2 Corinthians 7:8, Ephesians 1:11, Ephesians 4:28, Colossians 2:12, Colossians 2:18, 1 Timothy 5:13, Hebrews 11:8, James 5:17, 2 Peter 2:6, 1 John 2:7, 1 John 2:16, Revelation 6:12, Revelation 10:10, Revelation 21:5, Genesis 2:20, Genesis 14:10, Genesis 19:30, Genesis 24:65, Genesis 31:29, Genesis 41:42, Genesis 41:55, Genesis 43:33, Genesis 47:13, Genesis 49:29, Genesis 50:15, Exodus 6:14, Exodus 14:31, Exodus 28:32, Exodus 36:12, Exodus 40:38, Leviticus 3:1, Leviticus 6:27, Leviticus 16:19, Leviticus 26:34, Numbers 6:7, Numbers 9:23, Numbers 14:19, Numbers 19:7, Deuteronomy 4:11, Deuteronomy 11:22, Deuteronomy 15:12, Deuteronomy 17:1, Deuteronomy 20:18, Deuteronomy 25:15, Deuteronomy 28:58, Joshua 9:13, Joshua 19:12, Judges 1:30, Judges 3:4, Judges 6:30, Judges 19:12, 1 Samuel 4:8, 1 Samuel 4:20, 1 Samuel 6:13, 1 Samuel 6:21, 1 Samuel 7:9, 1 Samuel 12:2, 1 Samuel 12:15, 1 Samuel 15:32, 1 Samuel 19:3, 1 Samuel 26:11, 1 Samuel 26:24, 1 Samuel 29:10, 2 Samuel 7:6, 2 Samuel 11:10, 2 Samuel 11:23, 2 Samuel 13:25, 2 Samuel 17:15, 2 Samuel 18:20, 2 Samuel 18:26, 2 Samuel 22:16, 1 Kings 6:21, 1 Kings 11:32, 1 Kings 13:14, 1 Kings 18:43, 2 Kings 2:11, 2 Kings 2:24, 2 Kings 4:22, 2 Kings 13:2, 2 Kings 16:5, 1 Chronicles 13:14, 2 Chronicles 3:3, 2 Chronicles 14:1, 2 Chronicles 20:18, 2 Chronicles 23:5, 2 Chronicles 25:20, 2 Chronicles 28:6, 2 Chronicles 30:16, 2 Chronicles 34:15, Ezra 6:18, Nehemiah 13:2, Nehemiah 13:9, Esther 1:8, Esther 2:6, Psalms 40:12, Psalms 40:14, Psalms 68:18, Ecclesiastes 5:19, Isaiah 2:7, Isaiah 5:6, Isaiah 8:14, Isaiah 10:4, Isaiah 13:13, Isaiah 17:5, Isaiah 17:8, Isaiah 24:6, Isaiah 24:23, Isaiah 30:16, Isaiah 34:2, Isaiah 34:14, Isaiah 42:10, Isaiah 47:6, Isaiah 49:4, Jeremiah 21:14, Jeremiah 24:3, Jeremiah 33:20, Jeremiah 37:20, Jeremiah 43:3, Jeremiah 51:5, Jeremiah 51:44, Jeremiah 51:52, Ezekiel 7:26, Ezekiel 11:24, Ezekiel 16:19, Ezekiel 16:25, Ezekiel 20:18, Ezekiel 24:16, Ezekiel 45:21, Daniel 4:26, Daniel 7:16, Daniel 8:2, Daniel 11:5, Hosea 2:3, Hosea 10:1, Amos 8:14, Micah 1:2, Nahum 1:6, Haggai 2:9, Zechariah 7:3, Malachi 1:9, Matthew 18:17, Matthew 25:44, Mark 5:15, Mark 10:19, Luke 4:38, Luke 7:20, Luke 8:18, Luke 11:13, Luke 11:46, Luke 12:45, Luke 13:4, Luke 17:27, Luke 21:21, Luke 23:8, Luke 24:18, John 1:38, John 4:27, John 6:64, John 7:18, John 12:36, John 18:25, John 21:16, Acts 14:13, Acts 17:29, Acts 18:23, Acts 22:10, Acts 26:11, Romans 8:15, 2 Corinthians 5:10, Ephesians 6:18, 2 Thessalonians 2:8, Hebrews 4:15, Hebrews 6:7, Hebrews 7:3, 1 Peter 2:6, 1 Peter 3:1, 1 Peter 3:15, 1 John 2:11, 2 John 1:9, Revelation 7:15, Revelation 9:4, Genesis 3:19, Genesis 9:16, Genesis 14:2, Genesis 23:11, Genesis 26:1, Genesis 26:20, Genesis 27:39, Genesis 28:2, Genesis 30:20, Exodus 1:16, Exodus 2:9, Exodus 10:1, Exodus 16:7, Exodus 38:1, Exodus 40:9, Leviticus 6:21, Leviticus 14:41, Leviticus 15:6, Leviticus 15:8, Leviticus 16:13, Leviticus 26:40, Numbers 14:29, Numbers 14:36, Numbers 16:41, Numbers 22:38, Numbers 26:10, Deuteronomy 1:21, Deuteronomy 1:33, Deuteronomy 5:29, Deuteronomy 22:3, Deuteronomy 32:36, Joshua 2:23, Joshua 8:13, Joshua 14:7, Joshua 23:5, Judges 5:26, Judges 6:29, Judges 9:45, Judges 13:3, Judges 21:14, 1 Samuel 12:23, 1 Samuel 15:24, 2 Samuel 7:26, 2 Samuel 14:6, 1 Kings 2:46, 1 Kings 6:8, 1 Kings 7:32, 1 Kings 11:28, 1 Kings 13:28, 1 Kings 18:30, 1 Kings 21:8, 2 Kings 2:19, 2 Kings 4:25, 2 Kings 4:26, 2 Kings 21:2, 1 Chronicles 4:42, 1 Chronicles 7:21, 1 Chronicles 25:2, 1 Chronicles 29:9, 2 Chronicles 12:10, 2 Chronicles 17:2, 2 Chronicles 18:19, 2 Chronicles 20:24, 2 Chronicles 28:8, 2 Chronicles 28:10, 2 Chronicles 30:3, 2 Chronicles 36:5, Ezra 10:11, Nehemiah 4:13, Esther 9:3, Psalms 18:15, Ecclesiastes 3:14, Ecclesiastes 12:1, Isaiah 3:12, Isaiah 9:3, Isaiah 19:7, Isaiah 29:21, Isaiah 41:1, Isaiah 59:9, Jeremiah 3:14, Jeremiah 4:2, Jeremiah 8:3, Jeremiah 11:14, Jeremiah 12:3, Jeremiah 17:19, Jeremiah 22:14, Jeremiah 23:20, Jeremiah 26:3, Jeremiah 44:10, Jeremiah 48:36, Jeremiah 49:23, Jeremiah 50:17, Jeremiah 51:53, Ezekiel 3:21, Ezekiel 13:2, Ezekiel 16:17, Ezekiel 17:3, Ezekiel 20:22, Ezekiel 24:17, Ezekiel 27:9, Ezekiel 36:26, Ezekiel 40:13, Ezekiel 44:9, Ezekiel 45:5, Ezekiel 46:16, Daniel 1:13, Daniel 7:6, Hosea 11:9, Joel 1:14, Amos 2:2, Micah 3:8, Micah 5:3, Zephaniah 3:5, Matthew 6:26, Matthew 13:35, Matthew 21:41, Matthew 24:2, Mark 2:8, Mark 2:15, Mark 6:11, Mark 7:6, Luke 7:25, Luke 8:12, Luke 9:22, Luke 11:51, Luke 12:3, Luke 15:20, Luke 17:2, Luke 22:37, John 3:18, John 4:47, John 14:17, Acts 8:9, Acts 9:2, Acts 20:3, Acts 20:32, 1 Corinthians 14:9, 1 Corinthians 15:52, 2 Corinthians 5:19, 2 Corinthians 10:15, 2 Corinthians 13:11, Galatians 1:10, Colossians 3:22, 1 Thessalonians 4:17, 1 Timothy 6:13, Hebrews 1:5, Revelation 2:9, Revelation 4:4, Revelation 8:10, Revelation 21:16, Genesis 19:17, Genesis 34:24, Genesis 36:18, Genesis 37:8, Genesis 41:56, Genesis 43:8, Genesis 45:11, Genesis 45:19, Exodus 8:16, Exodus 13:18, Exodus 17:2, Exodus 28:11, Exodus 29:33, Exodus 34:6, Exodus 39:6, Leviticus 3:8, Leviticus 4:28, Leviticus 7:30, Leviticus 9:2, Leviticus 11:43, Numbers 4:47, Numbers 5:25, Numbers 7:86, Numbers 11:21, Numbers 19:16, Numbers 31:26, Numbers 32:19, Deuteronomy 3:26, Deuteronomy 8:9, Deuteronomy 14:8, Deuteronomy 31:28, Joshua 5:15, Joshua 7:19, Joshua 8:9, Joshua 15:3, Joshua 16:8, Judges 7:14, Judges 11:7, Judges 18:22, Judges 20:1, Ruth 2:13, 1 Samuel 7:13, 1 Samuel 9:12, 1 Samuel 13:21, 1 Samuel 14:39, 1 Samuel 15:26, 1 Samuel 23:2, 1 Samuel 28:18, 2 Samuel 1:20, 2 Samuel 2:22, 2 Samuel 11:8, 2 Samuel 12:7, 2 Samuel 15:31, 1 Kings 6:22, 1 Kings 7:23, 1 Kings 7:39, 1 Kings 11:20, 1 Kings 11:26, 1 Kings 14:27, 1 Kings 17:19, 1 Kings 17:23, 2 Kings 9:3, 2 Kings 20:19, 1 Chronicles 9:16, 1 Chronicles 16:1, 1 Chronicles 24:3, 2 Chronicles 2:3, 2 Chronicles 4:2, 2 Chronicles 20:16, 2 Chronicles 21:2, 2 Chronicles 25:10, 2 Chronicles 32:6, Ezra 1:7, Ezra 4:10, Ezra 7:27, Nehemiah 11:7, Job 32:2, Psalms 5:11, Psalms 69:6, Psalms 78:4, Ecclesiastes 8:8, Ecclesiastes 8:10, Isaiah 1:7, Isaiah 10:16, Isaiah 11:13, Isaiah 22:5, Isaiah 54:2, Isaiah 58:6, Isaiah 58:10, Isaiah 59:7, Isaiah 62:6, Jeremiah 11:22, Jeremiah 23:28, Jeremiah 24:7, Jeremiah 25:13, Jeremiah 27:10, Jeremiah 32:7, Jeremiah 36:4, Jeremiah 38:19, Jeremiah 42:11, Jeremiah 49:1, Jeremiah 49:14, Jeremiah 51:22, Jeremiah 51:35, Jeremiah 52:30, Lamentations 1:13, Lamentations 4:21, Ezekiel 10:6, Ezekiel 30:4, Ezekiel 40:24, Ezekiel 44:27, Daniel 9:21, Daniel 11:35, Micah 2:13, Nahum 1:12, Malachi 2:8, Malachi 3:17, Matthew 3:7, Matthew 5:45, Matthew 6:1, Matthew 13:14, Matthew 20:8, Matthew 23:16, Matthew 25:34, Mark 4:17, Mark 8:34, Mark 13:35, Luke 10:30, Luke 12:24, Luke 12:36, Luke 18:29, Luke 21:36, John 6:40, John 13:10, Acts 5:15, Acts 14:27, Acts 15:12, Acts 17:15, Acts 22:22, Acts 24:1, Acts 25:15, Romans 10:19, Romans 12:20, Romans 13:7, 1 Corinthians 2:11, 1 Corinthians 7:30, 2 Corinthians 7:1, 2 Corinthians 8:7, Colossians 4:10, Titus 1:9, Titus 3:5, Hebrews 9:9, Hebrews 10:22, 1 Peter 4:17, 1 Peter 5:12, 2 Peter 1:3, 1 John 2:24, 1 John 4:6, Revelation 2:18, Revelation 15:4, Revelation 18:9, Revelation 19:1, Genesis 15:18, Genesis 20:3, Genesis 23:10, Genesis 31:1, Genesis 42:35, Genesis 44:31, Genesis 47:20, Exodus 2:10, Exodus 3:2, Exodus 17:9, Exodus 22:10, Exodus 38:27, Leviticus 11:27, Leviticus 14:19, Leviticus 14:52, Leviticus 17:7, Leviticus 21:12, Leviticus 26:30, Numbers 8:8, Numbers 9:3, Numbers 21:18, Numbers 28:19, Numbers 31:9, Deuteronomy 11:13, Deuteronomy 22:8, Deuteronomy 26:16, Deuteronomy 28:8, Deuteronomy 28:32, Deuteronomy 28:35, Deuteronomy 32:22, Deuteronomy 33:8, Deuteronomy 33:9, Joshua 1:2, Joshua 1:13, Joshua 4:14, Joshua 9:6, Joshua 13:30, Joshua 15:5, Judges 1:10, 1 Samuel 3:17, 1 Samuel 9:3, 1 Samuel 14:19, 1 Samuel 15:30, 1 Samuel 19:10, 1 Samuel 30:23, 2 Samuel 2:4, 2 Samuel 3:1, 2 Samuel 3:23, 2 Samuel 10:9, 1 Kings 1:5, 1 Kings 1:11, 1 Kings 1:39, 1 Kings 1:42, 1 Kings 3:7, 1 Kings 6:20, 1 Kings 18:31, 1 Kings 18:42, 2 Kings 8:16, 2 Kings 15:18, 2 Kings 16:8, 2 Kings 16:9, 1 Chronicles 5:10, 1 Chronicles 7:15, 1 Chronicles 12:20, 1 Chronicles 18:4, 1 Chronicles 19:10, 2 Chronicles 7:17, 2 Chronicles 29:7, 2 Chronicles 29:11, Ezra 1:6, Nehemiah 4:10, Nehemiah 12:35, Job 28:4, Ecclesiastes 11:6, Isaiah 15:2, Isaiah 30:1, Isaiah 36:15, Isaiah 39:7, Isaiah 41:9, Isaiah 46:11, Isaiah 61:4, Jeremiah 3:21, Jeremiah 9:22, Jeremiah 11:5, Jeremiah 16:7, Jeremiah 27:14, Jeremiah 42:15, Jeremiah 49:12, Jeremiah 50:40, Lamentations 1:6, Ezekiel 11:21, Ezekiel 13:21, Ezekiel 22:30, Daniel 2:43, Hosea 11:4, Micah 1:1, Habakkuk 2:3, Zephaniah 3:9, Haggai 2:16, Haggai 2:19, Zechariah 1:17, Zechariah 2:4, Zechariah 8:14, Matthew 8:4, Matthew 26:18, Luke 5:14, Luke 7:9, Luke 11:26, Luke 23:35, John 6:32, John 12:13, John 14:26, Acts 13:17, Acts 26:29, 1 Corinthians 10:16, 1 Corinthians 14:23, Colossians 4:11, 2 Timothy 3:11, Hebrews 11:16, James 2:11, 2 Peter 1:16, 1 John 2:18, 1 John 4:20, Revelation 18:10, Revelation 21:19, Genesis 11:29, Genesis 35:4, Exodus 7:21, Exodus 12:3, Exodus 14:19, Exodus 19:23, Exodus 31:15, Exodus 31:17, Exodus 36:24, Leviticus 4:2, Leviticus 4:22, Leviticus 5:8, Leviticus 8:2, Leviticus 13:21, Leviticus 13:26, Leviticus 13:27, Leviticus 15:14, Leviticus 18:23, Numbers 2:2, Numbers 7:83, Numbers 17:5, Numbers 22:33, Numbers 23:17, Numbers 25:14, Numbers 26:12, Numbers 26:26, Numbers 26:38, Numbers 28:11, Numbers 29:11, Numbers 35:27, Deuteronomy 4:5, Deuteronomy 18:1, Deuteronomy 18:18, Deuteronomy 19:1, Deuteronomy 22:25, Deuteronomy 23:2, Deuteronomy 23:21, Deuteronomy 28:49, Deuteronomy 29:21, Deuteronomy 32:39, Joshua 2:22, Joshua 6:9, Joshua 7:17, Joshua 13:9, Joshua 17:7, Judges 8:1, Judges 10:9, Judges 17:9, Judges 19:19, Judges 20:5, 1 Samuel 2:1, 1 Samuel 16:2, 2 Samuel 3:26, 2 Samuel 3:39, 2 Samuel 13:2, 2 Samuel 13:18, 2 Samuel 14:30, 2 Samuel 15:19, 1 Kings 2:44, 1 Kings 8:65, 1 Kings 12:11, 1 Kings 19:16, 2 Kings 6:10, 2 Kings 6:19, 2 Kings 6:33, 2 Kings 10:29, 2 Kings 19:20, 1 Chronicles 15:2, 1 Chronicles 29:10, 1 Chronicles 29:12, 2 Chronicles 1:2, 2 Chronicles 10:11, 2 Chronicles 13:10, 2 Chronicles 21:10, Nehemiah 4:23, Nehemiah 8:2, Esther 1:20, Job 1:7, Psalms 28:4, Psalms 35:26, Psalms 145:13, Ecclesiastes 2:15, Ecclesiastes 4:16, Isaiah 14:25, Isaiah 26:11, Isaiah 27:10, Isaiah 32:2, Isaiah 41:15, Isaiah 44:14, Isaiah 51:8, Jeremiah 2:7, Jeremiah 15:1, Jeremiah 29:10, Jeremiah 30:17, Jeremiah 30:24, Jeremiah 32:18, Jeremiah 42:14, Jeremiah 45:4, Jeremiah 49:13, Jeremiah 50:3, Jeremiah 51:23, Lamentations 2:18, Ezekiel 16:14, Ezekiel 23:27, Ezekiel 26:5, Ezekiel 43:25, Ezekiel 46:21, Daniel 4:31, Daniel 9:20, Daniel 11:13, Daniel 11:21, Daniel 11:28, Daniel 11:43, Hosea 5:14, Hosea 6:3, Amos 2:1, Amos 5:12, Zechariah 8:21, Matthew 7:11, Matthew 15:22, Matthew 22:13, Mark 11:11, Luke 2:34, Luke 5:19, Luke 9:45, Luke 11:8, John 2:22, John 8:52, John 11:39, John 11:44, John 12:9, Acts 7:6, Acts 7:26, Acts 9:11, Acts 15:36, Acts 23:20, Acts 27:43, 1 Corinthians 9:21, 2 Corinthians 3:14, Galatians 2:12, Colossians 2:19, 1 Thessalonians 5:23, 2 Thessalonians 2:4, Titus 1:1, Hebrews 9:12, Hebrews 12:11, James 3:4, 1 Peter 1:8, 1 Peter 5:1, 2 Peter 2:5, 1 John 4:3, 2 John 1:12, Revelation 11:2, Revelation 11:9, Revelation 16:13, Genesis 19:15, Genesis 27:30, Genesis 27:31, Genesis 42:19, Exodus 1:19, Exodus 10:9, Exodus 30:36, Exodus 31:18, Exodus 38:19, Exodus 39:41, Leviticus 2:16, Leviticus 6:17, Leviticus 7:37, Leviticus 13:42, Leviticus 14:12, Leviticus 15:31, Leviticus 20:5, Leviticus 27:27, Numbers 5:24, Numbers 7:29, Numbers 11:22, Numbers 15:29, Numbers 20:10, Numbers 23:24, Numbers 35:30, Deuteronomy 1:16, Deuteronomy 1:31, Deuteronomy 17:7, Deuteronomy 32:42, Joshua 2:3, Joshua 9:4, Joshua 9:10, Joshua 11:15, Joshua 13:12, Joshua 18:20, Judges 4:7, Judges 5:28, Judges 8:7, Judges 16:21, Judges 20:34, Ruth 4:17, 1 Samuel 2:32, 1 Samuel 17:36, 1 Samuel 17:57, 1 Samuel 21:13, 1 Samuel 22:11, 1 Samuel 30:14, 2 Samuel 2:24, 2 Samuel 2:30, 2 Samuel 8:6, 2 Samuel 17:13, 2 Samuel 19:20, 1 Kings 1:6, 1 Kings 2:20, 2 Kings 3:26, 2 Kings 4:10, 2 Kings 10:11, 2 Kings 15:19, 2 Kings 20:12, 2 Kings 21:19, 1 Chronicles 21:18, 1 Chronicles 27:24, 2 Chronicles 2:10, 2 Chronicles 13:7, 2 Chronicles 23:2, 2 Chronicles 25:17, 2 Chronicles 32:7, Nehemiah 2:9, Nehemiah 13:10, Esther 9:18, Ecclesiastes 5:2, Song of Solomon 7:4, Isaiah 3:14, Isaiah 14:20, Isaiah 31:9, Isaiah 35:4, Isaiah 57:1, Isaiah 63:16, Jeremiah 7:6, Jeremiah 7:14, Jeremiah 18:20, Jeremiah 20:7, Jeremiah 37:14, Jeremiah 39:10, Jeremiah 52:18, Ezekiel 1:3, Ezekiel 3:13, Ezekiel 7:11, Ezekiel 7:24, Ezekiel 12:28, Ezekiel 14:8, Ezekiel 21:15, Ezekiel 33:25, Ezekiel 36:33, Ezekiel 38:15, Ezekiel 39:25, Ezekiel 40:39, Ezekiel 42:11, Daniel 8:11, Hosea 5:13, Hosea 10:11, Amos 3:14, Amos 3:15, Obadiah 1:16, Micah 6:14, Nahum 3:19, Habakkuk 2:18, Zephaniah 2:11, Zechariah 4:9, Matthew 3:12, Matthew 15:31, Mark 11:18, Luke 7:24, Luke 12:11, Luke 13:19, Luke 21:34, John 6:5, John 14:12, Acts 14:3, Acts 14:22, Acts 15:5, Acts 15:23, Romans 1:29, Romans 3:5, 1 Corinthians 7:4, 1 Corinthians 10:28, 1 Corinthians 11:25, 1 Corinthians 11:34, 1 Corinthians 15:28, 2 Corinthians 13:4, 2 Corinthians 13:7, Galatians 3:21, 2 Thessalonians 1:11, 2 Thessalonians 2:3, 1 Timothy 5:16, Hebrews 5:12, Hebrews 6:4, Hebrews 9:28, Hebrews 12:5, James 5:16, 1 John 1:2, 2 John 1:6, Revelation 16:14, Revelation 19:17, Genesis 8:1, Genesis 10:32, Genesis 22:6, Genesis 24:49, Genesis 30:41, Genesis 39:23, Genesis 46:15, Exodus 3:6, Exodus 4:10, Exodus 5:19, Exodus 9:14, Exodus 9:24, Exodus 11:7, Exodus 14:26, Exodus 35:2, Leviticus 4:27, Leviticus 6:30, Leviticus 7:15, Leviticus 7:20, Leviticus 16:23, Leviticus 20:19, Leviticus 21:7, Leviticus 25:45, Leviticus 27:21, Numbers 3:26, Numbers 3:39, Numbers 5:2, Numbers 5:26, Numbers 15:30, Numbers 16:7, Numbers 20:16, Deuteronomy 2:29, Deuteronomy 22:14, Deuteronomy 24:14, Deuteronomy 31:19, Deuteronomy 33:19, Joshua 10:35, Joshua 16:5, Joshua 23:6, Judges 20:4, 1 Samuel 14:30, 1 Samuel 17:12, 1 Samuel 17:33, 1 Samuel 20:34, 1 Samuel 26:25, 1 Samuel 28:3, 2 Samuel 7:14, 2 Samuel 21:6, 2 Samuel 24:9, 1 Kings 2:36, 1 Kings 5:8, 1 Kings 8:28, 1 Kings 10:19, 1 Kings 21:20, 1 Kings 22:42, 2 Kings 18:30, 2 Kings 19:2, 2 Kings 22:1, 1 Chronicles 1:43, 1 Chronicles 17:10, 1 Chronicles 18:6, 1 Chronicles 23:31, 2 Chronicles 3:12, 2 Chronicles 24:7, 2 Chronicles 29:1, 2 Chronicles 35:4, Ezra 2:62, Nehemiah 8:14, Nehemiah 9:4, Esther 5:12, Psalms 74:2, Ecclesiastes 7:25, Isaiah 8:4, Isaiah 37:2, Isaiah 41:18, Isaiah 44:8, Isaiah 56:5, Isaiah 59:13, Jeremiah 4:5, Jeremiah 7:30, Jeremiah 9:19, Jeremiah 10:7, Jeremiah 26:12, Jeremiah 27:7, Jeremiah 34:8, Jeremiah 35:6, Jeremiah 41:6, Jeremiah 48:38, Jeremiah 51:2, Jeremiah 52:21, Ezekiel 13:11, Ezekiel 13:15, Ezekiel 16:3, Ezekiel 24:23, Ezekiel 26:14, Ezekiel 33:9, Daniel 9:19, Daniel 10:7, Amos 4:2, Micah 3:3, Micah 7:4, Habakkuk 2:1, Matthew 2:8, Matthew 6:30, Matthew 8:32, Matthew 11:5, Matthew 13:54, Matthew 15:30, Mark 6:34, Mark 8:17, Mark 9:1, Mark 9:20, Mark 12:34, Luke 3:5, Luke 16:3, Luke 22:66, John 3:26, John 7:39, John 12:6, John 21:3, Acts 4:24, Acts 7:10, Acts 11:28, Acts 17:3, Acts 17:13, Acts 19:12, Acts 22:24, Acts 24:10, Romans 12:8, 1 Corinthians 14:26, 2 Corinthians 4:6, Galatians 2:4, Ephesians 4:13, Philippians 4:12, 2 Timothy 2:19, James 1:25, 2 Peter 2:10, 2 John 1:7, Genesis 3:24, Genesis 7:4, Genesis 8:11, Genesis 16:3, Genesis 18:10, Genesis 22:12, Genesis 24:53, Genesis 24:60, Genesis 28:4, Genesis 31:12, Genesis 35:11, Genesis 44:26, Exodus 12:31, Exodus 24:7, Exodus 35:19, Leviticus 7:38, Leviticus 9:22, Leviticus 13:56, Leviticus 14:37, Numbers 4:31, Numbers 6:15, Numbers 7:23, Numbers 7:77, Numbers 11:11, Numbers 24:16, Deuteronomy 9:19, Deuteronomy 12:14, Deuteronomy 16:2, Deuteronomy 18:14, Deuteronomy 24:13, Deuteronomy 28:54, Deuteronomy 32:8, Joshua 7:2, Joshua 9:21, Joshua 22:17, Judges 9:25, Judges 16:19, Judges 20:2, Judges 20:15, 1 Samuel 3:9, 1 Samuel 4:1, 1 Samuel 10:14, 1 Samuel 12:7, 2 Samuel 15:27, 2 Samuel 18:17, 2 Samuel 24:20, 1 Kings 4:19, 1 Kings 8:21, 1 Kings 22:11, 2 Kings 2:10, 2 Kings 4:2, 2 Kings 4:8, 2 Kings 6:28, 2 Kings 9:20, 2 Kings 19:25, 2 Kings 21:17, 2 Kings 24:18, 1 Chronicles 10:13, 1 Chronicles 12:23, 1 Chronicles 15:25, 1 Chronicles 16:35, 1 Chronicles 21:5, 1 Chronicles 21:13, 1 Chronicles 23:32, 2 Chronicles 4:13, 2 Chronicles 18:10, 2 Chronicles 21:9, 2 Chronicles 28:21, 2 Chronicles 31:4, Ezra 2:42, Ezra 7:23, Ezra 8:15, Ezra 8:28, Nehemiah 4:17, Job 32:6, Song of Solomon 2:3, Song of Solomon 5:6, Isaiah 1:13, Isaiah 5:19, Isaiah 8:8, Isaiah 26:14, Isaiah 26:18, Isaiah 43:1, Isaiah 45:3, Isaiah 45:19, Isaiah 50:10, Isaiah 59:10, Isaiah 60:4, Isaiah 63:17, Jeremiah 8:7, Jeremiah 11:21, Jeremiah 26:13, Jeremiah 27:6, Jeremiah 27:13, Jeremiah 27:22, Jeremiah 38:20, Jeremiah 51:39, Jeremiah 52:1, Ezekiel 3:23, Ezekiel 7:8, Ezekiel 7:20, Ezekiel 13:6, Ezekiel 17:21, Ezekiel 22:28, Ezekiel 25:9, Ezekiel 34:29, Ezekiel 36:35, Ezekiel 42:3, Ezekiel 48:11, Daniel 4:7, Hosea 9:1, Hosea 14:7, Joel 1:12, Amos 7:9, Matthew 4:18, Matthew 5:30, Matthew 12:18, Matthew 12:40, Matthew 25:21, Matthew 25:23, Matthew 26:47, Matthew 27:3, Mark 1:44, Mark 2:17, Mark 6:37, Luke 4:29, Luke 5:10, Luke 8:43, Luke 9:26, Luke 12:28, Luke 12:42, Luke 18:11, Luke 22:19, John 13:33, Acts 13:10, Romans 1:21, Galatians 2:7, 1 Timothy 2:9, Hebrews 9:23, 1 Peter 5:2, Jude 1:5, Revelation 6:4, Revelation 13:12, Revelation 14:8, Revelation 16:21, Revelation 17:14, Revelation 21:20, Genesis 5:29, Genesis 15:5, Genesis 17:13, Genesis 27:34, Genesis 29:32, Genesis 31:8, Genesis 43:9, Genesis 49:10, Exodus 15:9, Exodus 21:36, Exodus 26:10, Exodus 37:16, Exodus 39:14, Leviticus 3:3, Leviticus 21:14, Leviticus 22:27, Leviticus 25:35, Leviticus 26:17, Numbers 4:41, Numbers 5:6, Numbers 7:35, Numbers 7:47, Numbers 7:65, Numbers 7:87, Numbers 8:26, Numbers 12:8, Numbers 14:11, Numbers 30:11, Deuteronomy 3:4, Deuteronomy 13:18, Deuteronomy 24:15, Deuteronomy 29:29, Joshua 5:7, Joshua 15:63, Joshua 18:3, Joshua 23:12, Judges 1:19, Judges 2:2, Judges 4:15, Judges 7:7, Judges 13:19, Ruth 1:21, Ruth 2:10, 1 Samuel 6:2, 1 Samuel 9:26, 1 Samuel 14:28, 1 Samuel 17:9, 1 Samuel 17:17, 1 Samuel 22:5, 1 Samuel 30:24, 2 Samuel 3:31, 2 Samuel 15:8, 2 Samuel 17:2, 1 Kings 3:18, 1 Kings 3:21, 1 Kings 4:33, 1 Kings 13:25, 1 Kings 22:45, 2 Kings 6:12, 2 Kings 8:14, 2 Kings 16:6, 2 Kings 24:16, 1 Chronicles 6:54, 1 Chronicles 9:12, 2 Chronicles 1:14, 2 Chronicles 7:1, 2 Chronicles 25:12, Ezra 2:2, Ezra 2:68, Ezra 5:1, Nehemiah 2:20, Esther 3:1, Esther 6:3, Job 2:2, Song of Solomon 2:14, Isaiah 7:3, Isaiah 21:2, Isaiah 28:1, Isaiah 37:16, Isaiah 37:21, Isaiah 44:16, Isaiah 60:13, Isaiah 64:2, Jeremiah 19:5, Jeremiah 24:6, Jeremiah 27:21, Jeremiah 42:1, Jeremiah 48:12, Jeremiah 50:12, Jeremiah 50:18, Lamentations 1:16, Lamentations 4:6, Ezekiel 3:15, Ezekiel 3:19, Ezekiel 4:5, Ezekiel 8:10, Ezekiel 10:1, Ezekiel 12:2, Ezekiel 22:12, Ezekiel 25:6, Ezekiel 32:21, Ezekiel 37:11, Ezekiel 39:15, Ezekiel 47:13, Daniel 2:6, Daniel 3:1, Daniel 8:27, Hosea 8:7, Hosea 13:8, Joel 3:17, Joel 3:19, Amos 1:14, Jonah 1:7, Nahum 3:15, Malachi 3:11, Matthew 10:23, Matthew 13:44, Matthew 14:13, Mark 5:4, Mark 6:3, Mark 10:38, Mark 12:43, Luke 3:4, Luke 4:35, Luke 7:37, Luke 9:42, Luke 21:23, John 5:24, John 14:21, John 18:15, Acts 4:21, Acts 14:17, Acts 18:8, Acts 21:34, Acts 23:11, Acts 24:21, Acts 28:25, Romans 2:15, Romans 7:6, Romans 15:4, 1 Corinthians 4:9, Ephesians 6:9, 1 Thessalonians 2:9, 1 Thessalonians 4:6, 2 Timothy 4:3, James 1:27, James 5:3, 1 Peter 1:13, 1 Peter 4:3, 2 Peter 2:21, 2 Peter 3:4, Revelation 2:23, Revelation 17:1, Revelation 17:16, Revelation 19:9, Revelation 20:9, Genesis 9:15, Genesis 14:13, Genesis 18:28, Genesis 27:25, Genesis 28:15, Genesis 32:9, Genesis 37:7, Genesis 40:13, Genesis 41:14, Genesis 41:35, Genesis 48:13, Exodus 3:7, Exodus 5:1, Exodus 23:27, Exodus 24:8, Leviticus 2:4, Leviticus 4:14, Leviticus 15:3, Numbers 28:3, Numbers 29:8, Numbers 29:12, Numbers 30:7, Deuteronomy 6:15, Deuteronomy 7:12, Deuteronomy 11:25, Deuteronomy 17:9, Deuteronomy 29:13, Deuteronomy 32:13, Joshua 3:6, Joshua 24:19, Joshua 24:26, Judges 1:21, Judges 3:27, Judges 18:18, 1 Samuel 1:15, 1 Samuel 12:12, 1 Samuel 13:12, 1 Samuel 13:22, 1 Samuel 20:6, 1 Samuel 20:31, 1 Samuel 24:6, 2 Samuel 3:14, 2 Samuel 10:5, 2 Samuel 10:16, 2 Samuel 13:36, 2 Samuel 21:7, 1 Kings 7:6, 1 Kings 18:18, 1 Kings 22:32, 2 Kings 8:8, 2 Kings 13:1, 2 Kings 15:35, 2 Kings 21:12, 1 Chronicles 1:50, 1 Chronicles 15:28, 1 Chronicles 17:1, 2 Chronicles 2:17, 2 Chronicles 11:1, 2 Chronicles 16:6, 2 Chronicles 18:18, 2 Chronicles 20:22, 2 Chronicles 22:8, 2 Chronicles 25:14, Ezra 4:13, Psalms 32:5, Ecclesiastes 1:16, Isaiah 5:5, Isaiah 19:2, Isaiah 30:27, Isaiah 42:6, Isaiah 45:23, Jeremiah 1:16, Jeremiah 4:29, Jeremiah 13:22, Jeremiah 22:13, Jeremiah 28:16, Jeremiah 31:4, Jeremiah 38:7, Jeremiah 48:15, Jeremiah 51:56, Ezekiel 20:26, Ezekiel 21:26, Ezekiel 22:29, Ezekiel 23:35, Ezekiel 33:21, Ezekiel 40:19, Ezekiel 47:4, Daniel 1:7, Daniel 5:20, Daniel 7:13, Hosea 13:3, Micah 1:13, Zechariah 1:8, Zechariah 1:11, Zechariah 9:13, Matthew 2:6, Matthew 12:4, Matthew 20:21, Matthew 20:30, Matthew 26:64, Mark 6:20, Luke 1:22, Luke 4:41, Luke 6:4, Luke 10:2, Luke 10:35, Luke 16:24, Luke 17:6, John 3:8, John 4:23, John 12:38, Acts 5:37, Acts 17:11, 1 Corinthians 3:13, 1 Corinthians 10:27, 1 Corinthians 13:2, 1 Corinthians 15:15, 2 Corinthians 2:4, 2 Corinthians 7:9, 2 Corinthians 12:11, Ephesians 2:11, Colossians 1:24, 1 Thessalonians 3:5, 1 Thessalonians 4:15, Hebrews 6:1, Hebrews 11:12, 1 Peter 3:16, Revelation 14:9, Revelation 21:12, Genesis 6:13, Genesis 17:8, Genesis 46:29, Genesis 48:20, Genesis 50:8, Exodus 7:15, Exodus 18:1, Exodus 26:37, Exodus 28:41, Exodus 30:6, Exodus 34:11, Leviticus 3:5, Leviticus 8:25, Leviticus 10:7, Leviticus 13:57, Leviticus 21:23, Leviticus 25:6, Numbers 5:7, Numbers 5:20, Numbers 7:53, Numbers 26:2, Numbers 26:20, Deuteronomy 2:22, Deuteronomy 7:4, Deuteronomy 7:22, Deuteronomy 19:4, Joshua 3:8, Joshua 18:5, Judges 14:17, Judges 16:29, 1 Samuel 3:13, 1 Samuel 11:2, 1 Samuel 12:20, 1 Samuel 15:33, 1 Samuel 23:19, 2 Samuel 4:10, 2 Samuel 5:3, 2 Samuel 20:2, 2 Samuel 20:19, 1 Kings 3:9, 1 Kings 4:31, 1 Kings 14:24, 1 Kings 16:19, 2 Kings 9:2, 2 Kings 10:31, 2 Kings 13:6, 2 Kings 23:36, 1 Chronicles 5:18, 1 Chronicles 9:33, 1 Chronicles 15:17, 1 Chronicles 29:18, 2 Chronicles 29:19, 2 Chronicles 33:13, 2 Chronicles 34:11, 2 Chronicles 36:20, Esther 8:1, Psalms 57:1, Psalms 59:16, Psalms 75:8, Ecclesiastes 7:15, Ecclesiastes 12:4, Isaiah 1:26, Isaiah 3:5, Isaiah 21:9, Isaiah 25:6, Isaiah 33:14, Isaiah 34:10, Isaiah 35:7, Isaiah 36:18, Isaiah 43:23, Isaiah 49:13, Isaiah 53:3, Jeremiah 2:28, Jeremiah 6:12, Jeremiah 6:20, Jeremiah 10:16, Jeremiah 13:7, Jeremiah 34:13, Jeremiah 50:39, Jeremiah 51:19, Ezekiel 1:11, Ezekiel 4:4, Ezekiel 18:13, Ezekiel 41:25, Daniel 2:47, Daniel 2:48, Daniel 6:16, Jonah 1:6, Jonah 4:11, Micah 5:5, Zephaniah 1:1, Zephaniah 3:15, Haggai 2:2, Zechariah 11:17, Matthew 5:29, Matthew 16:23, Matthew 26:24, Matthew 28:7, Mark 4:32, Mark 10:29, Mark 12:19, Mark 13:14, Luke 18:31, Luke 19:8, Luke 20:37, John 15:19, Acts 5:28, Acts 7:4, Acts 13:38, Acts 17:26, Acts 19:21, Acts 23:18, Acts 28:15, 1 Corinthians 9:10, 2 Corinthians 4:18, 1 Thessalonians 2:8, 2 Thessalonians 1:4, 2 Thessalonians 2:2, 1 Timothy 6:10, 2 Timothy 1:10, James 1:12, 1 John 3:12, Revelation 1:7, Revelation 3:10, Revelation 4:10, Revelation 14:6, Revelation 17:12, Genesis 6:17, Genesis 13:14, Genesis 24:43, Genesis 24:67, Genesis 26:28, Genesis 37:20, Genesis 39:6, Genesis 42:34, Genesis 43:14, Genesis 44:17, Genesis 49:6, Exodus 1:14, Exodus 4:6, Exodus 9:23, Exodus 9:33, Exodus 14:17, Exodus 26:19, Exodus 26:35, Exodus 29:13, Exodus 37:17, Exodus 38:26, Exodus 39:3, Exodus 39:32, Leviticus 12:5, Leviticus 16:12, Leviticus 21:6, Leviticus 23:2, Leviticus 24:10, Numbers 3:12, Numbers 7:17, Numbers 7:59, Numbers 13:22, Numbers 14:33, Numbers 23:19, Numbers 25:4, Numbers 28:9, Numbers 30:16, Deuteronomy 1:3, Deuteronomy 9:1, Deuteronomy 10:6, Deuteronomy 12:20, Deuteronomy 17:6, Deuteronomy 18:20, Deuteronomy 22:22, Deuteronomy 33:7, Deuteronomy 34:1, Joshua 8:21, Joshua 13:16, Joshua 15:1, Joshua 19:49, Judges 4:17, Judges 13:14, Judges 14:8, Ruth 3:14, 1 Samuel 3:6, 1 Samuel 9:22, 1 Samuel 14:17, 1 Samuel 14:40, 1 Samuel 17:1, 1 Samuel 22:3, 1 Samuel 30:17, 2 Samuel 2:5, 2 Samuel 15:10, 2 Samuel 18:4, 2 Samuel 18:27, 2 Samuel 21:15, 2 Samuel 21:16, 1 Kings 16:26, 2 Kings 5:12, 2 Kings 14:11, 2 Kings 15:9, 2 Kings 17:23, 2 Kings 24:8, 1 Chronicles 11:13, 1 Chronicles 29:7, 2 Chronicles 29:8, 2 Chronicles 34:14, Ezra 6:11, Nehemiah 5:12, Nehemiah 8:12, Nehemiah 12:38, Job 1:12, Ecclesiastes 10:20, Isaiah 7:8, Isaiah 13:11, Isaiah 23:15, Isaiah 30:20, Isaiah 40:31, Isaiah 53:5, Isaiah 59:6, Isaiah 59:17, Jeremiah 4:22, Jeremiah 6:26, Jeremiah 9:2, Jeremiah 10:20, Jeremiah 13:14, Jeremiah 17:3, Jeremiah 17:24, Jeremiah 29:17, Lamentations 2:16, Ezekiel 5:1, Ezekiel 11:5, Ezekiel 25:16, Ezekiel 31:4, Ezekiel 35:3, Ezekiel 39:27, Ezekiel 43:19, Ezekiel 46:5, Daniel 11:38, Hosea 10:13, Hosea 12:11, Joel 3:8, Micah 1:6, Zephaniah 2:3, Zechariah 14:20, Mark 2:12, Mark 8:23, Luke 8:24, Luke 12:46, Luke 13:7, Luke 16:8, Luke 16:15, John 12:42, Acts 7:5, Acts 16:3, Romans 8:3, Romans 11:11, Romans 12:1, 1 Corinthians 4:8, 1 Corinthians 9:13, Philippians 2:12, Philippians 2:15, 1 Thessalonians 2:16, Hebrews 7:28, Hebrews 8:11, 2 Peter 1:17, 1 John 2:1, Revelation 1:5, Revelation 6:5, Revelation 7:17, Revelation 10:7, Revelation 22:9, Genesis 1:14, Genesis 4:23, Genesis 9:5, Genesis 9:11, Genesis 40:8, Genesis 46:5, Genesis 48:5, Exodus 13:14, Exodus 14:20, Exodus 14:21, Exodus 14:25, Leviticus 2:14, Leviticus 8:23, Leviticus 13:13, Leviticus 15:33, Leviticus 23:20, Leviticus 25:16, Leviticus 26:13, Numbers 4:9, Numbers 4:33, Numbers 4:37, Numbers 14:3, Numbers 14:24, Numbers 15:26, Numbers 18:32, Numbers 20:6, Numbers 21:26, Numbers 32:28, Deuteronomy 10:10, Deuteronomy 15:14, Deuteronomy 20:6, Deuteronomy 27:4, Joshua 9:27, Joshua 18:9, Judges 16:24, Ruth 1:12, 1 Samuel 6:17, 2 Samuel 4:11, 2 Samuel 8:14, 2 Samuel 10:17, 2 Samuel 16:5, 2 Samuel 20:7, 1 Kings 3:23, 1 Kings 4:24, 1 Kings 7:12, 1 Kings 10:26, 1 Kings 11:4, 1 Kings 12:6, 1 Kings 14:22, 1 Kings 16:15, 1 Kings 19:2, 1 Kings 21:10, 1 Kings 22:3, 2 Kings 1:11, 2 Kings 9:14, 2 Kings 10:2, 2 Kings 10:8, 2 Kings 10:17, 2 Kings 14:23, 2 Kings 23:31, 2 Kings 25:22, 1 Chronicles 18:8, 1 Chronicles 21:8, 1 Chronicles 21:24, 1 Chronicles 22:2, 2 Chronicles 1:5, 2 Chronicles 10:6, 2 Chronicles 16:2, 2 Chronicles 20:2, 2 Chronicles 31:18, Ezra 8:36, Nehemiah 3:7, Nehemiah 4:22, Nehemiah 11:12, Psalms 27:6, Psalms 53:5, Psalms 78:8, Ecclesiastes 5:1, Isaiah 3:9, Isaiah 9:12, Isaiah 10:2, Isaiah 19:23, Isaiah 30:17, Isaiah 34:17, Isaiah 39:4, Isaiah 41:17, Isaiah 44:7, Isaiah 45:9, Isaiah 45:11, Isaiah 49:10, Isaiah 60:11, Jeremiah 2:20, Jeremiah 7:13, Jeremiah 12:1, Jeremiah 15:15, Jeremiah 21:1, Jeremiah 25:5, Jeremiah 29:2, Jeremiah 31:19, Jeremiah 32:5, Jeremiah 48:18, Jeremiah 50:5, Lamentations 2:12, Ezekiel 20:7, Ezekiel 21:3, Ezekiel 21:31, Ezekiel 23:17, Ezekiel 27:24, Ezekiel 29:16, Ezekiel 36:12, Ezekiel 39:18, Ezekiel 43:2, Ezekiel 47:19, Daniel 3:14, Daniel 4:8, Daniel 11:41, Hosea 7:1, Hosea 12:1, Amos 5:22, Jonah 1:12, Jonah 1:14, Jonah 3:8, Zechariah 3:5, Zechariah 14:8, Matthew 16:19, Matthew 26:45, Mark 9:18, Mark 10:39, Mark 11:2, Mark 15:36, Mark 16:18, Luke 1:13, Luke 24:19, John 7:23, John 12:34, John 14:9, John 19:15, Acts 3:2, Acts 3:10, Acts 5:34, Acts 10:38, Acts 23:27, Acts 25:6, Acts 26:24, Acts 28:7, Romans 8:9, 2 Corinthians 7:14, Ephesians 4:14, 1 Thessalonians 2:17, Hebrews 8:6, 1 Peter 3:18, 1 Peter 4:6, 2 Peter 3:12, 1 John 3:2, Revelation 5:11, Revelation 13:8, Revelation 20:8, Genesis 14:5, Genesis 14:7, Genesis 31:41, Genesis 31:52, Genesis 35:3, Genesis 38:12, Genesis 41:15, Genesis 41:36, Genesis 42:25, Genesis 45:10, Exodus 4:31, Exodus 14:2, Exodus 22:6, Exodus 38:23, Leviticus 15:15, Leviticus 26:41, Numbers 7:71, Numbers 16:26, Numbers 18:6, Numbers 21:3, Numbers 22:30, Numbers 22:31, Numbers 22:32, Numbers 31:28, Deuteronomy 1:27, Deuteronomy 4:36, Deuteronomy 8:18, Deuteronomy 11:21, Deuteronomy 12:7, Deuteronomy 15:11, Deuteronomy 17:10, Deuteronomy 22:26, Deuteronomy 25:2, Joshua 19:27, Joshua 19:34, Judges 1:17, Judges 7:2, Judges 14:4, Judges 18:25, 1 Samuel 6:7, 1 Samuel 25:3, 1 Samuel 30:26, 2 Samuel 1:2, 2 Samuel 2:32, 2 Samuel 16:23, 2 Samuel 17:27, 1 Kings 2:9, 1 Kings 6:7, 1 Kings 7:18, 1 Kings 13:24, 1 Kings 21:7, 2 Kings 3:17, 2 Kings 9:1, 2 Kings 10:7, 2 Kings 16:11, 2 Kings 17:29, 1 Chronicles 5:24, 2 Chronicles 2:8, 2 Chronicles 32:23, 2 Chronicles 32:30, 2 Chronicles 33:16, Ezra 2:70, Nehemiah 12:22, Psalms 31:19, Isaiah 5:30, Isaiah 13:8, Isaiah 28:19, Isaiah 30:22, Isaiah 30:32, Isaiah 44:5, Isaiah 56:3, Isaiah 57:11, Jeremiah 9:3, Jeremiah 14:9, Jeremiah 19:6, Jeremiah 23:36, Jeremiah 42:10, Jeremiah 43:9, Jeremiah 44:29, Jeremiah 50:34, Lamentations 1:8, Lamentations 1:10, Lamentations 1:22, Ezekiel 5:4, Ezekiel 16:31, Ezekiel 16:46, Ezekiel 16:63, Ezekiel 20:27, Ezekiel 20:30, Ezekiel 24:27, Ezekiel 33:2, Ezekiel 41:19, Ezekiel 47:17, Daniel 3:25, Daniel 6:8, Daniel 10:13, Hosea 1:7, Hosea 2:23, Hosea 4:3, Hosea 7:12, Joel 2:26, Amos 5:3, Amos 9:4, Amos 9:5, Obadiah 1:3, Zechariah 9:1, Zechariah 10:10, Matthew 18:9, Mark 14:1, Luke 2:25, Luke 4:40, Luke 11:29, Luke 14:26, Luke 22:52, John 2:15, John 7:35, John 19:11, Acts 1:8, Acts 4:16, Acts 5:10, Romans 3:19, Romans 13:3, 1 Corinthians 14:16, 2 Corinthians 1:4, Galatians 6:1, Ephesians 2:2, 1 Thessalonians 1:8, 1 Thessalonians 5:3, 2 Timothy 1:9, Hebrews 2:10, 1 Peter 2:12, 2 Peter 3:9, Revelation 1:4, Revelation 2:7, Revelation 13:4, Revelation 16:2, Revelation 20:13, Genesis 16:11, Genesis 19:28, Genesis 20:5, Genesis 26:29, Genesis 29:25, Genesis 29:34, Genesis 44:8, Exodus 6:7, Exodus 10:14, Exodus 12:14, Exodus 13:13, Exodus 16:10, Exodus 23:23, Exodus 30:18, Exodus 32:23, Exodus 34:1, Exodus 34:24, Leviticus 9:15, Leviticus 10:9, Leviticus 11:4, Leviticus 14:18, Leviticus 16:10, Numbers 3:25, Numbers 13:2, Numbers 20:5, Numbers 30:2, Numbers 32:9, Numbers 34:11, Deuteronomy 3:27, Deuteronomy 7:5, Deuteronomy 10:11, Deuteronomy 11:19, Deuteronomy 12:2, Deuteronomy 20:20, Deuteronomy 26:17, Joshua 8:6, Joshua 10:19, Joshua 11:16, Joshua 17:10, Joshua 24:1, Judges 2:15, Judges 20:36, 1 Samuel 1:19, 1 Samuel 4:21, 2 Samuel 4:5, 2 Samuel 14:20, 1 Kings 6:16, 1 Kings 7:25, 1 Kings 7:29, 1 Kings 8:30, 1 Kings 11:13, 1 Kings 11:24, 1 Kings 16:13, 2 Kings 8:18, 2 Kings 8:27, 2 Kings 13:11, 2 Kings 17:11, 2 Kings 20:3, 2 Kings 22:18, 1 Chronicles 7:28, 1 Chronicles 17:17, 2 Chronicles 4:4, 2 Chronicles 5:10, 2 Chronicles 18:21, 2 Chronicles 21:6, 2 Chronicles 33:22, 2 Chronicles 34:26, 2 Chronicles 36:13, Nehemiah 13:1, Nehemiah 13:21, Esther 4:5, Esther 4:7, Esther 7:3, Ecclesiastes 2:16, Ecclesiastes 3:11, Isaiah 1:6, Isaiah 3:6, Isaiah 9:21, Isaiah 26:9, Isaiah 30:15, Isaiah 37:26, Isaiah 40:2, Isaiah 47:12, Isaiah 51:9, Jeremiah 2:24, Jeremiah 4:11, Jeremiah 7:2, Jeremiah 11:16, Jeremiah 14:13, Jeremiah 25:20, Jeremiah 26:23, Jeremiah 31:21, Jeremiah 51:47, Jeremiah 51:48, Lamentations 1:4, Ezekiel 3:3, Ezekiel 13:10, Ezekiel 14:23, Ezekiel 20:34, Ezekiel 22:31, Ezekiel 28:12, Ezekiel 32:18, Ezekiel 33:32, Ezekiel 35:5, Ezekiel 42:1, Ezekiel 48:28, Daniel 2:49, Hosea 1:6, Hosea 2:2, Amos 4:1, Amos 4:11, Micah 3:6, Micah 4:7, Nahum 1:3, Habakkuk 2:19, Zechariah 9:14, Matthew 3:3, Matthew 8:28, Matthew 26:31, Mark 14:21, Luke 8:13, Luke 9:13, John 3:2, John 10:12, John 11:31, John 16:32, Acts 6:7, Acts 9:40, Acts 16:4, 1 Corinthians 12:3, 1 Corinthians 15:54, 2 Corinthians 1:1, 2 Corinthians 6:2, 2 Corinthians 11:12, Galatians 3:8, Ephesians 1:18, 1 Timothy 6:12, Hebrews 4:7, 1 Peter 2:5, Revelation 7:11, Revelation 14:2, Revelation 17:17, Revelation 21:6, Genesis 11:9, Genesis 18:32, Genesis 22:7, Genesis 31:35, Genesis 33:5, Genesis 37:14, Genesis 41:45, Genesis 41:46, Exodus 7:4, Exodus 9:4, Exodus 12:30, Exodus 20:11, Exodus 28:35, Exodus 29:12, Exodus 29:25, Exodus 30:4, Exodus 34:15, Exodus 37:18, Leviticus 9:18, Leviticus 13:12, Leviticus 13:45, Leviticus 14:31, Leviticus 15:30, Leviticus 16:11, Leviticus 18:30, Leviticus 22:22, Leviticus 24:9, Leviticus 26:1, Leviticus 26:26, Leviticus 27:23, Numbers 7:41, Numbers 15:28, Numbers 16:17, Numbers 21:1, Numbers 28:2, Deuteronomy 1:36, Deuteronomy 3:28, Deuteronomy 16:10, Deuteronomy 19:3, Deuteronomy 20:3, Deuteronomy 21:15, Deuteronomy 24:16, Deuteronomy 30:3, Deuteronomy 31:27, Joshua 16:10, Joshua 18:11, Joshua 20:5, Joshua 24:14, Judges 5:23, Judges 9:7, Judges 9:31, Judges 11:31, Judges 16:23, Judges 20:40, Ruth 1:8, Ruth 1:19, Ruth 2:3, Ruth 2:7, Ruth 3:7, 1 Samuel 12:5, 1 Samuel 14:15, 1 Samuel 15:3, 1 Samuel 19:22, 1 Samuel 27:3, 1 Samuel 30:8, 2 Samuel 2:21, 2 Samuel 23:13, 1 Kings 1:30, 1 Kings 3:12, 1 Kings 5:7, 1 Kings 16:29, 2 Kings 4:40, 2 Kings 13:3, 2 Kings 17:17, 2 Kings 22:12, 1 Chronicles 6:78, 1 Chronicles 10:9, 2 Chronicles 8:16, 2 Chronicles 11:17, 2 Chronicles 35:16, Ezra 8:16, Ezra 9:6, Nehemiah 1:2, Nehemiah 3:8, Nehemiah 4:19, Nehemiah 9:22, Job 1:3, Psalms 10:14, Ecclesiastes 5:6, Ecclesiastes 6:12, Song of Solomon 4:1, Isaiah 7:2, Isaiah 11:2, Isaiah 28:18, Isaiah 28:21, Isaiah 34:11, Isaiah 42:11, Jeremiah 11:12, Jeremiah 13:21, Jeremiah 31:18, Jeremiah 32:28, Jeremiah 37:3, Jeremiah 42:6, Jeremiah 50:21, Ezekiel 10:16, Ezekiel 12:4, Ezekiel 18:17, Ezekiel 26:19, Ezekiel 33:28, Ezekiel 46:7, Daniel 4:37, Daniel 5:5, Daniel 8:12, Daniel 10:20, Daniel 11:37, Hosea 10:12, Joel 2:3, Obadiah 1:11, Zechariah 11:5, Zechariah 12:1, Zechariah 12:3, Malachi 4:6, Matthew 6:24, Matthew 20:23, Matthew 23:34, Matthew 25:20, Mark 3:5, Mark 8:33, Mark 10:46, Mark 11:17, Luke 4:23, Luke 8:37, Luke 10:40, Luke 17:31, Luke 19:11, Luke 20:19, Luke 23:2, John 16:7, John 18:20, Acts 13:34, Acts 20:16, Romans 8:23, Romans 8:26, Romans 9:17, 1 Corinthians 16:15, Galatians 2:6, Galatians 6:12, Colossians 1:9, Hebrews 11:23, Hebrews 13:21, James 2:5, Revelation 18:8, Revelation 21:9, Genesis 4:25, Genesis 19:1, Genesis 24:10, Genesis 24:35, Genesis 26:4, Genesis 28:12, Genesis 30:30, Genesis 44:32, Genesis 47:11, Exodus 6:25, Exodus 9:3, Exodus 12:11, Exodus 14:11, Exodus 17:14, Exodus 28:21, Exodus 29:9, Exodus 29:42, Leviticus 4:12, Leviticus 11:44, Leviticus 15:11, Leviticus 17:11, Leviticus 23:41, Leviticus 24:11, Numbers 3:45, Numbers 8:16, Numbers 16:13, Numbers 35:28, Deuteronomy 13:10, Deuteronomy 21:18, Joshua 7:6, Joshua 7:9, Joshua 22:13, Judges 8:18, Judges 13:8, Ruth 1:1, Ruth 1:22, Ruth 2:18, Ruth 4:15, 1 Samuel 19:24, 1 Samuel 20:1, 1 Samuel 23:7, 1 Samuel 28:23, 2 Samuel 7:12, 2 Samuel 9:2, 2 Samuel 11:4, 2 Samuel 11:27, 2 Samuel 18:31, 1 Kings 3:28, 1 Kings 7:42, 1 Kings 9:11, 1 Kings 9:22, 1 Kings 20:14, 2 Kings 4:35, 2 Kings 8:13, 2 Kings 17:32, 2 Kings 18:9, 2 Kings 20:15, 2 Kings 24:20, 1 Chronicles 17:27, 1 Chronicles 19:7, 2 Chronicles 23:6, 2 Chronicles 24:18, 2 Chronicles 29:5, Nehemiah 2:10, Nehemiah 3:30, Nehemiah 7:7, Nehemiah 7:70, Nehemiah 12:45, Psalms 5:10, Psalms 44:3, Ecclesiastes 11:3, Isaiah 14:13, Isaiah 30:19, Isaiah 34:4, Isaiah 38:5, Isaiah 48:20, Isaiah 59:19, Isaiah 60:5, Isaiah 60:16, Isaiah 60:19, Jeremiah 18:6, Jeremiah 27:5, Jeremiah 27:9, Jeremiah 29:22, Jeremiah 33:21, Lamentations 1:18, Ezekiel 7:4, Ezekiel 16:41, Ezekiel 19:9, Ezekiel 23:15, Ezekiel 26:2, Ezekiel 29:15, Ezekiel 32:15, Ezekiel 33:15, Ezekiel 40:3, Ezekiel 45:11, Daniel 2:40, Daniel 6:22, Habakkuk 3:6, Zechariah 6:12, Matthew 4:23, Matthew 9:2, Matthew 11:11, Matthew 13:22, Matthew 26:39, Mark 9:12, Luke 5:12, Luke 7:32, Luke 11:42, Luke 13:28, John 6:27, John 17:8, John 20:26, Acts 12:4, Acts 18:6, Acts 24:23, Acts 27:7, Romans 11:17, Romans 14:4, 1 Corinthians 7:28, 1 Corinthians 8:6, 2 Corinthians 11:23, 2 Peter 1:1, Revelation 1:1, Revelation 19:2, Genesis 1:29, Genesis 18:5, Genesis 23:13, Genesis 50:24, Exodus 14:9, Exodus 15:17, Exodus 16:18, Exodus 26:5, Exodus 29:34, Exodus 29:36, Exodus 30:21, Exodus 35:24, Leviticus 8:33, Numbers 7:84, Numbers 9:17, Numbers 9:18, Numbers 14:22, Numbers 18:16, Numbers 27:7, Deuteronomy 1:1, Deuteronomy 6:7, Deuteronomy 7:15, Deuteronomy 11:29, Deuteronomy 34:9, Joshua 3:1, Ruth 3:15, 1 Samuel 1:1, 1 Samuel 2:16, 1 Samuel 8:7, 1 Samuel 10:24, 1 Samuel 14:33, 1 Samuel 31:12, 2 Samuel 13:4, 2 Samuel 16:4, 2 Samuel 18:14, 1 Kings 6:5, 1 Kings 7:30, 1 Kings 8:6, 1 Kings 8:38, 1 Kings 8:54, 1 Kings 15:7, 1 Kings 18:33, 1 Kings 21:11, 1 Kings 22:17, 2 Kings 9:22, 2 Kings 11:8, 2 Kings 15:14, 2 Kings 17:21, 1 Chronicles 12:15, 1 Chronicles 14:10, 1 Chronicles 14:15, 1 Chronicles 28:13, 2 Chronicles 6:21, 2 Chronicles 11:14, 2 Chronicles 18:16, 2 Chronicles 20:27, 2 Chronicles 20:34, 2 Chronicles 23:17, 2 Chronicles 32:8, 2 Chronicles 34:32, Ezra 6:6, Ezra 7:11, Nehemiah 6:14, Nehemiah 8:13, Nehemiah 9:11, Esther 2:23, Psalms 31:11, Psalms 141:5, Ecclesiastes 2:10, Isaiah 10:6, Isaiah 19:11, Isaiah 26:19, Isaiah 29:7, Isaiah 39:1, Isaiah 41:16, Isaiah 44:28, Isaiah 45:13, Isaiah 47:15, Jeremiah 2:13, Jeremiah 4:10, Jeremiah 4:19, Jeremiah 7:23, Jeremiah 13:17, Jeremiah 23:7, Jeremiah 27:11, Jeremiah 28:3, Jeremiah 39:18, Jeremiah 42:5, Jeremiah 51:62, Ezekiel 1:1, Ezekiel 4:2, Ezekiel 16:4, Ezekiel 20:43, Ezekiel 23:8, Ezekiel 35:6, Daniel 11:11, Daniel 11:31, Hosea 8:14, Amos 1:3, Micah 7:3, Haggai 1:11, Matthew 11:21, Matthew 17:5, Matthew 18:28, Mark 6:22, Luke 1:20, Luke 5:24, Luke 11:24, Luke 19:22, John 6:51, John 13:26, John 19:12, Acts 1:16, Romans 16:2, 1 Corinthians 2:14, 1 Corinthians 7:36, 1 Corinthians 14:21, Hebrews 13:9, Revelation 4:5, Revelation 10:1, Revelation 11:10, Genesis 13:7, Genesis 19:16, Genesis 20:13, Genesis 31:37, Genesis 42:13, Genesis 43:29, Exodus 2:14, Exodus 4:7, Exodus 8:8, Exodus 17:5, Exodus 19:13, Exodus 19:18, Exodus 26:4, Exodus 34:28, Numbers 2:17, Numbers 9:7, Numbers 34:13, Deuteronomy 4:23, Deuteronomy 7:24, Deuteronomy 13:13, Deuteronomy 30:5, Deuteronomy 31:13, Joshua 15:19, Judges 2:7, Judges 2:10, Judges 8:24, Judges 11:27, Judges 11:39, Judges 19:8, Judges 20:32, 1 Samuel 5:7, 1 Samuel 24:3, 1 Samuel 26:23, 2 Samuel 6:22, 2 Samuel 17:29, 1 Kings 1:35, 1 Kings 10:7, 1 Kings 14:31, 1 Kings 15:13, 1 Kings 18:25, 1 Kings 20:12, 2 Kings 3:14, 2 Kings 3:24, 2 Kings 6:30, 2 Kings 8:21, 2 Kings 22:8, 1 Chronicles 16:40, 2 Chronicles 5:7, 2 Chronicles 8:8, 2 Chronicles 9:18, 2 Chronicles 9:21, 2 Chronicles 13:3, 2 Chronicles 22:5, 2 Chronicles 24:13, 2 Chronicles 36:4, Nehemiah 2:6, Job 1:10, Psalms 138:2, Song of Solomon 1:4, Song of Solomon 3:11, Isaiah 2:21, Isaiah 36:6, Isaiah 38:8, Isaiah 48:16, Isaiah 62:1, Isaiah 64:7, Jeremiah 2:23, Jeremiah 3:18, Jeremiah 11:13, Jeremiah 16:3, Jeremiah 18:15, Jeremiah 29:19, Jeremiah 44:6, Jeremiah 49:29, Ezekiel 16:5, Ezekiel 18:21, Ezekiel 27:11, Ezekiel 44:4, Ezekiel 48:15, Daniel 11:27, Joel 2:16, Nahum 3:5, Habakkuk 1:12, Habakkuk 3:13, Matthew 9:35, Matthew 12:32, Matthew 21:12, Matthew 25:24, Mark 2:16, Mark 9:42, Mark 12:28, Mark 15:43, Luke 2:4, Luke 20:10, Luke 20:46, Luke 22:61, John 4:42, John 16:25, John 21:25, Acts 1:11, Acts 7:38, Acts 10:33, Acts 11:19, Acts 19:38, Romans 8:5, Romans 9:11, 2 Corinthians 10:2, 2 Corinthians 13:2, Galatians 3:10, Ephesians 2:3, Ephesians 5:5, Hebrews 9:14, Hebrews 10:8, Hebrews 11:5, James 1:11, James 4:4, 1 Peter 2:20, 1 John 1:1, Revelation 10:4, Genesis 14:17, Genesis 18:2, Genesis 36:39, Genesis 39:8, Exodus 10:19, Exodus 25:32, Leviticus 5:17, Leviticus 6:5, Leviticus 25:31, Numbers 7:3, Numbers 20:28, Numbers 22:11, Numbers 27:17, Deuteronomy 28:36, Deuteronomy 29:25, Deuteronomy 32:27, Joshua 2:9, Joshua 2:16, Joshua 4:23, Joshua 9:12, Judges 12:9, Judges 19:11, Ruth 1:6, 1 Samuel 2:22, 1 Samuel 4:2, 1 Samuel 14:11, 1 Samuel 18:10, 1 Samuel 23:14, 2 Samuel 12:21, 2 Samuel 19:19, 2 Samuel 20:17, 1 Kings 7:17, 2 Kings 2:8, 2 Kings 8:26, 2 Kings 9:7, 2 Kings 24:15, 2 Chronicles 31:17, 2 Chronicles 34:7, 2 Chronicles 36:16, Ezra 4:19, Nehemiah 2:1, Nehemiah 12:37, Nehemiah 13:18, Esther 1:3, Ecclesiastes 1:13, Ecclesiastes 12:3, Isaiah 22:18, Isaiah 31:2, Isaiah 38:17, Isaiah 44:24, Isaiah 47:14, Isaiah 49:19, Isaiah 58:7, Isaiah 64:6, Jeremiah 5:5, Jeremiah 16:14, Jeremiah 23:10, Jeremiah 29:8, Jeremiah 33:12, Jeremiah 51:64, Lamentations 4:15, Ezekiel 11:12, Ezekiel 15:7, Ezekiel 19:12, Ezekiel 21:29, Ezekiel 26:8, Ezekiel 27:3, Ezekiel 32:16, Ezekiel 40:40, Daniel 2:18, Daniel 7:1, Daniel 9:23, Hosea 13:14, Amos 4:5, Obadiah 1:13, Jonah 4:5, Micah 5:7, Nahum 2:3, Habakkuk 3:8, Zephaniah 1:12, Zechariah 4:12, Zechariah 7:5, Zechariah 8:6, Zechariah 10:7, Matthew 11:19, Matthew 27:29, Mark 2:22, Mark 6:14, Luke 1:5, Luke 3:14, Luke 16:13, John 4:10, Acts 2:14, Acts 7:34, Acts 7:52, Acts 16:13, Acts 16:26, Acts 18:14, Acts 21:13, Acts 26:26, 1 Corinthians 8:7, Hebrews 9:7, Hebrews 9:24, Hebrews 12:27, Revelation 7:1, Revelation 10:8, Revelation 17:3, Revelation 22:19, Genesis 10:19, Genesis 17:17, Genesis 24:15, Genesis 32:32, Genesis 37:9, Genesis 48:17, Exodus 20:4, Exodus 30:20, Exodus 40:15, Leviticus 1:2, Leviticus 4:26, Leviticus 6:18, Leviticus 8:28, Leviticus 9:9, Leviticus 10:16, Leviticus 13:32, Leviticus 19:23, Numbers 9:20, Numbers 23:7, Deuteronomy 7:26, Deuteronomy 11:8, Deuteronomy 19:14, Deuteronomy 26:19, Joshua 6:4, Joshua 6:22, Joshua 6:24, Joshua 12:5, Joshua 13:23, Joshua 21:2, Joshua 22:18, Judges 6:2, Judges 9:36, 1 Samuel 2:5, 2 Samuel 13:34, 2 Samuel 19:18, 1 Kings 2:28, 1 Kings 7:16, 1 Kings 13:3, 1 Kings 14:9, 1 Kings 14:11, 1 Kings 17:14, 1 Kings 22:19, 2 Kings 17:41, 1 Chronicles 2:3, 1 Chronicles 14:8, 2 Chronicles 2:6, 2 Chronicles 9:6, 2 Chronicles 20:12, 2 Chronicles 20:26, 2 Chronicles 34:24, 2 Chronicles 36:21, Ezra 5:5, Ecclesiastes 2:7, Ecclesiastes 2:8, Isaiah 7:17, Isaiah 10:26, Isaiah 17:3, Isaiah 30:18, Isaiah 38:3, Isaiah 42:25, Isaiah 53:2, Jeremiah 21:10, Jeremiah 25:34, Jeremiah 34:15, Jeremiah 37:13, Jeremiah 50:33, Jeremiah 52:3, Ezekiel 47:10, Daniel 5:13, Daniel 11:10, Daniel 11:20, Hosea 4:12, Amos 6:1, Amos 8:8, Micah 6:2, Habakkuk 2:8, Zechariah 11:7, Zechariah 11:9, Matthew 19:29, Matthew 21:15, Mark 14:43, Luke 15:4, Acts 3:12, Acts 4:13, Acts 12:11, Acts 13:50, Acts 20:28, Acts 22:25, Acts 22:29, 2 Corinthians 4:4, 2 Corinthians 9:2, 2 Thessalonians 1:3, 2 Timothy 1:12, Revelation 5:5, Revelation 16:18, Revelation 21:4, Revelation 22:17, Genesis 4:15, Genesis 13:9, Genesis 26:9, Genesis 47:26, Exodus 5:21, Exodus 6:13, Exodus 19:16, Exodus 26:33, Exodus 34:34, Exodus 37:9, Exodus 39:20, Leviticus 4:20, Leviticus 9:24, Leviticus 11:42, Leviticus 13:58, Numbers 3:27, Numbers 5:30, Numbers 26:35, Numbers 26:57, Numbers 36:6, Deuteronomy 2:4, Deuteronomy 5:8, Deuteronomy 16:19, Deuteronomy 18:10, Deuteronomy 21:4, Joshua 12:3, Judges 3:9, Judges 10:18, Judges 14:13, Judges 15:2, Judges 15:13, 1 Samuel 10:16, 1 Samuel 12:19, 1 Samuel 14:43, 1 Samuel 15:11, 1 Samuel 16:23, 1 Samuel 19:17, 1 Samuel 23:17, 1 Samuel 25:35, 2 Samuel 14:25, 2 Samuel 15:18, 2 Samuel 18:11, 1 Kings 6:32, 1 Kings 22:30, 2 Kings 2:21, 2 Kings 3:19, 2 Kings 9:11, 1 Chronicles 9:1, 1 Chronicles 17:7, 1 Chronicles 17:8, 1 Chronicles 22:13, 2 Chronicles 4:12, 2 Chronicles 7:11, 2 Chronicles 11:16, 2 Chronicles 20:14, 2 Chronicles 26:16, 2 Chronicles 32:26, Ezra 5:16, Ezra 7:9, Ezra 8:18, Nehemiah 4:16, Job 1:8, Psalms 106:7, Isaiah 6:5, Isaiah 7:20, Isaiah 10:20, Isaiah 16:5, Isaiah 19:17, Isaiah 21:3, Isaiah 23:17, Isaiah 52:1, Jeremiah 4:7, Jeremiah 23:3, Jeremiah 29:26, Jeremiah 32:40, Jeremiah 35:8, Jeremiah 49:28, Jeremiah 50:6, Jeremiah 51:6, Lamentations 1:15, Ezekiel 20:15, Ezekiel 21:21, Ezekiel 32:26, Ezekiel 44:25, Ezekiel 45:8, Daniel 2:2, Daniel 7:24, Hosea 3:5, Joel 2:5, Nahum 3:17, Habakkuk 1:13, Habakkuk 3:2, Zephaniah 3:17, Haggai 2:13, Zechariah 1:12, Zechariah 12:7, Matthew 4:21, Matthew 17:12, Matthew 21:9, Mark 2:4, Mark 10:30, Luke 10:27, Luke 18:14, Luke 18:22, Luke 19:44, John 11:54, Acts 2:38, Acts 3:25, Acts 18:25, Acts 27:2, Acts 27:17, Romans 16:25, 1 Corinthians 11:6, 1 Corinthians 16:12, 2 Corinthians 1:8, Hebrews 9:11, 1 John 2:8, Revelation 3:3, Revelation 9:2, Genesis 24:3, Genesis 24:32, Genesis 31:33, Genesis 37:28, Genesis 45:23, Exodus 3:12, Exodus 18:12, Exodus 25:31, Exodus 34:35, Leviticus 1:9, Leviticus 11:35, Leviticus 11:40, Leviticus 14:6, Leviticus 14:7, Leviticus 26:39, Numbers 4:28, Numbers 9:6, Numbers 25:13, Numbers 35:6, Deuteronomy 1:25, Deuteronomy 6:11, Deuteronomy 10:8, Deuteronomy 11:18, Deuteronomy 14:2, Deuteronomy 16:18, Deuteronomy 30:19, Deuteronomy 32:24, Joshua 4:9, Joshua 5:5, Joshua 11:17, Joshua 16:1, Joshua 20:7, Judges 1:15, Judges 2:20, Judges 6:27, Judges 8:3, Judges 11:37, 1 Samuel 8:8, 1 Samuel 14:20, 1 Samuel 17:40, 1 Samuel 18:30, 1 Samuel 30:1, 2 Samuel 5:17, 2 Samuel 7:9, 2 Samuel 7:19, 2 Samuel 14:24, 2 Samuel 18:24, 1 Kings 4:12, 1 Kings 7:9, 1 Kings 12:7, 1 Kings 18:24, 2 Kings 5:13, 2 Kings 10:1, 2 Kings 12:12, 2 Kings 18:12, 2 Kings 18:21, 1 Chronicles 25:4, 2 Chronicles 16:1, 2 Chronicles 20:10, 2 Chronicles 32:13, Ezra 10:13, Nehemiah 11:25, Isaiah 3:16, Isaiah 4:1, Isaiah 10:12, Isaiah 14:29, Isaiah 17:11, Isaiah 25:11, Isaiah 31:8, Isaiah 40:24, Isaiah 41:25, Isaiah 43:24, Isaiah 48:5, Jeremiah 12:13, Jeremiah 21:13, Jeremiah 24:5, Jeremiah 25:26, Jeremiah 32:2, Jeremiah 38:16, Jeremiah 39:14, Ezekiel 16:53, Ezekiel 18:30, Ezekiel 40:36, Ezekiel 47:5, Ezekiel 47:8, Daniel 2:25, Daniel 6:3, Daniel 8:17, Daniel 9:14, Joel 2:19, Joel 3:16, Amos 1:6, Amos 8:2, Malachi 2:13, Matthew 13:19, Matthew 18:12, Mark 14:12, Mark 14:41, Luke 16:26, John 1:33, John 12:16, John 14:28, Acts 4:32, Acts 8:32, Acts 19:29, Acts 27:33, Romans 2:1, Romans 6:4, Romans 11:25, 1 Corinthians 3:10, 1 Corinthians 12:28, Colossians 2:2, 1 Timothy 4:6, Hebrews 6:18, 1 John 3:1, 1 John 3:8, Revelation 2:5, Revelation 10:6, Revelation 15:8, Genesis 29:13, Genesis 33:1, Genesis 43:21, Genesis 45:27, Exodus 2:23, Exodus 7:9, Exodus 14:4, Exodus 19:12, Exodus 21:19, Exodus 29:41, Exodus 39:5, Leviticus 8:35, Leviticus 27:6, Numbers 4:49, Numbers 6:9, Numbers 14:43, Numbers 20:1, Numbers 20:24, Deuteronomy 5:23, Deuteronomy 7:9, Deuteronomy 28:30, Deuteronomy 29:1, Joshua 9:9, Joshua 11:3, Judges 6:8, Judges 6:35, Ruth 3:3, 1 Samuel 6:6, 1 Samuel 9:5, 1 Samuel 9:7, 1 Samuel 14:1, 1 Samuel 15:23, 1 Samuel 18:22, 1 Samuel 23:5, 2 Samuel 14:33, 2 Samuel 23:18, 1 Kings 1:41, 2 Kings 2:23, 2 Kings 5:6, 2 Kings 19:21, 2 Kings 20:9, 2 Kings 24:7, 1 Chronicles 12:1, 1 Chronicles 20:5, 2 Chronicles 6:29, 2 Chronicles 32:1, 2 Chronicles 35:5, Ezra 8:21, Ezra 9:4, Nehemiah 9:37, Nehemiah 13:6, Esther 6:2, Job 2:10, Ecclesiastes 7:14, Isaiah 40:28, Isaiah 47:1, Isaiah 47:10, Isaiah 61:6, Jeremiah 5:1, Jeremiah 6:6, Jeremiah 23:22, Jeremiah 25:27, Jeremiah 29:6, Jeremiah 29:16, Jeremiah 31:10, Jeremiah 32:19, Jeremiah 42:16, Jeremiah 51:30, Ezekiel 3:7, Ezekiel 12:13, Ezekiel 23:22, Ezekiel 29:10, Ezekiel 30:6, Ezekiel 33:10, Ezekiel 37:6, Ezekiel 41:3, Ezekiel 43:14, Daniel 7:5, Daniel 8:8, Daniel 11:14, Amos 8:11, Obadiah 1:12, Micah 7:1, Zephaniah 3:19, Zechariah 10:1, Zechariah 14:13, Matthew 5:25, Matthew 5:32, Matthew 9:18, Luke 2:36, Luke 8:27, Luke 8:28, John 21:6, Acts 23:30, Acts 27:40, Galatians 3:16, Philippians 1:20, Philippians 4:18, 1 Thessalonians 2:14, 2 Timothy 4:17, 1 Peter 3:21, 1 Peter 5:10, Genesis 1:24, Genesis 4:14, Genesis 14:8, Genesis 23:6, Genesis 24:47, Genesis 29:2, Genesis 38:9, Genesis 39:14, Genesis 40:5, Genesis 41:48, Exodus 3:1, Exodus 6:1, Exodus 7:16, Exodus 28:27, Leviticus 4:30, Leviticus 5:10, Leviticus 22:2, Numbers 1:38, Numbers 10:33, Numbers 13:29, Numbers 14:34, Numbers 22:34, Numbers 25:8, Numbers 26:54, Numbers 31:8, Deuteronomy 5:1, Deuteronomy 11:30, Deuteronomy 21:14, Deuteronomy 29:2, Deuteronomy 33:2, Joshua 10:23, Joshua 10:32, Joshua 22:20, Joshua 24:13, Judges 16:27, Judges 16:28, Judges 17:8, Judges 21:8, Ruth 2:2, Ruth 3:10, 1 Samuel 2:20, 1 Samuel 3:8, 1 Samuel 11:5, 1 Samuel 13:6, 1 Samuel 14:49, 2 Samuel 1:21, 2 Samuel 13:15, 2 Samuel 16:10, 2 Samuel 24:25, 1 Kings 4:21, 1 Kings 7:21, 1 Kings 16:11, 1 Kings 17:13, 1 Kings 20:1, 1 Kings 22:52, 2 Kings 10:33, 2 Kings 17:27, 2 Kings 19:35, 2 Kings 21:6, 2 Kings 22:4, 1 Chronicles 19:18, 1 Chronicles 27:25, 2 Chronicles 6:24, 2 Chronicles 6:36, 2 Chronicles 11:21, 2 Chronicles 19:4, 2 Chronicles 31:21, 2 Chronicles 32:4, 2 Chronicles 34:10, Ezra 3:3, Ezra 4:7, Nehemiah 2:16, Nehemiah 9:30, Ecclesiastes 7:26, Isaiah 1:18, Isaiah 5:14, Isaiah 29:23, Isaiah 33:23, Isaiah 37:22, Isaiah 40:22, Isaiah 55:10, Isaiah 55:11, Isaiah 58:8, Jeremiah 7:28, Jeremiah 23:9, Jeremiah 44:18, Jeremiah 46:5, Jeremiah 50:4, Jeremiah 50:13, Lamentations 1:12, Lamentations 2:22, Ezekiel 14:3, Ezekiel 14:16, Ezekiel 23:39, Ezekiel 28:7, Ezekiel 30:11, Ezekiel 30:24, Ezekiel 34:6, Daniel 8:5, Micah 6:7, Micah 7:6, Zechariah 14:16, Matthew 12:41, Mark 1:27, Mark 10:42, Mark 11:13, Luke 9:16, Luke 11:32, John 8:28, John 14:10, John 17:24, John 18:18, Acts 19:26, Acts 23:3, Romans 4:12, 2 Corinthians 3:3, 2 Corinthians 8:22, Philippians 3:9, Colossians 2:8, Titus 3:3, 1 John 1:3, Revelation 22:6, Genesis 3:16, Genesis 23:9, Genesis 27:45, Genesis 42:36, Genesis 43:23, Exodus 7:17, Exodus 29:5, Exodus 37:25, Leviticus 6:2, Leviticus 19:34, Leviticus 23:3, Leviticus 26:6, Numbers 6:17, Numbers 8:21, Numbers 14:40, Numbers 15:38, Numbers 28:12, Numbers 33:52, Deuteronomy 11:28, Deuteronomy 16:4, Deuteronomy 24:3, Deuteronomy 24:8, Deuteronomy 28:22, Deuteronomy 32:46, Joshua 6:6, Joshua 18:28, Judges 1:35, Judges 5:15, Judges 11:29, Judges 16:15, Judges 19:23, Judges 20:33, 1 Samuel 8:11, 1 Samuel 10:11, 1 Samuel 28:20, 2 Samuel 5:24, 2 Samuel 7:11, 2 Samuel 9:6, 2 Samuel 15:21, 2 Samuel 15:25, 2 Samuel 17:18, 2 Samuel 19:17, 1 Kings 9:8, 1 Kings 14:26, 2 Kings 11:11, 2 Kings 16:17, 2 Kings 18:16, 2 Kings 23:26, 2 Chronicles 3:4, 2 Chronicles 23:7, 2 Chronicles 28:1, 2 Chronicles 32:32, Nehemiah 2:7, Esther 8:14, Job 2:12, Song of Solomon 7:12, Song of Solomon 8:5, Isaiah 4:4, Isaiah 17:10, Isaiah 28:2, Isaiah 49:18, Isaiah 51:17, Isaiah 52:15, Isaiah 55:7, Isaiah 56:11, Isaiah 62:11, Jeremiah 22:6, Jeremiah 40:14, Ezekiel 6:12, Ezekiel 8:1, Ezekiel 15:6, Ezekiel 23:40, Ezekiel 31:6, Ezekiel 42:12, Ezekiel 43:3, Hosea 5:1, Amos 6:8, Jonah 1:8, Habakkuk 1:8, Matthew 2:9, Matthew 11:25, Matthew 23:13, Matthew 24:43, Luke 9:48, Luke 16:25, John 4:14, John 10:18, John 19:6, John 21:20, Acts 7:35, Acts 13:15, Acts 20:7, Acts 24:25, Acts 26:22, Romans 12:2, 2 Corinthians 12:19, Philippians 4:15, Colossians 1:6, Colossians 2:23, Hebrews 10:34, 1 Peter 5:5, Revelation 2:24, Revelation 3:5, Revelation 8:3, Revelation 16:19, Genesis 1:11, Genesis 9:10, Genesis 24:40, Genesis 27:27, Genesis 37:35, Exodus 8:5, Exodus 15:16, Exodus 17:7, Exodus 21:6, Exodus 24:3, Exodus 25:20, Exodus 26:1, Exodus 31:6, Exodus 32:19, Exodus 32:29, Leviticus 12:2, Numbers 1:26, Numbers 1:40, Numbers 6:3, Numbers 8:22, Numbers 10:25, Numbers 35:15, Deuteronomy 9:16, Judges 4:18, Judges 8:5, Judges 9:51, Judges 20:6, 1 Samuel 1:22, 1 Samuel 22:14, 1 Samuel 26:8, 1 Samuel 28:1, 1 Samuel 31:9, 2 Samuel 14:17, 2 Samuel 17:17, 1 Kings 6:24, 1 Kings 18:40, 2 Kings 5:14, 2 Kings 17:36, 2 Kings 18:18, 1 Chronicles 7:29, 1 Chronicles 7:40, 1 Chronicles 26:30, 1 Chronicles 29:29, 2 Chronicles 1:17, 2 Chronicles 14:8, 2 Chronicles 16:4, 2 Chronicles 16:12, 2 Chronicles 25:15, 2 Chronicles 32:11, 2 Chronicles 32:14, 2 Chronicles 32:18, 2 Chronicles 33:3, Ezra 1:2, Nehemiah 2:12, Nehemiah 7:63, Nehemiah 8:1, Nehemiah 12:36, Psalms 40:5, Song of Solomon 8:6, Isaiah 11:6, Isaiah 20:4, Isaiah 22:16, Isaiah 23:4, Isaiah 25:8, Isaiah 38:12, Isaiah 48:14, Isaiah 51:22, Isaiah 55:12, Isaiah 55:13, Isaiah 58:12, Isaiah 60:7, Jeremiah 13:27, Jeremiah 14:3, Jeremiah 29:3, Jeremiah 29:31, Jeremiah 44:3, Jeremiah 46:16, Jeremiah 48:32, Lamentations 1:5, Ezekiel 10:14, Ezekiel 13:13, Ezekiel 13:22, Ezekiel 30:9, Ezekiel 32:23, Ezekiel 38:11, Ezekiel 38:17, Ezekiel 40:44, Ezekiel 40:49, Daniel 9:4, Amos 6:14, Zechariah 2:11, Matthew 2:22, Matthew 8:9, Matthew 13:32, Matthew 13:52, Matthew 23:27, Mark 13:8, Luke 8:25, Luke 10:13, John 5:18, John 7:28, Acts 11:5, Acts 12:6, Acts 13:1, Acts 17:31, Acts 19:13, Romans 3:25, Romans 4:19, Romans 10:14, Romans 15:16, 2 Corinthians 2:3, 2 Corinthians 7:7, 1 Timothy 6:17, Hebrews 4:3, Hebrews 7:2, 1 John 5:6, Revelation 1:11, Revelation 8:5, Revelation 14:7, Genesis 19:19, Genesis 22:2, Genesis 22:9, Genesis 28:13, Genesis 30:38, Genesis 40:20, Genesis 49:30, Exodus 8:22, Exodus 11:1, Exodus 13:21, Exodus 15:1, Exodus 31:14, Exodus 39:1, Leviticus 5:9, Leviticus 5:12, Leviticus 10:1, Leviticus 11:10, Leviticus 16:34, Leviticus 24:23, Numbers 15:14, Numbers 16:42, Numbers 32:13, Numbers 32:22, Numbers 33:8, Deuteronomy 2:5, Deuteronomy 3:21, Deuteronomy 3:24, Deuteronomy 24:5, Joshua 2:11, Joshua 6:10, Joshua 19:1, Joshua 19:8, Joshua 22:23, Judges 11:33, 1 Samuel 2:13, 2 Samuel 1:12, 2 Samuel 6:3, 2 Samuel 6:17, 2 Samuel 9:11, 2 Samuel 12:8, 2 Samuel 12:19, 2 Samuel 17:12, 1 Kings 2:7, 1 Kings 2:31, 1 Kings 8:56, 2 Kings 2:9, 2 Kings 6:11, 2 Kings 10:9, 2 Kings 25:24, 1 Chronicles 2:55, 1 Chronicles 29:5, 2 Chronicles 5:6, 2 Chronicles 9:9, 2 Chronicles 18:29, 2 Chronicles 24:22, 2 Chronicles 32:22, Esther 8:3, Isaiah 19:20, Isaiah 34:16, Isaiah 42:24, Isaiah 54:9, Jeremiah 6:21, Jeremiah 8:13, Jeremiah 15:3, Jeremiah 26:10, Jeremiah 36:2, Jeremiah 38:1, Jeremiah 48:34, Lamentations 1:1, Lamentations 2:9, Ezekiel 11:7, Ezekiel 16:51, Ezekiel 17:16, Ezekiel 35:12, Ezekiel 41:12, Ezekiel 42:6, Daniel 4:21, Daniel 7:11, Amos 4:9, Jonah 1:10, Micah 1:11, Micah 2:12, Micah 3:5, Micah 7:10, Zephaniah 1:13, Malachi 3:3, Matthew 9:15, Matthew 27:19, Matthew 27:54, Luke 4:25, Luke 15:29, Luke 21:24, John 9:22, John 18:16, Acts 9:31, Acts 16:15, Acts 18:27, Acts 24:14, Acts 26:14, Romans 16:26, Colossians 3:16, 1 Thessalonians 1:5, 1 Thessalonians 2:2, 1 Thessalonians 4:16, 1 Timothy 1:16, Hebrews 8:8, Revelation 3:7, Revelation 7:14, Revelation 10:9, Revelation 12:12, Revelation 14:11, Revelation 18:21, Revelation 19:18, Revelation 20:10, Genesis 19:29, Genesis 30:14, Genesis 36:17, Genesis 37:25, Genesis 50:4, Exodus 14:12, Exodus 20:18, Exodus 30:13, Exodus 38:11, Exodus 38:24, Leviticus 7:29, Leviticus 12:7, Leviticus 26:22, Leviticus 26:45, Numbers 1:30, Numbers 11:33, Numbers 22:22, Numbers 28:26, Deuteronomy 5:5, Deuteronomy 5:16, Deuteronomy 6:1, Deuteronomy 6:10, Deuteronomy 7:6, Deuteronomy 7:16, Deuteronomy 8:1, Deuteronomy 9:26, Deuteronomy 17:14, Deuteronomy 20:17, Deuteronomy 26:15, Judges 19:29, Judges 20:39, 1 Samuel 4:10, 1 Samuel 13:3, 1 Samuel 14:22, 1 Samuel 17:49, 2 Samuel 2:16, 2 Samuel 10:14, 2 Samuel 23:5, 1 Kings 1:44, 1 Kings 8:53, 1 Kings 16:9, 1 Kings 20:29, 2 Kings 4:31, 2 Kings 7:16, 2 Kings 7:18, 2 Kings 19:10, 2 Chronicles 25:27, 2 Chronicles 31:12, 2 Chronicles 31:14, 2 Chronicles 32:12, Nehemiah 3:31, Esther 1:18, Esther 2:18, Esther 3:2, Psalms 68:30, Psalms 72:16, Song of Solomon 1:7, Isaiah 13:4, Isaiah 16:9, Isaiah 29:11, Isaiah 37:10, Isaiah 53:8, Isaiah 63:15, Isaiah 64:5, Jeremiah 6:19, Jeremiah 16:13, Jeremiah 20:9, Jeremiah 22:11, Jeremiah 23:33, Jeremiah 26:16, Jeremiah 32:36, Jeremiah 36:21, Jeremiah 39:9, Jeremiah 49:30, Lamentations 2:14, Ezekiel 6:14, Ezekiel 9:4, Ezekiel 14:20, Ezekiel 16:34, Ezekiel 17:20, Ezekiel 28:17, Ezekiel 37:12, Ezekiel 44:17, Daniel 6:17, Daniel 8:24, Daniel 9:15, Amos 7:1, Zechariah 10:5, Matthew 1:18, Luke 6:38, Luke 19:15, John 15:20, Acts 23:23, Romans 15:19, 1 Corinthians 9:20, Galatians 3:19, Hebrews 5:7, Hebrews 7:27, James 3:6, Revelation 4:6, Revelation 4:7, Genesis 24:48, Genesis 25:23, Genesis 33:13, Genesis 38:24, Genesis 41:12, Genesis 42:6, Exodus 9:25, Exodus 10:7, Exodus 13:19, Exodus 22:11, Exodus 23:12, Exodus 28:29, Exodus 30:12, Exodus 34:4, Leviticus 5:3, Leviticus 10:3, Leviticus 23:32, Numbers 1:28, Numbers 1:34, Numbers 1:36, Numbers 1:42, Numbers 2:3, Numbers 4:19, Numbers 8:17, Numbers 21:24, Numbers 31:16, Numbers 31:19, Deuteronomy 4:42, Deuteronomy 12:1, Deuteronomy 23:18, Deuteronomy 30:6, Deuteronomy 32:49, Joshua 2:14, Joshua 3:3, Joshua 7:25, Judges 3:19, Judges 3:24, Judges 3:25, Judges 19:15, Judges 21:19, 1 Samuel 22:22, 1 Samuel 24:8, 1 Samuel 28:7, 2 Samuel 18:29, 2 Samuel 24:4, 1 Kings 2:29, 1 Kings 8:8, 1 Kings 9:6, 1 Kings 9:21, 1 Kings 10:2, 1 Kings 13:22, 1 Kings 15:5, 1 Kings 19:20, 1 Kings 22:38, 2 Kings 4:43, 2 Kings 14:15, 1 Chronicles 18:11, 1 Chronicles 28:11, 2 Chronicles 5:9, 2 Chronicles 6:30, 2 Chronicles 17:8, 2 Chronicles 21:3, 2 Chronicles 33:11, 2 Chronicles 36:18, Ezra 6:17, Esther 3:4, Proverbs 27:10, Song of Solomon 1:6, Isaiah 2:19, Isaiah 15:5, Isaiah 27:1, Isaiah 42:22, Jeremiah 5:7, Lamentations 1:9, Ezekiel 5:10, Ezekiel 11:17, Ezekiel 14:21, Ezekiel 40:21, Ezekiel 41:11, Ezekiel 45:9, Daniel 5:3, Daniel 5:15, Daniel 11:18, Hosea 13:16, Matthew 11:23, Matthew 16:3, Mark 2:18, Mark 10:21, Luke 1:35, Luke 6:45, Luke 7:38, John 16:4, Acts 2:33, Acts 4:31, Acts 13:22, Acts 13:25, 1 Corinthians 9:15, 2 Corinthians 5:4, Colossians 4:12, 2 Timothy 2:21, James 5:12, 2 Peter 2:13, Revelation 13:2, Genesis 3:1, Genesis 17:19, Genesis 28:11, Genesis 30:16, Genesis 31:32, Genesis 33:14, Genesis 39:9, Genesis 43:16, Exodus 3:13, Exodus 16:15, Exodus 16:29, Exodus 19:24, Exodus 28:1, Leviticus 13:59, Leviticus 15:19, Leviticus 19:10, Leviticus 25:30, Numbers 8:7, Numbers 14:9, Numbers 34:4, Deuteronomy 3:13, Deuteronomy 8:15, Deuteronomy 11:24, Deuteronomy 22:6, Deuteronomy 26:10, Deuteronomy 33:16, Joshua 8:35, Joshua 22:22, Judges 17:10, Judges 18:10, 1 Samuel 2:29, 1 Samuel 2:33, 1 Samuel 5:3, 1 Samuel 16:13, 1 Samuel 26:7, 1 Samuel 27:9, 2 Samuel 1:6, 2 Samuel 3:22, 2 Samuel 10:18, 2 Samuel 13:10, 2 Samuel 23:8, 2 Kings 1:9, 2 Kings 2:12, 2 Kings 14:14, 2 Kings 17:9, 2 Kings 19:3, 2 Kings 19:6, 2 Kings 20:17, 1 Chronicles 6:32, 2 Chronicles 1:12, 2 Chronicles 6:14, 2 Chronicles 20:6, 2 Chronicles 21:7, 2 Chronicles 32:27, Nehemiah 2:3, Nehemiah 2:5, Nehemiah 2:17, Nehemiah 11:22, Nehemiah 12:43, Song of Solomon 4:8, Song of Solomon 5:1, Isaiah 1:23, Isaiah 29:13, Isaiah 39:6, Isaiah 41:26, Isaiah 43:14, Isaiah 63:9, Jeremiah 31:16, Lamentations 2:21, Ezekiel 1:26, Ezekiel 4:6, Ezekiel 7:9, Ezekiel 17:6, Ezekiel 18:6, Ezekiel 32:12, Ezekiel 47:2, Daniel 1:20, Daniel 9:17, Joel 2:11, Joel 2:13, Amos 2:7, Amos 2:9, Micah 7:18, Matthew 13:30, Matthew 26:55, Mark 6:48, Mark 9:25, Luke 5:36, Luke 7:8, Acts 3:16, Acts 4:27, Acts 12:7, 2 Corinthians 3:7, Ephesians 4:16, 1 Timothy 6:4, 1 John 2:19, Genesis 6:7, Genesis 17:20, Genesis 39:1, Genesis 44:4, Genesis 47:22, Exodus 4:18, Exodus 14:13, Exodus 24:4, Exodus 32:34, Exodus 33:13, Exodus 36:8, Leviticus 6:4, Leviticus 10:4, Leviticus 13:43, Leviticus 25:47, Numbers 1:1, Numbers 1:24, Numbers 16:14, Numbers 28:8, Numbers 34:14, Deuteronomy 2:37, Deuteronomy 3:18, Deuteronomy 7:2, Deuteronomy 12:10, Deuteronomy 15:10, Deuteronomy 30:1, Deuteronomy 32:14, Joshua 5:12, Joshua 6:15, Judges 8:10, Judges 9:38, Judges 18:9, 1 Samuel 9:19, 1 Samuel 10:25, 1 Samuel 20:27, 1 Samuel 21:8, 1 Samuel 26:6, 2 Samuel 2:1, 2 Samuel 4:7, 1 Kings 2:15, 1 Kings 2:39, 1 Kings 7:41, 1 Kings 11:21, 2 Kings 16:18, 2 Kings 23:29, 2 Kings 23:34, 1 Chronicles 28:12, 2 Chronicles 16:10, 2 Chronicles 23:3, 2 Chronicles 23:10, 2 Chronicles 25:19, 2 Chronicles 35:13, Job 1:19, Ecclesiastes 9:1, Isaiah 37:3, Isaiah 37:6, Isaiah 45:20, Isaiah 47:8, Isaiah 47:13, Jeremiah 2:2, Jeremiah 33:22, Jeremiah 34:20, Jeremiah 48:1, Lamentations 1:20, Lamentations 2:6, Ezekiel 10:11, Ezekiel 21:12, Ezekiel 41:22, Daniel 1:8, Daniel 3:10, Daniel 8:4, Hosea 8:13, Amos 2:6, Micah 7:14, Zephaniah 1:17, Haggai 2:14, Zechariah 9:5, Matthew 6:16, Matthew 21:16, Matthew 24:3, Mark 8:31, Luke 8:10, Acts 2:22, Acts 11:26, Acts 15:3, Acts 18:2, Acts 21:21, Acts 23:9, 2 Corinthians 9:5, Colossians 1:16, 1 Thessalonians 4:1, James 2:3, Jude 1:9, Revelation 13:10, Genesis 3:22, Genesis 11:4, Genesis 30:32, Genesis 31:18, Genesis 38:18, Genesis 44:18, Exodus 2:5, Exodus 8:24, Exodus 17:3, Exodus 18:10, Exodus 36:3, Leviticus 12:4, Leviticus 13:4, Leviticus 18:3, Leviticus 22:13, Numbers 7:1, Numbers 18:20, Numbers 23:3, Numbers 31:50, Deuteronomy 2:25, Deuteronomy 5:33, Deuteronomy 17:12, Deuteronomy 31:23, Joshua 7:11, Joshua 15:10, Joshua 15:13, Joshua 21:1, Judges 3:3, Judges 9:16, Judges 9:20, Judges 9:43, Judges 20:18, 1 Samuel 1:3, 1 Samuel 14:3, 1 Samuel 17:23, 1 Samuel 25:17, 1 Samuel 27:10, 2 Samuel 23:1, 1 Kings 8:35, 1 Kings 9:25, 1 Kings 17:1, 1 Kings 18:27, 2 Kings 1:12, 2 Kings 10:10, 2 Kings 22:5, 1 Chronicles 10:12, 2 Chronicles 3:8, 2 Chronicles 6:26, 2 Chronicles 12:15, 2 Chronicles 15:15, Ezra 3:13, Ezra 9:15, Ezra 10:18, Esther 1:14, Esther 6:10, Esther 9:24, Psalms 49:14, Ecclesiastes 2:21, Isaiah 37:33, Isaiah 51:16, Isaiah 58:9, Isaiah 61:11, Isaiah 65:1, Jeremiah 2:31, Jeremiah 12:5, Jeremiah 31:13, Jeremiah 38:14, Jeremiah 38:27, Lamentations 1:17, Ezekiel 23:4, Ezekiel 32:29, Ezekiel 36:20, Ezekiel 36:38, Ezekiel 41:15, Daniel 2:38, Daniel 12:10, Hosea 1:1, Amos 7:10, Amos 9:7, Zechariah 8:10, Zechariah 8:13, Zechariah 10:3, Matthew 3:11, Matthew 14:15, Matthew 21:19, Matthew 21:42, Mark 4:1, Luke 2:48, Luke 6:17, Luke 8:14, Luke 20:20, John 15:15, John 17:11, Acts 17:5, Acts 17:6, Acts 21:40, Acts 26:10, Romans 8:11, Romans 11:22, 2 Corinthians 11:9, 2 Corinthians 12:6, 2 Corinthians 12:7, Hebrews 12:25, Genesis 17:7, Genesis 22:17, Genesis 45:1, Genesis 50:10, Exodus 9:22, Leviticus 3:2, Leviticus 5:1, Numbers 3:36, Numbers 9:15, Numbers 16:5, Numbers 17:10, Numbers 32:1, Deuteronomy 25:11, Joshua 1:4, Joshua 10:20, Joshua 16:6, Joshua 21:4, Joshua 21:44, Judges 9:3, Judges 9:5, Judges 9:44, Judges 11:8, Judges 16:31, Judges 18:28, Judges 19:10, 1 Samuel 4:13, 1 Samuel 25:21, 1 Samuel 26:3, 2 Samuel 3:12, 1 Kings 10:12, 1 Kings 13:33, 1 Kings 18:13, 2 Kings 16:2, 2 Kings 16:14, 2 Kings 19:32, 2 Kings 23:33, 1 Chronicles 11:10, 1 Chronicles 17:9, 1 Chronicles 28:18, 2 Chronicles 9:20, 2 Chronicles 18:3, 2 Chronicles 28:27, Ezra 10:8, Nehemiah 9:35, Esther 2:21, Esther 9:13, Job 1:16, Psalms 69:4, Psalms 123:2, Isaiah 14:9, Isaiah 19:18, Isaiah 30:28, Isaiah 53:11, Isaiah 55:2, Jeremiah 14:22, Jeremiah 17:11, Jeremiah 30:19, Jeremiah 31:15, Jeremiah 36:26, Lamentations 4:22, Ezekiel 9:8, Ezekiel 23:45, Ezekiel 30:21, Ezekiel 37:14, Ezekiel 43:17, Daniel 3:5, Daniel 11:8, Joel 1:4, Luke 2:15, Luke 7:6, John 3:29, John 8:14, Acts 6:1, Acts 8:27, Acts 12:19, 1 Corinthians 15:27, Ephesians 2:12, Hebrews 11:13, James 5:11, Revelation 11:19, Revelation 13:15, Revelation 17:4, Genesis 27:33, Genesis 33:10, Exodus 2:3, Exodus 28:15, Exodus 32:15, Leviticus 1:3, Leviticus 6:25, Leviticus 14:48, Leviticus 17:13, Leviticus 19:22, Leviticus 22:25, Leviticus 23:10, Leviticus 27:10, Numbers 2:34, Numbers 21:5, Numbers 34:2, Deuteronomy 2:30, Deuteronomy 11:10, Deuteronomy 15:18, Deuteronomy 16:6, Deuteronomy 18:3, Deuteronomy 31:3, Joshua 21:6, Judges 4:11, Judges 11:34, Judges 15:12, Judges 19:1, Ruth 4:5, 1 Samuel 2:27, 2 Samuel 7:8, 1 Kings 13:21, 1 Kings 22:35, 2 Kings 2:15, 2 Kings 12:10, 1 Chronicles 6:60, 1 Chronicles 17:24, 1 Chronicles 29:6, 2 Chronicles 6:20, 2 Chronicles 9:12, 2 Chronicles 15:16, 2 Chronicles 20:31, Ezra 5:2, Nehemiah 1:3, Nehemiah 2:13, Nehemiah 5:11, Nehemiah 7:61, Nehemiah 9:15, Esther 4:1, Esther 6:6, Ecclesiastes 2:11, Isaiah 14:1, Isaiah 17:9, Isaiah 18:5, Isaiah 25:9, Isaiah 36:2, Isaiah 37:29, Isaiah 41:22, Isaiah 58:14, Isaiah 65:8, Jeremiah 5:14, Jeremiah 5:24, Jeremiah 7:18, Jeremiah 36:3, Jeremiah 44:27, Jeremiah 46:25, Jeremiah 49:10, Jeremiah 51:9, Lamentations 1:2, Ezekiel 2:3, Ezekiel 5:16, Ezekiel 16:7, Ezekiel 24:25, Ezekiel 31:8, Ezekiel 32:4, Ezekiel 36:15, Ezekiel 40:46, Ezekiel 45:15, Hosea 10:8, Amos 9:6, Malachi 2:14, Matthew 11:27, Matthew 21:31, Mark 14:72, Luke 12:37, Luke 14:31, John 13:1, Acts 27:21, 2 Corinthians 13:5, Revelation 19:15, Genesis 20:16, Genesis 21:17, Genesis 23:17, Genesis 30:40, Genesis 34:25, Genesis 38:16, Genesis 47:1, Exodus 12:13, Exodus 40:29, Leviticus 13:28, Leviticus 23:27, Leviticus 26:5, Numbers 16:47, Numbers 21:23, Deuteronomy 18:16, Deuteronomy 31:12, Joshua 8:2, Judges 19:24, Judges 21:10, 1 Samuel 10:21, 1 Samuel 26:15, 1 Samuel 30:12, 2 Samuel 11:2, 2 Samuel 18:5, 2 Samuel 23:11, 1 Kings 1:9, 1 Kings 1:38, 1 Kings 2:24, 1 Kings 6:38, 1 Kings 8:9, 1 Kings 9:15, 1 Kings 9:16, 1 Kings 12:18, 1 Kings 14:6, 2 Kings 19:28, 2 Kings 21:13, 1 Chronicles 12:38, 1 Chronicles 15:16, 1 Chronicles 15:24, 1 Chronicles 20:4, 1 Chronicles 26:28, 2 Chronicles 18:2, 2 Chronicles 21:19, 2 Chronicles 28:3, 2 Chronicles 30:17, Ezra 3:5, Ezra 8:29, Nehemiah 3:13, Nehemiah 8:6, Esther 3:15, Esther 5:9, Proverbs 24:12, Isaiah 17:13, Isaiah 23:13, Isaiah 23:18, Isaiah 36:7, Isaiah 44:11, Isaiah 44:15, Isaiah 48:8, Isaiah 61:9, Jeremiah 13:16, Jeremiah 31:7, Lamentations 2:3, Lamentations 2:10, Ezekiel 1:21, Ezekiel 14:9, Ezekiel 14:13, Ezekiel 20:3, Ezekiel 20:6, Ezekiel 30:13, Ezekiel 48:13, Daniel 5:10, Daniel 8:3, Daniel 11:7, Hosea 9:6, Micah 6:5, Habakkuk 2:6, Malachi 2:16, Matthew 3:16, Matthew 18:6, Luke 10:22, John 9:16, Acts 10:17, Acts 20:4, Acts 21:20, Acts 28:6, 1 Corinthians 6:9, 1 Corinthians 7:18, 1 Corinthians 12:10, 1 Corinthians 15:10, 2 Corinthians 1:6, James 5:4, 2 Peter 2:12, 1 John 3:10, Revelation 6:15, Genesis 3:8, Genesis 24:45, Genesis 29:3, Genesis 37:22, Exodus 10:2, Exodus 13:9, Exodus 14:10, Exodus 24:12, Exodus 36:6, Leviticus 17:10, Leviticus 21:21, Leviticus 24:3, Numbers 4:32, Numbers 14:2, Numbers 18:28, Numbers 19:21, Numbers 31:6, Numbers 36:7, Deuteronomy 15:6, Deuteronomy 17:19, Deuteronomy 22:29, Deuteronomy 24:7, Deuteronomy 28:25, Joshua 3:4, Joshua 9:18, Judges 19:16, Judges 21:12, Ruth 1:16, 1 Samuel 6:14, 1 Samuel 18:23, 1 Samuel 22:18, 2 Samuel 10:8, 2 Samuel 13:13, 2 Samuel 16:11, 2 Samuel 19:26, 2 Samuel 21:19, 1 Kings 8:5, 1 Kings 8:33, 2 Kings 2:4, 2 Kings 5:17, 2 Kings 9:19, 2 Kings 14:10, 2 Chronicles 6:41, 2 Chronicles 24:27, 2 Chronicles 36:10, Ezra 2:59, Song of Solomon 5:2, Isaiah 7:25, Isaiah 19:3, Isaiah 35:10, Isaiah 49:21, Isaiah 51:11, Isaiah 52:5, Isaiah 53:7, Isaiah 62:8, Isaiah 65:25, Jeremiah 6:16, Jeremiah 22:25, Jeremiah 33:24, Ezekiel 12:16, Ezekiel 16:61, Ezekiel 21:19, Ezekiel 28:23, Ezekiel 40:7, Daniel 4:14, Hosea 9:7, Jonah 4:6, Micah 2:3, Zephaniah 2:2, Matthew 2:11, Mark 15:1, Luke 3:8, Luke 6:35, Luke 21:12, Luke 23:14, John 5:19, John 12:3, John 20:2, Acts 13:43, Acts 16:14, 1 Corinthians 1:10, 2 Corinthians 3:18, 1 Timothy 5:4, Hebrews 12:2, Genesis 1:12, Genesis 42:7, Genesis 48:14, Exodus 12:16, Exodus 15:25, Exodus 29:27, Exodus 32:11, Leviticus 2:13, Leviticus 7:16, Numbers 3:31, Numbers 4:12, Numbers 9:10, Numbers 17:6, Numbers 17:8, Numbers 20:19, Numbers 22:18, Numbers 23:13, Numbers 29:13, Deuteronomy 21:17, Deuteronomy 22:2, Deuteronomy 28:64, Joshua 18:19, Judges 6:25, Judges 15:5, Judges 16:25, Judges 21:21, Ruth 3:13, 1 Samuel 14:21, 1 Samuel 15:12, 1 Samuel 23:11, 2 Samuel 7:27, 2 Samuel 17:16, 2 Samuel 17:25, 1 Kings 11:31, 1 Kings 13:11, 1 Kings 20:6, 1 Kings 22:4, 2 Kings 1:10, 2 Kings 6:23, 2 Kings 12:13, 1 Chronicles 9:22, 1 Chronicles 21:22, 2 Chronicles 13:8, 2 Chronicles 26:23, Nehemiah 3:25, Esther 8:15, Psalms 27:4, Isaiah 8:19, Isaiah 10:15, Isaiah 26:21, Isaiah 30:29, Isaiah 52:7, Isaiah 66:17, Jeremiah 6:1, Jeremiah 12:6, Jeremiah 23:17, Jeremiah 25:1, Jeremiah 34:18, Jeremiah 35:13, Jeremiah 42:2, Jeremiah 50:37, Jeremiah 51:33, Lamentations 2:1, Ezekiel 10:4, Ezekiel 19:14, Ezekiel 20:44, Ezekiel 25:13, Ezekiel 34:16, Ezekiel 44:2, Ezekiel 45:19, Hosea 7:16, Hosea 14:9, Amos 1:8, Nahum 3:10, Habakkuk 2:17, Haggai 2:12, Zechariah 1:16, Zechariah 8:3, Zechariah 8:23, Malachi 3:7, Matthew 5:13, Matthew 9:17, Matthew 13:23, Matthew 17:25, Mark 12:33, Mark 13:9, Luke 7:12, Acts 5:36, Acts 20:9, Romans 5:16, Romans 15:27, 1 Corinthians 6:13, Galatians 5:17, 1 Peter 1:2, 1 Peter 1:3, 1 Peter 3:20, Revelation 3:8, Genesis 2:5, Genesis 15:13, Genesis 20:6, Genesis 21:12, Genesis 26:3, Genesis 27:46, Genesis 42:16, Exodus 5:8, Exodus 11:3, Exodus 20:17, Exodus 35:29, Leviticus 1:13, Numbers 6:12, Numbers 18:30, Numbers 24:10, Deuteronomy 12:3, Deuteronomy 17:16, Deuteronomy 26:3, Joshua 8:19, Joshua 23:4, Judges 9:33, Judges 14:15, 1 Samuel 9:2, 1 Samuel 17:13, 1 Samuel 18:8, 1 Samuel 20:2, 1 Samuel 20:5, 1 Samuel 26:20, 2 Samuel 3:35, 2 Samuel 7:10, 2 Samuel 15:24, 2 Samuel 19:28, 2 Samuel 20:6, 1 Kings 1:45, 1 Kings 7:8, 1 Kings 13:32, 1 Kings 19:13, 1 Kings 20:27, 2 Kings 4:34, 2 Kings 5:5, 2 Kings 6:20, 2 Kings 9:5, 2 Kings 16:3, 2 Kings 17:16, 2 Kings 20:6, 2 Kings 24:14, 1 Chronicles 29:19, 2 Chronicles 1:3, 2 Chronicles 7:14, Ezra 4:17, Ezra 8:25, Esther 8:13, Isaiah 14:19, Isaiah 20:2, Isaiah 30:30, Isaiah 54:10, Isaiah 55:5, Jeremiah 5:28, Jeremiah 16:5, Jeremiah 17:13, Jeremiah 23:16, Jeremiah 25:10, Jeremiah 31:28, Jeremiah 36:30, Jeremiah 48:45, Jeremiah 49:5, Ezekiel 24:13, Ezekiel 39:7, Daniel 3:24, Daniel 9:13, Zechariah 7:7, Matthew 27:9, Mark 8:38, Mark 9:31, John 20:17, Acts 17:23, Acts 18:18, Romans 4:17, 1 Corinthians 11:22, 1 Thessalonians 3:6, Hebrews 9:26, Jude 1:6, Jude 1:7, Revelation 18:7, Genesis 20:7, Genesis 47:14, Genesis 47:24, Exodus 10:5, Exodus 32:4, Leviticus 1:5, Leviticus 20:24, Leviticus 27:16, Numbers 4:25, Numbers 8:12, Numbers 8:20, Numbers 9:21, Numbers 11:8, Numbers 13:20, Numbers 14:35, Numbers 19:2, Numbers 27:3, Numbers 30:5, Numbers 35:2, Deuteronomy 4:46, Deuteronomy 5:28, Deuteronomy 14:7, Deuteronomy 17:15, Deuteronomy 21:8, Deuteronomy 28:53, Joshua 5:4, Joshua 7:5, Joshua 14:9, Judges 11:26, 1 Samuel 6:8, 1 Samuel 16:5, 1 Samuel 18:5, 1 Samuel 21:6, 2 Samuel 18:22, 1 Kings 8:32, 1 Kings 10:22, 1 Kings 18:44, 2 Kings 2:6, 2 Kings 3:21, 2 Kings 6:25, 2 Kings 9:36, 2 Kings 19:26, 2 Kings 21:11, 2 Chronicles 6:23, Nehemiah 3:4, Nehemiah 6:7, Psalms 42:4, Ecclesiastes 9:9, Song of Solomon 3:4, Isaiah 9:6, Isaiah 10:24, Isaiah 30:23, Isaiah 37:27, Isaiah 42:5, Isaiah 46:7, Isaiah 49:25, Isaiah 57:6, Jeremiah 1:18, Jeremiah 14:12, Jeremiah 15:8, Jeremiah 15:20, Jeremiah 25:12, Jeremiah 36:7, Jeremiah 40:12, Jeremiah 41:18, Jeremiah 44:22, Ezekiel 4:14, Ezekiel 4:16, Ezekiel 9:3, Ezekiel 18:19, Ezekiel 30:12, Ezekiel 32:32, Ezekiel 36:17, Ezekiel 38:22, Ezekiel 39:4, Daniel 7:10, Hosea 2:13, Hosea 4:1, Hosea 9:15, Amos 9:8, Obadiah 1:1, Zephaniah 2:5, Zephaniah 3:6, Matthew 16:21, Luke 24:44, 1 Corinthians 7:14, 1 Corinthians 7:37, 2 Thessalonians 3:6, 2 Timothy 4:8, Hebrews 2:14, 1 John 2:14, Revelation 7:2, Revelation 11:13, Genesis 48:4, Exodus 16:16, Numbers 1:51, Numbers 11:12, Numbers 12:14, Numbers 15:39, Numbers 16:27, Numbers 17:2, Numbers 33:3, Deuteronomy 5:31, Deuteronomy 11:2, Deuteronomy 12:28, Deuteronomy 15:19, Deuteronomy 16:14, Deuteronomy 17:2, Deuteronomy 23:4, Joshua 5:14, Joshua 7:26, Joshua 17:14, Joshua 18:17, Joshua 21:32, Judges 3:8, Judges 9:27, Judges 15:1, 1 Samuel 1:23, 1 Samuel 7:1, 1 Samuel 28:9, 2 Samuel 6:16, 2 Samuel 16:3, 1 Kings 5:5, 1 Kings 8:39, 1 Kings 10:29, 1 Kings 15:20, 1 Kings 20:22, 2 Kings 11:12, 2 Kings 13:12, 1 Chronicles 19:19, 1 Chronicles 29:20, Nehemiah 6:16, Nehemiah 9:3, Esther 2:17, Esther 9:26, Isaiah 6:10, Isaiah 17:6, Isaiah 37:36, Isaiah 45:1, Isaiah 58:3, Isaiah 65:22, Isaiah 66:2, Jeremiah 3:6, Jeremiah 26:20, Jeremiah 27:20, Jeremiah 30:8, Jeremiah 32:14, Jeremiah 35:7, Jeremiah 38:9, Jeremiah 43:5, Jeremiah 48:33, Lamentations 1:3, Ezekiel 5:13, Ezekiel 7:13, Ezekiel 9:6, Ezekiel 14:11, Ezekiel 23:10, Ezekiel 23:29, Ezekiel 40:16, Ezekiel 47:18, Hosea 1:4, Hosea 2:12, Hosea 2:15, Obadiah 1:5, Jonah 3:7, Zechariah 4:10, Zechariah 5:9, Zechariah 11:13, Zechariah 12:12, Malachi 3:16, Matthew 24:29, Matthew 24:30, John 15:16, John 20:19, Acts 9:27, Acts 13:27, Acts 20:35, 2 Corinthians 5:12, Hebrews 2:17, Genesis 19:8, Genesis 44:20, Exodus 10:26, Exodus 12:4, Exodus 12:42, Leviticus 4:3, Leviticus 13:5, Leviticus 13:52, Leviticus 20:3, Leviticus 24:16, Numbers 21:22, Deuteronomy 5:24, Deuteronomy 19:9, Deuteronomy 21:16, Deuteronomy 28:13, Judges 3:10, Judges 13:20, Judges 16:20, 1 Samuel 6:5, 1 Samuel 15:15, 1 Samuel 17:55, 1 Samuel 25:25, 1 Samuel 27:8, 1 Kings 3:22, 1 Kings 16:16, 1 Kings 18:5, 1 Kings 22:39, 2 Kings 9:6, 2 Kings 13:7, 2 Kings 15:5, 2 Kings 20:14, 2 Kings 25:13, 1 Chronicles 19:6, 1 Chronicles 29:1, 2 Chronicles 11:23, 2 Chronicles 23:11, 2 Chronicles 27:2, Ezra 5:11, Nehemiah 5:7, Nehemiah 6:18, Isaiah 18:6, Isaiah 40:9, Isaiah 43:2, Isaiah 51:23, Isaiah 54:4, Isaiah 60:17, Jeremiah 17:4, Jeremiah 25:33, Jeremiah 26:21, Jeremiah 30:16, Jeremiah 31:20, Jeremiah 31:35, Jeremiah 47:3, Lamentations 2:20, Ezekiel 8:5, Ezekiel 12:6, Ezekiel 23:37, Ezekiel 30:22, Ezekiel 36:36, Ezekiel 37:22, Ezekiel 37:26, Ezekiel 44:24, Ezekiel 45:6, Ezekiel 46:19, Daniel 2:23, Hosea 1:2, Amos 6:2, Obadiah 1:20, Micah 1:5, Micah 5:6, Matthew 10:25, Mark 5:13, Mark 10:33, Luke 7:44, Luke 20:28, John 2:9, Acts 21:5, Acts 28:4, 2 Corinthians 1:12, 2 Thessalonians 2:13, Hebrews 2:8, James 5:7, 2 Peter 1:19, Revelation 14:3, Genesis 16:2, Genesis 19:14, Genesis 34:21, Genesis 42:33, Exodus 10:3, Exodus 10:13, Exodus 21:8, Exodus 34:18, Leviticus 10:12, Leviticus 13:49, Leviticus 27:8, Numbers 15:15, Numbers 18:2, Numbers 22:4, Numbers 24:13, Numbers 24:17, Numbers 26:58, Numbers 26:62, Numbers 28:24, Numbers 30:4, Numbers 31:47, Numbers 31:54, Deuteronomy 2:8, Deuteronomy 5:9, Joshua 8:18, Joshua 10:10, Joshua 17:3, Joshua 24:2, Judges 10:8, Judges 11:36, Judges 19:30, Ruth 4:1, Ruth 4:9, 1 Samuel 15:22, 2 Samuel 2:26, 2 Samuel 5:2, 2 Samuel 17:21, 2 Samuel 24:2, 1 Kings 8:29, 2 Kings 4:42, 2 Kings 6:18, 2 Kings 15:30, 1 Chronicles 17:6, 1 Chronicles 22:8, 2 Chronicles 29:18, 2 Chronicles 31:15, Ezra 5:12, Nehemiah 11:1, Song of Solomon 6:9, Isaiah 3:24, Isaiah 22:21, Isaiah 33:20, Isaiah 48:1, Jeremiah 3:13, Jeremiah 3:19, Jeremiah 12:4, Jeremiah 16:18, Jeremiah 18:23, Jeremiah 22:30, Lamentations 2:13, Ezekiel 1:4, Ezekiel 1:10, Ezekiel 26:7, Ezekiel 39:14, Ezekiel 43:18, Micah 5:2, Habakkuk 3:17, Zechariah 7:14, Matthew 23:35, Acts 5:9, Romans 13:4, 1 Peter 2:9, Jude 1:3, Jude 1:12, Revelation 12:4, Genesis 17:12, Genesis 26:22, Genesis 26:24, Genesis 27:41, Genesis 27:42, Genesis 28:6, Genesis 47:15, Genesis 49:25, Exodus 8:17, Exodus 9:13, Exodus 10:12, Exodus 22:5, Leviticus 8:21, Leviticus 23:24, Leviticus 23:40, Numbers 24:8, Numbers 35:33, Deuteronomy 28:1, Deuteronomy 28:29, Joshua 11:6, Joshua 13:8, Judges 9:54, Judges 11:21, Judges 17:4, Judges 19:5, Judges 20:42, 1 Samuel 11:3, 1 Samuel 22:2, 1 Samuel 30:13, 2 Samuel 3:13, 2 Samuel 14:26, 2 Samuel 24:22, 1 Kings 4:13, 1 Kings 12:28, 1 Kings 16:24, 2 Kings 1:17, 1 Chronicles 16:5, 1 Chronicles 20:6, 1 Chronicles 21:26, 2 Chronicles 6:34, 2 Chronicles 10:15, Ezra 4:23, Ezra 9:13, Nehemiah 8:18, Esther 6:11, Esther 9:27, Psalms 40:10, Isaiah 19:1, Isaiah 19:21, Isaiah 39:3, Isaiah 60:14, Isaiah 63:11, Isaiah 66:8, Isaiah 66:14, Jeremiah 3:8, Jeremiah 8:10, Jeremiah 21:2, Jeremiah 23:38, Jeremiah 26:8, Jeremiah 27:15, Jeremiah 32:3, Jeremiah 32:37, Jeremiah 49:36, Lamentations 2:7, Lamentations 2:15, Ezekiel 37:9, Daniel 2:10, Daniel 2:28, Daniel 10:19, Hosea 10:5, Hosea 11:8, Joel 2:28, Habakkuk 2:16, Matthew 18:8, Mark 11:23, Mark 13:11, Luke 7:39, Luke 9:33, John 17:12, Acts 15:29, Romans 1:13, Romans 7:4, Galatians 4:9, 1 John 5:10, Revelation 3:1, Revelation 12:14, Revelation 15:3, Revelation 21:3, Genesis 1:25, Genesis 46:31, Leviticus 15:10, Leviticus 18:17, Leviticus 27:33, Numbers 11:32, Numbers 19:12, Numbers 21:7, Deuteronomy 1:8, Deuteronomy 2:36, Deuteronomy 6:18, Deuteronomy 20:8, Deuteronomy 32:43, Joshua 11:12, Judges 5:14, Judges 6:5, 1 Samuel 2:14, 1 Samuel 7:6, 1 Samuel 9:21, 1 Samuel 16:16, 1 Samuel 21:11, 1 Samuel 23:25, 1 Samuel 30:6, 2 Samuel 1:4, 2 Samuel 2:13, 2 Samuel 14:14, 2 Samuel 18:32, 2 Samuel 21:20, 1 Kings 3:11, 1 Kings 7:20, 1 Kings 8:23, 1 Kings 8:46, 1 Kings 11:18, 1 Kings 19:19, 2 Kings 3:9, 2 Kings 4:39, 2 Kings 6:15, 2 Kings 13:21, 2 Kings 19:29, 2 Kings 20:20, 2 Kings 23:25, 1 Chronicles 15:29, 2 Chronicles 5:12, 2 Chronicles 16:7, 2 Chronicles 18:14, 2 Chronicles 19:8, 2 Chronicles 30:1, Ezra 7:26, Nehemiah 3:16, Esther 5:6, Ecclesiastes 8:15, Isaiah 63:1, Jeremiah 2:27, Jeremiah 6:23, Jeremiah 7:31, Jeremiah 22:4, Jeremiah 27:3, Jeremiah 32:4, Jeremiah 36:23, Jeremiah 49:22, Jeremiah 50:7, Jeremiah 51:57, Lamentations 2:4, Ezekiel 5:15, Ezekiel 21:14, Ezekiel 26:12, Ezekiel 28:24, Ezekiel 29:3, Ezekiel 37:21, Ezekiel 45:25, Daniel 5:29, Daniel 6:15, Amos 7:8, Micah 5:4, Micah 7:9, Zechariah 9:7, Zechariah 10:2, Matthew 4:24, John 12:35, Acts 20:24, Acts 24:2, Romans 5:15, 1 Corinthians 14:5, Hebrews 7:5, Hebrews 12:1, Revelation 2:2, Revelation 13:14, Genesis 27:29, Genesis 43:32, Exodus 8:9, Exodus 8:20, Exodus 12:19, Exodus 16:12, Leviticus 4:34, Leviticus 8:26, Leviticus 23:17, Leviticus 23:21, Leviticus 27:28, Numbers 9:5, Numbers 13:23, Numbers 28:14, Deuteronomy 2:9, Deuteronomy 14:26, Deuteronomy 28:15, Joshua 11:23, Joshua 18:12, Judges 6:11, Judges 6:28, Judges 7:1, 1 Samuel 5:9, 1 Samuel 13:4, 2 Samuel 5:19, 2 Samuel 9:3, 2 Samuel 15:12, 2 Samuel 17:10, 2 Samuel 23:20, 1 Kings 1:2, 1 Kings 8:44, 1 Kings 10:10, 1 Kings 16:2, 2 Kings 4:29, 1 Chronicles 10:7, 1 Chronicles 11:22, 1 Chronicles 15:27, 1 Chronicles 22:18, 2 Chronicles 3:11, 2 Chronicles 10:18, Ezra 2:61, Esther 1:5, Esther 4:3, Esther 6:4, Ecclesiastes 9:12, Isaiah 2:6, Isaiah 4:5, Isaiah 16:4, Isaiah 16:10, Isaiah 35:2, Isaiah 58:11, Jeremiah 2:8, Jeremiah 11:17, Jeremiah 16:11, Jeremiah 17:18, Jeremiah 23:5, Jeremiah 33:4, Jeremiah 34:3, Jeremiah 38:23, Jeremiah 42:17, Jeremiah 50:15, Jeremiah 50:42, Jeremiah 52:22, Ezekiel 5:17, Ezekiel 6:11, Ezekiel 24:6, Ezekiel 40:29, Ezekiel 40:33, Ezekiel 41:2, Daniel 3:19, Matthew 21:25, Matthew 22:4, Matthew 23:15, Mark 15:46, Luke 6:48, Luke 12:33, Luke 19:37, John 5:36, Acts 10:28, 1 Corinthians 9:12, Galatians 2:20, Philippians 4:3, 1 Peter 1:7, Revelation 6:6, Exodus 11:8, Exodus 12:12, Exodus 18:8, Exodus 18:21, Exodus 20:5, Leviticus 5:6, Leviticus 13:31, Numbers 32:11, Numbers 33:38, Numbers 35:21, Deuteronomy 2:7, Deuteronomy 10:12, Deuteronomy 13:3, Deuteronomy 13:17, Deuteronomy 15:2, Joshua 14:6, Joshua 22:8, Judges 3:12, Judges 7:8, Judges 7:15, 1 Samuel 2:35, 1 Samuel 9:6, 1 Samuel 26:21, 1 Samuel 28:21, 1 Samuel 29:8, 1 Kings 9:4, 1 Kings 10:9, 2 Kings 7:1, 2 Kings 7:19, 1 Chronicles 15:18, 1 Chronicles 24:19, 1 Chronicles 29:3, 2 Chronicles 20:23, 2 Chronicles 25:13, Ezra 4:12, Ezra 7:7, Esther 8:7, Psalms 17:14, Isaiah 1:4, Isaiah 5:7, Isaiah 25:4, Isaiah 40:12, Isaiah 44:12, Isaiah 60:6, Isaiah 61:7, Jeremiah 30:14, Jeremiah 38:2, Jeremiah 39:4, Jeremiah 42:20, Jeremiah 45:1, Jeremiah 48:2, Jeremiah 48:11, Jeremiah 52:17, Lamentations 2:17, Ezekiel 17:12, Ezekiel 46:1, Daniel 6:23, Joel 2:23, Habakkuk 3:16, Malachi 2:11, Mark 12:1, Luke 8:35, Acts 7:8, Romans 6:16, 2 Corinthians 12:9, Philippians 1:7, Genesis 11:6, Genesis 22:13, Exodus 4:21, Exodus 9:19, Exodus 33:11, Exodus 39:40, Leviticus 16:33, Leviticus 25:46, Leviticus 26:16, Leviticus 26:44, Leviticus 27:18, Deuteronomy 12:27, Judges 14:6, 1 Samuel 4:6, 1 Samuel 5:10, 1 Samuel 17:39, 1 Samuel 19:11, 1 Samuel 30:15, 2 Samuel 9:7, 1 Kings 5:3, 1 Kings 20:42, 2 Kings 2:3, 2 Kings 21:16, 1 Chronicles 23:29, 2 Chronicles 4:22, 2 Chronicles 7:20, 2 Chronicles 25:9, 2 Chronicles 26:15, 2 Chronicles 29:35, Ezra 6:9, Ezra 6:20, Esther 4:4, Isaiah 8:7, Isaiah 28:4, Isaiah 43:10, Isaiah 44:13, Isaiah 63:3, Isaiah 66:24, Jeremiah 3:12, Jeremiah 14:17, Jeremiah 40:9, Jeremiah 43:2, Jeremiah 49:3, Jeremiah 51:12, Lamentations 1:21, Ezekiel 25:14, Ezekiel 40:22, Daniel 6:13, Daniel 11:39, Amos 1:9, Zechariah 1:7, Matthew 21:33, John 16:21, John 21:15, Acts 5:4, Acts 6:9, Acts 16:18, Acts 19:9, Acts 26:18, 1 Timothy 5:10, 1 John 5:20, Revelation 2:13, Revelation 12:9, Revelation 14:4, Genesis 32:20, Genesis 38:25, Genesis 39:5, Exodus 8:3, Exodus 26:13, Leviticus 5:13, Leviticus 7:12, Leviticus 15:26, Leviticus 23:14, Numbers 8:4, Deuteronomy 4:21, Deuteronomy 6:2, Deuteronomy 28:67, Joshua 7:3, Joshua 18:4, Judges 20:45, 1 Samuel 2:15, 1 Samuel 2:36, 1 Samuel 4:18, 1 Samuel 10:8, 1 Samuel 17:37, 1 Samuel 23:13, 1 Samuel 25:8, 1 Samuel 27:5, 1 Samuel 28:14, 2 Samuel 3:18, 2 Samuel 6:2, 1 Kings 8:37, 1 Kings 12:15, 2 Kings 18:22, 2 Kings 19:15, 1 Chronicles 7:2, 1 Chronicles 22:9, 2 Chronicles 9:11, 2 Chronicles 21:20, 2 Chronicles 35:22, Ezra 1:5, Esther 7:9, Isaiah 8:21, Isaiah 29:14, Isaiah 41:7, Jeremiah 3:17, Jeremiah 8:6, Jeremiah 23:12, Jeremiah 28:4, Jeremiah 30:21, Jeremiah 38:25, Jeremiah 44:15, Jeremiah 46:21, Ezekiel 8:2, Ezekiel 22:25, Ezekiel 33:22, Ezekiel 43:20, Ezekiel 43:27, Ezekiel 46:14, Hosea 1:11, Hosea 2:5, Hosea 2:7, Joel 3:4, Habakkuk 2:5, Matthew 6:25, Mark 16:8, Luke 12:53, Acts 4:10, Acts 15:2, Acts 25:16, Acts 26:16, 2 Corinthians 11:26, 2 Corinthians 13:10, 1 Timothy 3:16, Hebrews 9:4, Revelation 1:9, Revelation 3:9, Revelation 14:15, Genesis 6:20, Genesis 7:11, Genesis 18:25, Genesis 32:10, Genesis 41:8, Exodus 33:19, Leviticus 14:51, Leviticus 16:17, Numbers 11:20, Numbers 32:17, Deuteronomy 1:22, Deuteronomy 3:2, Deuteronomy 11:4, Deuteronomy 28:12, Deuteronomy 33:29, Deuteronomy 34:4, Joshua 12:6, Judges 7:12, 1 Samuel 6:19, 1 Samuel 8:12, 1 Samuel 11:15, 1 Samuel 17:51, 1 Samuel 17:52, 1 Samuel 19:4, 1 Samuel 20:8, 1 Samuel 29:9, 2 Samuel 3:27, 2 Samuel 19:42, 2 Samuel 20:15, 2 Samuel 23:9, 2 Samuel 24:21, 1 Kings 14:13, 1 Kings 21:29, 1 Kings 22:13, 2 Kings 2:2, 2 Kings 2:5, 2 Kings 5:1, 2 Kings 13:14, 2 Kings 23:27, 2 Chronicles 6:28, 2 Chronicles 7:10, 2 Chronicles 18:12, Ezra 1:3, Ezra 6:13, Ezra 8:31, Nehemiah 12:39, Esther 7:7, Esther 9:25, Isaiah 7:4, Isaiah 22:25, Isaiah 40:26, Isaiah 50:4, Jeremiah 2:19, Jeremiah 13:10, Jeremiah 26:11, Jeremiah 29:25, Jeremiah 30:18, Jeremiah 34:7, Jeremiah 37:7, Jeremiah 41:5, Lamentations 2:11, Ezekiel 20:9, Ezekiel 22:20, Ezekiel 26:10, Ezekiel 29:4, Ezekiel 44:13, Ezekiel 46:17, Daniel 2:41, Daniel 7:9, Daniel 10:12, Daniel 11:15, Hosea 3:1, Obadiah 1:7, Jonah 4:8, Zephaniah 1:3, Zephaniah 3:13, Zechariah 13:7, Malachi 1:14, Matthew 21:23, Luke 6:49, Luke 8:47, Romans 1:20, 1 John 2:13, Revelation 1:20, Revelation 6:11, Revelation 11:15, Revelation 20:3, Revelation 20:6, Genesis 1:30, Genesis 12:8, Genesis 42:21, Exodus 7:20, Exodus 14:27, Exodus 17:1, Exodus 21:29, Exodus 28:12, Exodus 34:20, Leviticus 21:10, Numbers 21:34, Deuteronomy 1:39, Deuteronomy 23:20, Deuteronomy 27:15, Deuteronomy 28:20, Deuteronomy 28:65, Deuteronomy 32:21, Joshua 6:17, Joshua 7:15, Joshua 22:25, Judges 6:37, Judges 7:3, 1 Samuel 17:8, 2 Samuel 5:20, 2 Samuel 13:6, 2 Samuel 13:28, 2 Samuel 14:15, 2 Samuel 21:17, 2 Samuel 23:17, 1 Kings 10:13, 1 Kings 11:34, 1 Kings 21:22, 2 Kings 5:11, 2 Kings 10:24, 2 Kings 13:25, 1 Chronicles 11:3, Isaiah 28:16, Isaiah 30:33, Isaiah 35:8, Isaiah 47:9, Jeremiah 9:12, Jeremiah 10:9, Jeremiah 23:8, Jeremiah 32:23, Jeremiah 50:20, Jeremiah 51:25, Jeremiah 51:59, Ezekiel 10:7, Ezekiel 16:13, Ezekiel 24:14, Ezekiel 30:18, Ezekiel 33:24, Ezekiel 45:23, Daniel 5:17, Daniel 10:11, Amos 1:5, Amos 1:13, Amos 9:14, Zephaniah 1:4, Zechariah 7:12, Matthew 27:24, Matthew 27:64, Mark 12:26, Luke 1:17, John 19:23, Acts 19:19, Acts 25:24, Romans 1:27, 2 Corinthians 8:19, Galatians 4:27, Hebrews 4:12, Revelation 2:20, Revelation 5:8, Revelation 14:10, Revelation 19:6, Genesis 1:21, Exodus 5:14, Exodus 13:17, Exodus 17:6, Exodus 31:13, Exodus 35:22, Leviticus 13:20, Leviticus 16:24, Leviticus 19:20, Leviticus 25:28, Numbers 5:13, Numbers 5:21, Numbers 6:11, Numbers 7:25, Numbers 7:31, Numbers 7:37, Numbers 7:43, Numbers 7:49, Numbers 7:55, Numbers 7:61, Numbers 7:67, Numbers 7:73, Numbers 7:79, Numbers 31:12, Deuteronomy 3:14, Deuteronomy 32:51, Judges 5:30, Judges 7:11, Judges 13:5, Judges 18:30, 1 Samuel 12:14, 1 Samuel 13:11, 1 Samuel 13:13, 1 Samuel 15:20, 1 Samuel 18:21, 1 Samuel 25:34, 2 Samuel 6:21, 2 Samuel 11:13, 2 Samuel 14:13, 2 Samuel 15:20, 2 Samuel 15:30, 1 Kings 8:47, 1 Kings 12:20, 2 Kings 7:15, 2 Kings 17:7, 2 Kings 19:37, 1 Chronicles 5:20, 1 Chronicles 24:4, 2 Chronicles 16:9, Ezra 4:9, Nehemiah 7:6, Isaiah 1:11, Jeremiah 6:10, Jeremiah 13:12, Jeremiah 14:18, Jeremiah 14:19, Jeremiah 37:10, Jeremiah 46:26, Jeremiah 48:44, Jeremiah 51:46, Ezekiel 8:11, Ezekiel 34:18, Daniel 1:5, Daniel 4:12, Nahum 1:14, Matthew 10:41, Luke 12:58, Luke 14:10, John 16:13, 2 Corinthians 9:13, Revelation 18:19, Exodus 9:29, Exodus 30:10, Numbers 9:22, Numbers 21:13, Deuteronomy 12:31, Deuteronomy 20:5, Deuteronomy 28:11, Deuteronomy 28:48, Joshua 8:20, Joshua 9:11, Joshua 17:1, Judges 4:14, Judges 7:5, Judges 9:15, Judges 15:18, 1 Samuel 9:20, 1 Samuel 17:45, 1 Samuel 20:41, 2 Samuel 19:8, 2 Samuel 23:10, 2 Samuel 24:3, 1 Kings 1:13, 1 Kings 15:27, 1 Kings 20:23, 2 Kings 7:17, 1 Chronicles 4:17, 2 Chronicles 26:20, 2 Chronicles 32:9, 2 Chronicles 36:14, Ecclesiastes 3:19, Ecclesiastes 5:18, Isaiah 24:18, Isaiah 30:14, Jeremiah 10:25, Jeremiah 21:9, Jeremiah 25:3, Jeremiah 25:31, Jeremiah 34:16, Jeremiah 38:18, Jeremiah 50:16, Jeremiah 51:16, Jeremiah 51:34, Ezekiel 39:28, Hosea 4:6, Hosea 10:14, Zechariah 4:2, Matthew 19:28, Mark 1:45, Mark 7:4, Acts 9:39, 1 Corinthians 4:6, Revelation 18:12, Genesis 48:16, Exodus 18:22, Exodus 19:9, Leviticus 5:4, Leviticus 14:36, Leviticus 16:29, Leviticus 26:25, Deuteronomy 3:20, Deuteronomy 15:7, Deuteronomy 21:23, Deuteronomy 30:10, Joshua 12:8, Judges 12:3, Judges 13:7, Judges 19:25, Judges 19:27, Ruth 1:13, Ruth 2:9, 1 Samuel 1:24, 1 Samuel 13:14, 1 Samuel 25:28, 2 Samuel 6:19, 2 Samuel 19:41, 1 Kings 1:19, 1 Kings 9:7, 1 Kings 14:5, 1 Kings 17:10, 1 Kings 20:9, 2 Kings 7:13, 2 Kings 10:13, 2 Kings 17:6, 2 Chronicles 6:37, 2 Chronicles 24:24, 2 Chronicles 29:30, 2 Chronicles 30:24, 2 Chronicles 35:9, Ezra 5:6, Ezra 10:1, Isaiah 11:15, Isaiah 24:16, Isaiah 36:12, Isaiah 37:30, Isaiah 57:13, Jeremiah 8:16, Jeremiah 9:26, Jeremiah 10:5, Jeremiah 10:13, Jeremiah 11:4, Jeremiah 31:32, Jeremiah 35:11, Jeremiah 42:4, Jeremiah 47:4, Lamentations 1:14, Ezekiel 6:6, Ezekiel 12:23, Ezekiel 16:55, Ezekiel 16:57, Ezekiel 33:31, Ezekiel 39:9, Ezekiel 45:1, Haggai 2:23, Zechariah 10:11, Mark 6:41, Luke 3:16, John 18:36, John 21:23, Acts 23:15, 1 Peter 3:7, Jude 1:4, Revelation 14:13, Genesis 2:9, Genesis 16:5, Genesis 23:16, Exodus 12:17, Exodus 13:3, Exodus 33:12, Exodus 35:21, Leviticus 5:7, Leviticus 8:7, Leviticus 14:8, Leviticus 19:19, Leviticus 22:21, Numbers 26:9, Numbers 36:2, Deuteronomy 4:1, Deuteronomy 4:26, Deuteronomy 9:7, Joshua 6:23, Joshua 6:25, Joshua 7:7, Joshua 15:9, Judges 5:11, Judges 9:2, Judges 11:2, Judges 18:3, 1 Samuel 2:10, 1 Samuel 12:8, 2 Samuel 11:1, 2 Samuel 18:33, 1 Kings 7:31, 1 Kings 8:66, 1 Kings 9:19, 1 Kings 10:21, 2 Kings 3:27, 2 Kings 18:37, 2 Kings 21:3, 2 Kings 25:11, 1 Chronicles 14:11, 1 Chronicles 20:3, 2 Chronicles 33:15, 2 Chronicles 35:7, Ezra 7:6, Esther 1:10, Esther 10:2, Isaiah 5:2, Isaiah 10:14, Isaiah 31:3, Isaiah 32:6, Isaiah 33:1, Isaiah 41:2, Isaiah 44:23, Isaiah 47:11, Jeremiah 7:20, Jeremiah 49:37, Ezekiel 17:15, Ezekiel 35:11, Ezekiel 41:16, Amos 9:3, Micah 2:4, Nahum 1:15, Mark 2:26, Mark 16:14, Luke 13:25, John 21:7, Acts 8:1, Acts 22:3, Romans 5:17, Romans 6:13, 2 Corinthians 12:14, Hebrews 10:29, Revelation 4:1, Genesis 3:14, Genesis 21:16, Genesis 27:37, Genesis 47:17, Exodus 11:5, Exodus 15:19, Exodus 34:9, Numbers 5:14, Numbers 7:13, Numbers 19:10, Deuteronomy 3:16, Deuteronomy 9:9, Deuteronomy 33:21, Joshua 6:18, Joshua 10:12, Joshua 14:4, Joshua 24:7, Judges 11:13, Judges 20:48, 1 Samuel 26:12, 1 Samuel 28:19, 2 Samuel 10:19, 1 Kings 12:14, 1 Chronicles 19:5, 2 Chronicles 6:32, 2 Chronicles 20:15, 2 Chronicles 29:6, Ezra 1:4, Esther 9:2, Esther 9:16, Job 42:7, Isaiah 27:13, Isaiah 29:16, Isaiah 36:22, Isaiah 49:22, Isaiah 49:26, Isaiah 50:11, Jeremiah 1:3, Jeremiah 3:2, Jeremiah 7:34, Jeremiah 38:11, Jeremiah 44:2, Jeremiah 52:20, Lamentations 2:5, Ezekiel 1:24, Ezekiel 23:42, Ezekiel 33:8, Ezekiel 33:30, Ezekiel 35:15, Daniel 2:5, Daniel 10:6, Hosea 13:2, Micah 4:1, Zechariah 9:15, Matthew 1:17, Mark 6:56, Acts 3:13, Acts 25:23, Ephesians 6:12, Philippians 3:8, Hebrews 2:9, Revelation 5:9, Genesis 19:2, Genesis 30:15, Genesis 47:6, Exodus 18:14, Exodus 27:16, Exodus 33:16, Leviticus 15:13, Leviticus 23:13, Numbers 18:1, Deuteronomy 1:19, Deuteronomy 5:21, Deuteronomy 14:24, Joshua 1:14, Joshua 8:22, Joshua 17:2, Judges 7:20, Judges 15:19, 1 Samuel 2:8, 1 Samuel 12:10, 1 Samuel 22:6, 1 Samuel 22:15, 2 Samuel 17:23, 2 Samuel 19:11, 1 Kings 11:29, 2 Kings 1:2, 2 Kings 15:16, 1 Chronicles 13:6, 1 Chronicles 19:16, 2 Chronicles 19:2, 2 Chronicles 33:18, 2 Chronicles 35:24, 2 Chronicles 35:25, Ezra 7:24, Nehemiah 10:38, Esther 3:6, Esther 5:2, Isaiah 51:3, Isaiah 56:6, Jeremiah 40:8, Jeremiah 45:5, Jeremiah 50:2, Ezekiel 29:19, Daniel 7:4, Amos 8:5, Micah 7:17, Zechariah 3:4, Zechariah 3:7, Zechariah 3:9, Zechariah 6:13, Malachi 1:10, Matthew 12:42, Luke 13:34, John 16:17, 1 Corinthians 1:2, Hebrews 11:4, Genesis 6:4, Genesis 18:19, Genesis 26:18, Exodus 16:4, Exodus 34:29, Leviticus 14:10, Numbers 3:41, Numbers 6:18, Deuteronomy 6:3, Deuteronomy 18:22, Joshua 2:1, Joshua 10:37, Joshua 13:31, Joshua 18:13, Judges 9:24, Judges 12:4, Judges 21:23, Ruth 2:20, 1 Samuel 25:31, 2 Samuel 14:11, 2 Samuel 21:4, 2 Samuel 23:21, 1 Kings 8:16, 1 Kings 13:18, 1 Kings 22:22, 1 Chronicles 28:15, 2 Chronicles 31:16, Ezra 7:16, Ezra 9:14, Nehemiah 8:7, Esther 8:8, Isaiah 11:4, Jeremiah 9:24, Jeremiah 31:37, Ezekiel 5:6, Ezekiel 23:23, Daniel 7:23, Amos 3:9, Amos 3:12, Matthew 6:2, Matthew 12:45, Matthew 23:37, John 16:19, Acts 16:37, Acts 23:10, Acts 25:26, Romans 7:3, Romans 7:7, Romans 12:3, Colossians 1:23, Titus 3:8, 3 John 1:10, Genesis 8:9, Genesis 19:34, Genesis 50:13, Exodus 14:5, Exodus 27:11, Exodus 28:4, Leviticus 6:10, Leviticus 16:18, Leviticus 26:43, Numbers 1:53, Deuteronomy 2:14, Deuteronomy 12:6, Deuteronomy 26:5, Joshua 4:5, Joshua 6:8, Joshua 15:11, Judges 1:7, Judges 16:12, 1 Samuel 7:7, 2 Samuel 19:24, 1 Kings 8:59, 1 Kings 12:21, 1 Kings 16:31, 1 Kings 20:13, 2 Kings 23:17, 1 Chronicles 11:2, 2 Chronicles 3:1, 2 Chronicles 15:9, 2 Chronicles 18:31, 2 Chronicles 30:25, Ezra 3:9, Ezra 8:17, Esther 5:11, Esther 10:3, Isaiah 43:9, Isaiah 44:26, Isaiah 45:8, Isaiah 45:18, Isaiah 65:20, Jeremiah 3:25, Jeremiah 11:8, Jeremiah 14:10, Jeremiah 20:11, Jeremiah 26:15, Jeremiah 33:5, Jeremiah 34:22, Jeremiah 36:9, Jeremiah 43:11, Jeremiah 51:58, Jeremiah 52:12, Ezekiel 8:6, Ezekiel 8:12, Ezekiel 16:27, Ezekiel 48:18, Daniel 4:9, Hosea 4:13, Joel 1:13, Obadiah 1:19, Zephaniah 3:20, Zechariah 9:9, Matthew 5:22, Luke 12:1, Romans 13:9, 2 Corinthians 6:16, 2 Corinthians 12:20, Genesis 9:23, Genesis 24:30, Genesis 27:36, Genesis 42:28, Exodus 3:17, Leviticus 4:25, Leviticus 6:9, Leviticus 12:8, Leviticus 14:13, Leviticus 23:36, Numbers 6:5, Numbers 11:17, Numbers 20:12, Deuteronomy 2:24, Deuteronomy 19:6, Joshua 8:1, Joshua 17:16, Joshua 22:10, Judges 2:19, Judges 20:13, Judges 20:26, Ruth 4:7, 1 Samuel 28:8, 2 Kings 9:17, 2 Kings 10:23, 2 Kings 23:6, 2 Kings 23:15, 2 Chronicles 10:14, 2 Chronicles 21:12, 2 Chronicles 26:6, 2 Chronicles 29:27, Isaiah 37:38, Isaiah 53:10, Isaiah 65:7, Isaiah 66:12, Jeremiah 16:15, Jeremiah 41:2, Jeremiah 49:32, Ezekiel 20:41, Ezekiel 34:14, Daniel 7:25, Amos 4:13, Amos 5:8, Matthew 17:27, Mark 8:6, Acts 13:11, Acts 21:26, Genesis 8:17, Genesis 30:33, Genesis 48:7, Genesis 49:26, Exodus 5:3, Leviticus 6:20, Numbers 6:14, Numbers 7:88, Deuteronomy 9:10, Deuteronomy 10:4, Deuteronomy 28:45, Joshua 3:17, Joshua 20:8, Judges 13:6, Judges 13:16, Judges 13:23, Judges 14:12, 1 Samuel 23:26, 2 Samuel 4:12, 1 Kings 7:15, 1 Kings 18:21, 2 Kings 4:1, 2 Kings 5:26, 2 Kings 16:10, 2 Kings 23:19, 1 Chronicles 25:3, 2 Chronicles 4:6, 2 Chronicles 14:13, 2 Chronicles 25:24, Nehemiah 7:73, Nehemiah 10:36, Nehemiah 11:17, Isaiah 2:2, Isaiah 16:8, Isaiah 31:1, Isaiah 58:5, Isaiah 65:13, Jeremiah 4:31, Jeremiah 26:9, Jeremiah 29:18, Jeremiah 34:2, Jeremiah 34:21, Jeremiah 44:7, Ezekiel 4:9, Ezekiel 12:25, Ezekiel 17:7, Ezekiel 33:13, Ezekiel 46:11, Luke 9:12, Acts 21:28, Romans 11:24, Hebrews 13:17, Jude 1:15, Revelation 12:17, Revelation 15:2, Genesis 50:5, Exodus 12:39, Exodus 36:1, Numbers 1:32, Numbers 16:30, Numbers 30:14, Deuteronomy 4:6, Deuteronomy 13:16, Joshua 24:8, Judges 2:1, Judges 7:22, 1 Samuel 12:9, 1 Samuel 14:27, 1 Samuel 16:18, 1 Samuel 19:20, 2 Samuel 21:14, 1 Kings 7:2, 2 Kings 13:19, 2 Kings 15:20, 1 Chronicles 25:6, 2 Chronicles 16:3, 2 Chronicles 28:12, Ezra 3:12, Ezra 6:21, Nehemiah 9:26, Isaiah 10:13, Isaiah 33:15, Isaiah 58:2, Isaiah 62:4, Jeremiah 34:10, Lamentations 2:8, Ezekiel 3:27, Ezekiel 16:39, Ezekiel 20:39, Ezekiel 28:22, Ezekiel 44:12, Daniel 10:1, Micah 3:11, Zechariah 1:4, Zechariah 5:4, Zechariah 14:18, Luke 5:17, Acts 25:11, Acts 26:20, Revelation 8:13, Genesis 9:2, Genesis 38:11, Exodus 12:22, Exodus 23:31, Numbers 3:13, Numbers 5:8, Numbers 7:19, Numbers 11:1, Numbers 11:26, Numbers 30:8, Deuteronomy 29:22, Joshua 13:27, Judges 12:5, Judges 12:6, Judges 18:27, 2 Samuel 21:8, 1 Kings 3:15, 1 Kings 7:50, 1 Kings 15:22, 1 Kings 18:10, 2 Kings 4:38, 2 Kings 5:23, 2 Kings 9:21, 2 Chronicles 28:24, 2 Chronicles 30:8, 2 Chronicles 31:5, 2 Chronicles 34:25, Nehemiah 2:19, Nehemiah 6:1, Nehemiah 7:5, Nehemiah 8:15, Nehemiah 9:10, Esther 1:22, Esther 8:10, Isaiah 11:14, Isaiah 36:11, Isaiah 54:1, Jeremiah 16:10, Lamentations 2:2, Amos 9:13, Obadiah 1:18, Zephaniah 2:15, Zechariah 12:8, Malachi 2:15, Luke 13:14, John 6:22, John 20:15, Acts 22:30, 1 Corinthians 5:11, 1 Corinthians 7:5, Hebrews 9:19, 2 Peter 1:4, Genesis 22:3, Exodus 3:22, Exodus 28:28, Exodus 38:21, Leviticus 6:12, Leviticus 14:9, Leviticus 20:18, Numbers 22:6, Deuteronomy 7:25, Deuteronomy 9:28, Deuteronomy 21:5, Deuteronomy 28:55, Joshua 11:8, Joshua 12:1, Joshua 22:32, Judges 15:14, 2 Samuel 7:7, 1 Kings 2:22, 1 Kings 2:30, 1 Kings 2:33, 1 Kings 6:12, 1 Kings 22:15, 2 Kings 6:17, 2 Kings 25:8, 2 Chronicles 8:13, 2 Chronicles 13:12, 2 Chronicles 24:23, Ezra 7:17, Nehemiah 2:18, Nehemiah 6:6, Esther 3:9, Ecclesiastes 5:8, Ecclesiastes 6:2, Ecclesiastes 8:17, Jeremiah 4:4, Ezekiel 20:38, Amos 1:1, Haggai 2:4, Zechariah 8:12, Matthew 4:6, Matthew 21:32, Mark 6:2, Luke 14:12, Acts 2:17, Acts 6:5, Acts 9:21, Hebrews 10:1, 2 Peter 3:10, Revelation 18:22, Revelation 18:23, Genesis 20:9, Exodus 29:28, Leviticus 17:15, Numbers 7:89, Numbers 15:3, Deuteronomy 7:19, Deuteronomy 12:30, Joshua 1:7, Joshua 5:13, Judges 6:26, Judges 18:1, 1 Samuel 2:28, 2 Samuel 12:11, 2 Samuel 12:30, 1 Kings 10:5, 1 Kings 20:32, 2 Kings 5:15, 2 Kings 5:20, 2 Kings 8:6, 2 Kings 18:27, 1 Chronicles 21:23, 1 Chronicles 26:31, 1 Chronicles 29:11, 2 Chronicles 11:4, 2 Chronicles 15:2, 2 Chronicles 30:15, Nehemiah 8:10, Ecclesiastes 9:11, Isaiah 34:6, Isaiah 49:8, Jeremiah 8:14, Jeremiah 26:2, Jeremiah 35:18, Jeremiah 44:9, Ezekiel 1:16, Ezekiel 9:9, Ezekiel 13:19, Ezekiel 16:45, Ezekiel 20:5, Ezekiel 34:4, Ezekiel 45:4, Zechariah 12:4, Malachi 1:8, Mark 11:15, Mark 14:3, Galatians 2:2, 1 Timothy 1:9, Hebrews 1:3, Revelation 4:8, Genesis 24:27, Genesis 28:14, Exodus 12:29, Exodus 20:24, Exodus 23:11, Exodus 25:22, Leviticus 13:30, Numbers 6:21, Numbers 9:13, Numbers 10:9, Numbers 18:15, Numbers 18:23, Numbers 22:23, Deuteronomy 20:1, Deuteronomy 29:19, Judges 1:16, Judges 3:15, 1 Samuel 9:27, 1 Samuel 22:7, 1 Samuel 23:23, 1 Samuel 25:36, 2 Samuel 1:10, 2 Samuel 11:25, 2 Samuel 15:34, 1 Kings 14:10, 2 Kings 10:21, 2 Kings 12:21, 2 Chronicles 29:24, 2 Chronicles 36:8, Ezra 5:8, Ezra 7:21, Nehemiah 1:9, Esther 1:17, Ecclesiastes 11:9, Isaiah 29:4, Isaiah 49:5, Jeremiah 17:8, Jeremiah 20:6, Jeremiah 39:3, Ezekiel 17:24, Ezekiel 37:25, Daniel 4:27, Daniel 7:20, Zephaniah 3:7, Matthew 6:5, Acts 15:7, 2 Corinthians 10:12, Revelation 22:2, Genesis 8:13, Genesis 13:10, Genesis 31:42, Exodus 33:7, Exodus 38:17, Leviticus 1:17, Leviticus 14:14, Numbers 4:27, Numbers 25:11, Deuteronomy 1:28, Deuteronomy 12:12, Joshua 2:18, Judges 17:3, 1 Samuel 13:5, 1 Samuel 14:4, 1 Samuel 14:6, 1 Samuel 20:13, 2 Samuel 3:29, 2 Samuel 4:2, 2 Samuel 7:29, 2 Samuel 13:20, 2 Samuel 16:8, 2 Samuel 19:22, 2 Samuel 19:37, 1 Kings 11:11, 1 Kings 18:23, 1 Kings 19:4, 2 Kings 5:8, 2 Kings 16:7, 2 Kings 25:1, 1 Chronicles 19:17, 1 Chronicles 23:13, 1 Chronicles 23:28, 2 Chronicles 6:5, 2 Chronicles 20:9, Ezra 10:2, Esther 9:19, Isaiah 28:7, Isaiah 56:7, Jeremiah 5:15, Jeremiah 8:12, Jeremiah 13:13, Jeremiah 15:9, Jeremiah 28:6, Jeremiah 32:30, Ezekiel 4:3, Ezekiel 11:13, Ezekiel 13:20, Ezekiel 16:36, Daniel 1:2, Daniel 4:15, Daniel 4:35, Zechariah 13:2, Matthew 1:20, Luke 7:22, Acts 12:10, Acts 19:35, Romans 14:6, 2 Corinthians 7:12, Genesis 47:4, Exodus 33:1, Numbers 13:26, Numbers 18:8, Numbers 19:18, Deuteronomy 2:12, Deuteronomy 5:15, Deuteronomy 21:13, Deuteronomy 22:19, Deuteronomy 23:14, Deuteronomy 27:3, Deuteronomy 28:56, Joshua 3:15, Joshua 11:14, Joshua 13:3, Judges 18:19, Ruth 1:2, 1 Samuel 6:3, 1 Samuel 6:9, 1 Samuel 30:16, 1 Kings 20:36, 2 Kings 6:22, 2 Kings 12:11, 2 Kings 13:23, 2 Kings 14:28, 2 Kings 22:17, 1 Chronicles 21:16, Nehemiah 4:7, Nehemiah 11:4, Isaiah 20:6, Isaiah 28:13, Jeremiah 19:9, Jeremiah 20:10, Jeremiah 43:6, Jeremiah 44:28, Jeremiah 52:4, Ezekiel 12:7, Ezekiel 44:7, Malachi 2:17, Mark 10:32, John 18:28, Acts 10:22, Hebrews 8:5, Genesis 17:23, Exodus 16:32, Exodus 23:16, Exodus 25:33, Exodus 37:19, Leviticus 10:17, Numbers 27:11, Deuteronomy 1:15, Deuteronomy 9:23, Judges 4:9, Judges 6:39, Judges 14:9, 1 Samuel 7:14, 1 Samuel 24:10, 1 Samuel 27:11, 2 Samuel 12:9, 2 Samuel 17:8, 2 Samuel 21:1, 1 Kings 1:51, 1 Kings 2:19, 1 Kings 8:36, 1 Kings 14:8, 2 Chronicles 2:12, 2 Chronicles 6:27, 2 Chronicles 26:11, 2 Chronicles 31:6, 2 Chronicles 33:8, Ezra 5:3, Esther 1:16, Isaiah 18:2, Isaiah 38:1, Jeremiah 14:15, Jeremiah 31:23, Jeremiah 39:16, Jeremiah 41:8, Ezekiel 10:2, Ezekiel 17:23, Ezekiel 34:2, Daniel 6:26, Amos 5:11, Haggai 1:9, Acts 13:46, 2 Corinthians 12:21, 2 Peter 2:20, Genesis 21:14, Genesis 46:34, Genesis 47:19, Exodus 12:15, Exodus 12:23, Exodus 28:38, Leviticus 5:18, Leviticus 7:18, Leviticus 8:15, Leviticus 16:14, Numbers 33:55, Joshua 2:19, Joshua 10:30, Joshua 17:9, Judges 2:14, Judges 6:19, Judges 8:15, Judges 12:1, 1 Kings 15:23, 2 Kings 8:1, 2 Kings 11:9, 2 Kings 20:1, 2 Kings 25:25, 1 Chronicles 19:3, 2 Chronicles 8:6, 2 Chronicles 28:23, 2 Chronicles 30:21, Ezra 2:1, Ezra 9:8, Ecclesiastes 4:1, Isaiah 16:14, Isaiah 27:11, Isaiah 65:16, Jeremiah 12:14, Jeremiah 12:16, Jeremiah 23:15, Jeremiah 33:10, Jeremiah 33:26, Ezekiel 33:11, Ezekiel 34:12, Ezekiel 38:4, Daniel 9:18, Zephaniah 2:14, Luke 11:31, Luke 12:48, 2 Corinthians 4:2, 1 Thessalonians 2:13, Genesis 2:19, Exodus 12:27, Exodus 16:1, Exodus 32:27, Leviticus 6:15, Leviticus 20:2, Numbers 6:20, Deuteronomy 20:14, Joshua 10:13, Joshua 22:33, Judges 1:3, Judges 8:21, 1 Samuel 4:4, 1 Samuel 19:5, 1 Samuel 20:30, 1 Samuel 25:2, 2 Samuel 18:28, 2 Samuel 19:9, 1 Kings 19:21, 1 Kings 22:10, 2 Kings 7:2, 2 Kings 17:24, 2 Kings 22:20, 2 Chronicles 22:1, Nehemiah 9:19, Isaiah 54:17, Jeremiah 8:19, Jeremiah 31:33, Ezekiel 11:16, Ezekiel 21:28, Ezekiel 36:22, Ezekiel 38:16, Ezekiel 47:9, Zephaniah 3:11, Zechariah 11:16, Matthew 15:32, Acts 12:17, Romans 7:13, 1 Corinthians 7:34, Galatians 2:9, James 4:11, Revelation 9:20, Genesis 42:38, Genesis 50:11, Numbers 1:18, Numbers 3:4, Numbers 4:7, Deuteronomy 8:2, Deuteronomy 9:21, Deuteronomy 17:20, Joshua 17:18, 1 Samuel 14:24, 1 Kings 20:7, 2 Kings 15:29, 2 Kings 17:34, 2 Kings 24:12, 1 Chronicles 20:2, 2 Chronicles 26:10, Ezra 10:3, Nehemiah 3:1, Nehemiah 8:16, Nehemiah 10:31, Jeremiah 16:9, Jeremiah 16:16, Jeremiah 18:21, Jeremiah 34:1, Ezekiel 11:15, Amos 8:10, John 19:38, Acts 21:25, Hebrews 8:10, 2 Peter 3:16, Revelation 5:13, Exodus 4:9, Leviticus 4:31, Leviticus 25:10, Numbers 1:20, Numbers 11:25, Numbers 27:14, Deuteronomy 29:23, Deuteronomy 30:20, Joshua 4:10, Judges 3:28, Judges 7:19, 1 Samuel 10:18, 1 Samuel 13:15, 1 Samuel 16:7, 1 Samuel 16:11, 2 Samuel 5:6, 2 Samuel 8:2, 2 Samuel 24:24, 1 Kings 6:15, 1 Kings 14:2, 1 Kings 18:12, 1 Kings 20:25, 1 Kings 22:34, 2 Kings 5:22, 2 Kings 12:7, 2 Chronicles 8:18, 2 Chronicles 18:33, 2 Chronicles 21:17, 2 Chronicles 32:33, Ecclesiastes 12:5, Isaiah 66:5, Jeremiah 40:10, Jeremiah 46:2, Ezekiel 37:16, Daniel 1:4, Daniel 10:16, Jonah 1:3, Micah 1:7, Micah 6:16, Haggai 1:6, Malachi 1:4, Matthew 22:16, Acts 7:42, Galatians 2:14, Hebrews 9:15, Revelation 3:18, Revelation 5:6, Revelation 18:3, Revelation 21:8, Genesis 7:14, Genesis 21:23, Genesis 26:7, Genesis 30:35, Exodus 12:48, Exodus 20:10, Leviticus 13:2, Deuteronomy 3:12, Deuteronomy 4:9, Deuteronomy 7:8, Deuteronomy 11:17, Deuteronomy 19:15, Deuteronomy 26:14, Deuteronomy 28:57, Joshua 10:40, Judges 9:18, 1 Samuel 17:20, 1 Samuel 21:5, 1 Samuel 22:13, 1 Samuel 25:18, 1 Samuel 25:29, 2 Samuel 12:4, 2 Samuel 20:8, 2 Samuel 20:12, 2 Samuel 23:16, 1 Kings 1:47, 1 Kings 3:1, 1 Kings 20:33, 1 Chronicles 11:18, 1 Chronicles 11:19, 1 Chronicles 15:12, 2 Chronicles 6:10, 2 Chronicles 12:9, Nehemiah 12:24, Esther 4:14, Ecclesiastes 9:3, Isaiah 45:21, Jeremiah 5:3, Jeremiah 5:19, Jeremiah 19:15, Jeremiah 44:19, Jeremiah 51:11, Ezekiel 17:22, Ezekiel 21:22, Ezekiel 28:16, Daniel 9:11, Amos 4:7, John 19:31, Hebrews 11:7, Genesis 7:23, Exodus 3:16, Exodus 32:12, Leviticus 13:51, Numbers 27:1, Deuteronomy 28:63, Deuteronomy 28:68, Joshua 21:27, Judges 4:22, Ruth 2:14, 1 Samuel 13:2, 1 Samuel 25:26, 1 Kings 8:20, 1 Kings 12:27, 1 Kings 21:19, 2 Kings 7:9, 2 Kings 25:4, 2 Chronicles 12:5, 2 Chronicles 16:14, 2 Chronicles 26:21, 2 Chronicles 30:5, 2 Chronicles 32:31, 2 Chronicles 33:6, Ezra 6:22, Nehemiah 9:6, Nehemiah 13:22, Jeremiah 16:19, Jeremiah 31:9, Ezekiel 5:11, Ezekiel 5:12, Ezekiel 25:4, Micah 4:13, Malachi 3:1, Luke 4:18, 2 Peter 2:1, 1 John 2:27, Exodus 23:15, Exodus 29:22, Exodus 30:16, Leviticus 4:13, Leviticus 8:31, Numbers 18:7, Numbers 31:23, Numbers 36:4, Joshua 11:20, Judges 4:21, Judges 20:23, 1 Samuel 4:17, 1 Samuel 12:17, 1 Samuel 25:13, 2 Samuel 10:2, 2 Samuel 12:20, 1 Kings 21:15, 1 Chronicles 5:1, 1 Chronicles 17:21, 2 Chronicles 18:5, 2 Chronicles 20:37, 2 Chronicles 26:19, Ezra 3:7, Ezra 10:6, Ezra 10:16, Nehemiah 5:8, Nehemiah 12:27, Esther 9:31, Job 1:17, Jeremiah 7:32, Jeremiah 8:1, Jeremiah 14:16, Jeremiah 44:23, Ezekiel 12:12, Ezekiel 31:16, Ezekiel 36:11, Daniel 6:20, Daniel 7:14, Acts 15:22, Acts 21:11, 1 Corinthians 10:13, Hebrews 8:9, Leviticus 16:2, Leviticus 22:4, Numbers 18:24, Numbers 29:6, Numbers 36:8, Deuteronomy 4:32, Deuteronomy 11:6, Deuteronomy 17:11, Deuteronomy 22:17, Deuteronomy 33:17, Joshua 1:11, Joshua 2:10, Judges 11:17, 2 Samuel 24:10, 1 Kings 8:50, 1 Kings 9:3, 2 Kings 14:25, 2 Kings 18:4, 2 Kings 24:13, 2 Chronicles 20:21, 2 Chronicles 25:23, Nehemiah 8:17, Nehemiah 11:3, Nehemiah 13:26, Esther 5:8, Ecclesiastes 2:26, Ecclesiastes 6:3, Jeremiah 19:11, Jeremiah 22:18, Jeremiah 24:8, Jeremiah 25:29, Jeremiah 32:32, Jeremiah 43:12, Ezekiel 39:11, Ezekiel 40:48, Daniel 9:2, Daniel 9:12, Zechariah 6:15, Zechariah 9:10, Malachi 1:11, Matthew 5:19, John 21:18, Acts 12:20, Genesis 29:10, Genesis 48:19, Exodus 35:35, Leviticus 14:21, Numbers 19:9, Numbers 19:19, Deuteronomy 9:3, Joshua 4:3, Joshua 14:1, Joshua 14:10, Joshua 24:27, Judges 11:35, 1 Samuel 2:25, 1 Samuel 7:10, 1 Samuel 11:9, 1 Samuel 26:16, 2 Samuel 18:3, 1 Kings 15:29, 2 Kings 3:11, 2 Kings 14:9, 1 Chronicles 12:8, 1 Chronicles 21:3, 2 Chronicles 35:12, 2 Chronicles 36:17, Isaiah 7:1, Isaiah 66:4, Jeremiah 4:30, Jeremiah 20:5, Jeremiah 31:8, Jeremiah 31:40, Jeremiah 34:5, Jeremiah 38:6, Jeremiah 40:1, Jeremiah 41:1, Ezekiel 2:6, Ezekiel 28:18, Ezekiel 34:13, Ezekiel 38:12, Ezekiel 43:13, Ezekiel 46:18, Daniel 4:36, Hosea 13:15, Zechariah 1:6, Malachi 4:1, Matthew 21:21, John 20:25, 1 Corinthians 4:5, Revelation 11:6, Genesis 1:28, Genesis 19:9, Genesis 34:7, Genesis 36:6, Genesis 47:29, Genesis 50:17, Exodus 4:14, Exodus 21:22, Leviticus 13:34, Leviticus 16:15, Leviticus 23:22, Numbers 9:14, Deuteronomy 1:17, Deuteronomy 5:22, Deuteronomy 9:18, Deuteronomy 25:9, Joshua 17:15, Joshua 20:4, Joshua 22:4, Judges 9:49, 1 Samuel 10:19, 1 Samuel 14:12, 2 Samuel 14:2, 2 Samuel 14:22, 1 Kings 15:19, 1 Kings 22:43, 1 Chronicles 6:49, 1 Chronicles 25:1, Ezra 6:12, Isaiah 65:12, Jeremiah 6:11, Jeremiah 28:14, Jeremiah 44:14, Jeremiah 46:27, Daniel 2:30, Zechariah 13:3, Luke 8:29, Philippians 4:8, Revelation 2:10, Exodus 33:5, Leviticus 8:24, Numbers 11:16, Numbers 14:18, Numbers 16:40, Numbers 16:46, Numbers 18:11, Deuteronomy 3:11, Deuteronomy 26:12, Joshua 13:6, Judges 15:6, 1 Samuel 26:5, 2 Samuel 17:9, 2 Samuel 21:9, 1 Kings 7:14, 1 Kings 21:6, 2 Kings 5:7, 1 Chronicles 22:19, 2 Chronicles 9:29, 2 Chronicles 25:18, 2 Chronicles 28:13, 2 Chronicles 29:21, 2 Chronicles 34:28, Ecclesiastes 2:3, Isaiah 11:11, Jeremiah 3:16, Jeremiah 14:14, Jeremiah 34:14, Jeremiah 35:4, Ezekiel 13:14, Ezekiel 26:17, Daniel 5:19, Amos 1:11, Acts 23:21, Romans 4:16, Revelation 18:2, Genesis 37:10, Leviticus 23:37, Leviticus 23:39, Numbers 11:31, Numbers 19:20, Numbers 20:8, Deuteronomy 1:41, Deuteronomy 16:15, Deuteronomy 29:18, Deuteronomy 31:14, Judges 18:14, 1 Samuel 10:3, 1 Samuel 17:26, 1 Samuel 18:6, 2 Kings 9:25, 2 Chronicles 24:12, Nehemiah 5:15, Nehemiah 8:3, Nehemiah 10:29, Proverbs 30:4, Isaiah 60:9, Jeremiah 30:3, Jeremiah 44:8, Ezekiel 30:25, Ezekiel 36:6, Daniel 11:30, Malachi 1:13, 1 Timothy 6:2, Exodus 17:12, Leviticus 5:16, Numbers 6:19, Numbers 18:26, Numbers 25:18, Deuteronomy 29:20, Joshua 12:2, 1 Samuel 6:12, 2 Samuel 11:21, 1 Kings 6:1, 2 Kings 1:3, 1 Chronicles 20:1, 1 Chronicles 29:17, 2 Chronicles 32:5, 2 Chronicles 34:22, Ezra 7:28, Isaiah 49:6, Jeremiah 3:1, Jeremiah 15:19, Jeremiah 21:12, Ezekiel 6:3, Ezekiel 29:5, Ezekiel 44:30, Daniel 3:26, Daniel 11:2, Joel 3:18, Matthew 23:23, Acts 22:5, Revelation 20:12, Exodus 16:23, Leviticus 5:2, Numbers 16:9, Deuteronomy 19:5, Deuteronomy 24:19, Judges 2:17, Judges 14:19, 1 Samuel 14:47, 2 Samuel 10:6, 2 Samuel 17:14, 1 Kings 3:26, 1 Kings 9:9, 1 Kings 16:34, 2 Kings 14:13, 1 Chronicles 4:10, 1 Chronicles 28:2, 2 Chronicles 5:1, 2 Chronicles 29:25, Esther 5:1, Isaiah 28:15, Jeremiah 2:6, Jeremiah 11:10, Jeremiah 28:11, Jeremiah 49:20, Ezekiel 1:13, Ezekiel 17:9, Ezekiel 40:1, Ezekiel 43:8, Daniel 4:17, Matthew 17:20, Luke 14:21, Philippians 1:27, 1 John 5:16, Genesis 37:2, Genesis 38:14, Genesis 44:16, Leviticus 10:19, Leviticus 17:14, Numbers 5:19, Deuteronomy 12:15, Deuteronomy 28:51, Joshua 18:8, 1 Samuel 14:36, 2 Samuel 16:21, 1 Kings 2:3, 1 Kings 14:15, 2 Kings 2:14, 2 Kings 3:7, 1 Chronicles 10:4, 2 Chronicles 7:22, 2 Chronicles 34:3, Esther 4:8, Esther 7:2, Jeremiah 6:15, Jeremiah 22:3, Jeremiah 44:21, Lamentations 2:19, Ezekiel 21:24, Hosea 1:10, Amos 4:10, Nahum 2:13, Haggai 2:22, Zechariah 10:6, 2 Corinthians 11:4, Revelation 2:14, Revelation 11:18, Genesis 12:5, Exodus 8:26, Exodus 10:6, Exodus 38:18, Leviticus 14:17, Leviticus 16:27, Leviticus 25:33, Numbers 18:19, Joshua 19:9, Judges 6:31, Judges 9:28, 1 Samuel 20:12, 2 Samuel 3:21, 2 Kings 21:7, 2 Kings 23:30, 2 Chronicles 5:2, 2 Chronicles 8:11, 2 Chronicles 28:18, 2 Chronicles 30:9, 2 Chronicles 30:22, Esther 2:8, Isaiah 61:1, Jeremiah 35:14, Jeremiah 37:17, Jeremiah 37:21, Jeremiah 39:5, Jeremiah 50:29, Ezekiel 32:10, Daniel 5:12, Daniel 6:4, Daniel 11:17, Joel 2:32, Luke 3:1, Acts 1:13, Acts 14:15, Acts 17:18, Acts 23:6, Revelation 8:7, Revelation 19:10, Genesis 43:11, Leviticus 22:3, Numbers 29:39, Joshua 22:30, Judges 14:18, Judges 16:2, Judges 17:2, Ruth 2:11, 1 Samuel 20:21, 2 Samuel 16:1, 2 Samuel 16:2, 1 Kings 12:33, 1 Kings 22:6, 2 Kings 7:10, 2 Kings 15:25, 2 Kings 20:5, 2 Kings 22:9, 1 Chronicles 22:14, Nehemiah 10:33, Jeremiah 11:19, Jeremiah 29:1, Ezekiel 20:31, Jonah 1:5, Zephaniah 1:18, Numbers 1:22, Numbers 31:30, Deuteronomy 28:31, Joshua 7:12, Joshua 7:21, Judges 16:9, Judges 19:18, 1 Samuel 18:25, 2 Samuel 5:8, 2 Kings 10:30, 2 Chronicles 24:6, Nehemiah 5:14, Esther 7:4, Jeremiah 13:11, Jeremiah 32:35, Ezekiel 28:25, Ezekiel 48:22, Daniel 11:25, Joel 2:20, Zechariah 13:9, Zechariah 14:2, Matthew 14:19, Revelation 6:8, Exodus 28:30, Numbers 22:5, Deuteronomy 2:19, Deuteronomy 9:12, Deuteronomy 31:20, Joshua 3:10, Joshua 20:6, 2 Samuel 6:12, 2 Kings 9:26, 2 Kings 17:4, 2 Kings 18:26, 2 Chronicles 2:7, Esther 3:7, Isaiah 14:2, Jeremiah 30:11, Jeremiah 32:29, Jeremiah 51:27, Ezekiel 36:3, Hosea 4:14, Zephaniah 2:7, Matthew 13:15, Acts 9:17, Acts 28:27, Exodus 27:21, Leviticus 4:18, Leviticus 7:21, Leviticus 25:50, Numbers 25:6, Deuteronomy 16:16, Joshua 14:12, Judges 4:6, Judges 7:25, Judges 16:5, 1 Samuel 6:4, 1 Samuel 15:9, 1 Kings 13:6, 1 Kings 21:2, 2 Kings 11:15, 2 Kings 11:18, 2 Kings 23:11, 2 Chronicles 9:4, 2 Chronicles 33:7, 2 Chronicles 34:8, Isaiah 18:7, Jeremiah 18:11, Jeremiah 27:18, Jeremiah 52:19, Ezekiel 3:18, Daniel 4:33, Daniel 7:27, Malachi 1:6, Exodus 13:5, Exodus 32:8, Leviticus 3:9, Deuteronomy 13:6, Deuteronomy 31:7, Joshua 7:1, Judges 21:5, 1 Samuel 15:6, 2 Samuel 24:17, 1 Kings 11:2, 1 Kings 20:31, 2 Kings 9:27, 1 Chronicles 24:31, 2 Chronicles 24:5, 2 Chronicles 31:13, 2 Chronicles 35:14, Ezra 4:2, Nehemiah 9:24, Nehemiah 12:47, Isaiah 30:26, Jeremiah 5:22, Jeremiah 19:3, Jeremiah 19:4, Jeremiah 32:24, Jeremiah 33:9, Daniel 3:7, Daniel 7:19, Daniel 8:25, Hosea 2:18, Joel 2:2, 2 Corinthians 7:11, 1 Peter 1:12, Genesis 3:17, Exodus 6:6, Numbers 10:29, Numbers 18:17, Deuteronomy 4:25, Deuteronomy 12:17, Joshua 11:21, Judges 18:17, 1 Samuel 5:4, 1 Samuel 20:29, 2 Samuel 4:8, 2 Samuel 19:7, 1 Kings 21:4, 1 Chronicles 26:26, 2 Chronicles 22:7, 2 Chronicles 35:8, Isaiah 27:9, Jeremiah 49:16, Ezekiel 41:6, Daniel 2:24, Daniel 11:36, Micah 4:10, Malachi 3:10, Revelation 7:9, Genesis 3:6, Exodus 16:8, Leviticus 12:6, Deuteronomy 8:3, Deuteronomy 25:19, Joshua 18:7, Joshua 24:11, 2 Samuel 10:3, 2 Kings 4:13, 2 Kings 4:27, 1 Chronicles 19:2, 1 Chronicles 26:32, Ezra 9:2, Isaiah 58:13, Jeremiah 40:11, Jeremiah 50:45, Ezekiel 13:18, Ezekiel 39:23, Daniel 2:9, Daniel 4:18, John 18:37, 1 Peter 4:11, Exodus 28:43, Leviticus 9:7, Leviticus 16:4, Leviticus 17:4, Deuteronomy 28:52, Joshua 22:16, Judges 2:12, Judges 14:16, Judges 21:22, 1 Samuel 16:1, 1 Samuel 17:25, 1 Samuel 22:8, 2 Samuel 19:5, 1 Kings 22:8, 2 Chronicles 18:9, Nehemiah 13:25, Esther 1:6, Isaiah 36:16, Jeremiah 29:14, Jeremiah 29:23, Jeremiah 36:31, Jeremiah 52:15, Ezekiel 12:3, Ezekiel 40:4, Daniel 3:12, Daniel 9:24, Daniel 11:40, Amos 5:16, Malachi 2:2, Acts 5:21, Revelation 12:10, Leviticus 13:6, Leviticus 13:25, Numbers 13:32, Numbers 20:17, Deuteronomy 4:40, Joshua 10:6, Judges 16:17, Judges 16:18, 2 Samuel 13:5, 2 Samuel 17:20, 2 Samuel 19:6, 2 Samuel 21:12, 1 Kings 7:51, 2 Kings 18:31, 2 Chronicles 13:9, Ezra 3:2, Ezra 6:14, Ezra 9:12, Jeremiah 19:13, Jeremiah 36:29, Ezekiel 5:7, Ezekiel 16:37, Ezekiel 40:42, Daniel 2:44, Daniel 11:4, Acts 21:24, Exodus 34:7, Leviticus 26:36, Numbers 30:12, Joshua 6:5, Joshua 8:24, Joshua 13:21, Joshua 23:15, Judges 2:18, Judges 19:3, Ruth 2:19, 1 Samuel 6:15, 2 Samuel 12:31, 1 Kings 18:26, 2 Kings 23:16, 2 Chronicles 22:6, 2 Chronicles 27:5, Nehemiah 1:11, Esther 2:9, Isaiah 42:16, Isaiah 50:1, Ezekiel 41:7, Ezekiel 46:20, Matthew 2:13, Genesis 47:9, Deuteronomy 12:21, Joshua 9:1, Joshua 22:29, 1 Samuel 24:4, 2 Samuel 20:1, 1 Kings 12:24, 1 Kings 17:12, 2 Chronicles 29:22, 2 Chronicles 31:3, Ezra 3:10, Ezra 10:14, Ezekiel 7:27, Ezekiel 18:20, Ezekiel 24:21, Ezekiel 28:26, Ezekiel 32:2, Ezekiel 33:6, Ezekiel 44:11, Daniel 6:10, Daniel 7:8, Hosea 9:10, Joel 2:17, Zechariah 8:19, Revelation 9:17, Genesis 11:31, Genesis 31:43, Exodus 39:21, Leviticus 14:28, Numbers 1:50, Joshua 8:14, Joshua 22:28, Judges 8:26, 1 Samuel 18:17, 1 Samuel 31:7, 2 Samuel 12:3, 2 Kings 10:5, 2 Kings 11:19, 2 Kings 21:8, 2 Chronicles 20:17, 2 Chronicles 23:1, 2 Chronicles 30:18, 2 Chronicles 34:12, Isaiah 2:4, Jeremiah 17:25, Ezekiel 6:13, Ezekiel 25:3, Ezekiel 26:16, Ezekiel 29:18, Daniel 1:10, Daniel 5:2, John 19:24, Acts 27:12, Joshua 1:8, Joshua 4:7, Joshua 24:17, 1 Samuel 4:19, 2 Samuel 18:18, 2 Samuel 20:10, 1 Kings 2:4, 1 Kings 5:6, 2 Kings 8:9, 2 Kings 13:17, 2 Kings 24:2, 1 Chronicles 18:10, 1 Chronicles 28:4, 2 Chronicles 28:5, Nehemiah 8:9, Isaiah 44:19, Ezekiel 42:14, Revelation 14:18, Exodus 8:21, Leviticus 7:34, Leviticus 20:25, Numbers 4:26, Deuteronomy 24:4, Joshua 6:26, Joshua 10:5, Joshua 10:27, Joshua 10:28, Judges 19:22, 1 Samuel 30:22, 2 Samuel 8:10, 1 Kings 21:13, 2 Kings 7:4, 2 Chronicles 10:10, 2 Chronicles 23:20, Nehemiah 9:8, Isaiah 29:8, Jeremiah 30:10, Jeremiah 52:7, Ezekiel 38:13, Daniel 9:27, Zechariah 14:21, John 21:17, Genesis 1:26, Leviticus 2:2, Leviticus 10:15, Joshua 22:7, 1 Samuel 30:21, 1 Kings 5:9, 1 Kings 12:10, 1 Chronicles 12:18, 2 Chronicles 18:7, Nehemiah 4:14, Nehemiah 9:5, Esther 2:3, Ecclesiastes 8:14, Isaiah 49:23, Jeremiah 18:18, Jeremiah 43:10, Jeremiah 49:19, Ezekiel 10:19, Ezekiel 16:43, Daniel 3:29, Joel 3:2, Micah 4:3, Zechariah 14:5, Matthew 19:12, Revelation 2:17, Genesis 47:18, Exodus 16:3, Numbers 16:38, Numbers 27:21, Joshua 8:29, Judges 16:3, 2 Kings 9:15, 2 Chronicles 29:17, 2 Chronicles 34:33, Ezra 1:1, Ezra 7:25, Ezra 8:22, Isaiah 53:12, Jeremiah 23:14, Jeremiah 36:32, Lamentations 1:7, Ezekiel 29:12, Ezekiel 39:10, Acts 19:27, Joshua 3:16, Judges 15:11, 1 Samuel 20:3, 2 Samuel 20:22, 1 Kings 19:10, 1 Kings 19:14, 2 Kings 22:14, 2 Kings 25:27, 2 Chronicles 6:13, 2 Chronicles 9:8, 2 Chronicles 12:7, 2 Chronicles 35:3, Esther 2:7, Esther 8:11, Jeremiah 17:27, Jeremiah 23:32, Jeremiah 31:34, Jeremiah 46:10, Ezekiel 16:8, Ezekiel 25:7, Ezekiel 27:27, Ezekiel 31:15, Luke 10:21, Revelation 8:12, Leviticus 8:30, Leviticus 22:18, Deuteronomy 14:29, Deuteronomy 24:1, Joshua 4:18, Joshua 10:1, Judges 16:14, 1 Samuel 11:11, 2 Samuel 2:23, 2 Kings 20:13, 2 Kings 23:12, 1 Chronicles 23:24, 2 Chronicles 20:25, Jeremiah 1:15, Jeremiah 23:2, Jeremiah 26:19, Jeremiah 36:10, Jeremiah 47:2, Jeremiah 50:44, Ezekiel 9:2, Ezekiel 32:24, Haggai 1:1, Zechariah 5:3, Zechariah 14:12, Exodus 29:21, Leviticus 14:25, Leviticus 16:16, Numbers 3:38, Numbers 4:16, Numbers 36:1, Deuteronomy 14:23, Deuteronomy 15:9, Joshua 7:13, Joshua 7:24, 1 Samuel 9:16, 1 Samuel 9:24, 1 Samuel 18:27, Esther 9:28, Isaiah 24:2, Jeremiah 41:9, Genesis 8:21, Exodus 3:15, Leviticus 10:14, Numbers 4:14, Numbers 16:3, Judges 16:30, 1 Samuel 9:4, 1 Samuel 9:13, 2 Samuel 13:32, 2 Samuel 18:12, 1 Kings 8:1, 2 Kings 5:18, 1 Chronicles 4:41, 1 Chronicles 11:23, 1 Chronicles 12:17, 2 Chronicles 34:27, 2 Chronicles 36:22, Ezra 9:7, Job 2:11, Isaiah 51:13, Jeremiah 5:6, Jeremiah 26:18, Ezekiel 44:15, Ezekiel 47:22, Daniel 11:24, Genesis 24:7, Numbers 32:29, Deuteronomy 16:3, Judges 6:21, 1 Samuel 5:8, 2 Samuel 15:14, 2 Kings 17:13, 2 Kings 19:4, 1 Chronicles 28:21, 2 Chronicles 23:8, 2 Chronicles 33:19, Ezra 6:8, Ecclesiastes 4:8, Isaiah 9:1, Ezekiel 23:25, Daniel 8:13, Amos 2:4, Matthew 2:16, Deuteronomy 25:7, Joshua 3:13, Joshua 10:24, Joshua 23:14, Joshua 23:16, Joshua 24:15, 1 Samuel 4:3, 1 Kings 8:48, 2 Kings 9:18, 2 Chronicles 14:7, Ezra 5:17, Esther 5:14, Isaiah 2:3, Isaiah 37:4, Isaiah 57:15, Jeremiah 46:28, Jeremiah 50:9, Mark 12:14, Acts 28:23, Exodus 10:15, Leviticus 13:55, Numbers 11:18, 1 Samuel 20:42, 1 Samuel 31:4, 2 Samuel 18:2, 1 Kings 12:16, 2 Kings 25:17, 2 Chronicles 21:13, 2 Chronicles 29:31, 2 Chronicles 32:17, Nehemiah 5:18, Esther 4:16, Jeremiah 33:13, Ezekiel 36:5, Ezekiel 48:8, Zechariah 8:9, Romans 6:19, Hebrews 7:11, Exodus 22:9, Numbers 18:9, Deuteronomy 25:5, Deuteronomy 31:16, Joshua 7:14, Joshua 15:7, Joshua 23:13, Judges 1:33, 2 Chronicles 35:21, Isaiah 9:17, Jeremiah 28:1, Jeremiah 32:12, Ezekiel 36:23, Ezekiel 44:19, Daniel 3:2, Micah 5:8, Romans 4:11, Numbers 15:25, Numbers 35:25, Deuteronomy 4:19, Joshua 10:39, Ruth 4:10, 1 Kings 18:36, 2 Kings 3:13, 2 Kings 7:8, 2 Kings 8:29, 2 Kings 23:5, 2 Kings 23:35, 2 Chronicles 6:38, 2 Chronicles 29:16, 2 Chronicles 34:31, Ezra 4:3, Isaiah 9:7, Jeremiah 38:17, Ezekiel 33:27, Ezekiel 37:19, Ezekiel 48:1, Daniel 5:16, Daniel 9:25, Zechariah 11:6, Zechariah 14:4, Zechariah 14:10, Revelation 3:12, Leviticus 23:18, Joshua 22:11, 1 Samuel 10:5, 1 Kings 6:6, 1 Kings 6:27, 2 Kings 11:4, 2 Kings 11:14, 2 Chronicles 7:3, 2 Chronicles 33:14, Ezra 8:35, Ezra 9:9, Ezra 9:11, Esther 8:17, Jeremiah 36:14, Jeremiah 44:30, Ezekiel 1:28, Daniel 9:16, Deuteronomy 4:10, Deuteronomy 30:9, Joshua 17:4, 2 Samuel 21:10, 1 Kings 2:26, 2 Kings 12:9, 1 Chronicles 28:8, 2 Chronicles 14:11, 2 Chronicles 23:14, 2 Chronicles 25:4, Isaiah 39:2, Jeremiah 15:2, Daniel 9:26, Galatians 2:16, Leviticus 17:5, Joshua 18:16, 1 Samuel 21:2, 1 Samuel 24:11, 2 Samuel 4:4, 1 Kings 2:42, 2 Kings 2:16, 2 Kings 3:25, 2 Kings 7:6, 2 Kings 10:19, 2 Chronicles 25:16, 2 Chronicles 29:12, 2 Chronicles 35:18, Esther 3:13, Isaiah 57:8, Jeremiah 5:17, Ezekiel 1:27, Ezekiel 34:27, Daniel 6:24, Micah 4:2, Exodus 32:13, Deuteronomy 7:13, Deuteronomy 14:21, Deuteronomy 22:21, Deuteronomy 26:2, Joshua 10:11, Judges 20:28, 2 Samuel 7:23, 2 Samuel 9:10, 1 Chronicles 28:20, Nehemiah 9:28, Isaiah 51:6, Isaiah 63:7, Jeremiah 36:12, Ezekiel 47:1, Haggai 1:12, Genesis 43:7, Exodus 8:29, Leviticus 5:11, Joshua 6:20, Joshua 19:47, Ruth 4:11, 2 Samuel 19:35, 1 Chronicles 12:19, Nehemiah 13:5, Jeremiah 29:32, Jeremiah 44:26, Ezekiel 22:4, Ezekiel 34:10, Ezekiel 44:5, Hosea 9:4, Zechariah 1:21, Zechariah 12:6, Joshua 18:14, Judges 16:13, 2 Samuel 15:2, 1 Kings 13:26, 2 Kings 18:32, Ezra 3:11, Nehemiah 10:34, Esther 2:14, Jeremiah 38:22, Ezekiel 36:4, Genesis 43:18, Joshua 20:9, Judges 14:3, 2 Kings 18:14, Nehemiah 9:27, Nehemiah 10:28, Nehemiah 13:13, Isaiah 31:4, Jeremiah 9:10, Jeremiah 31:12, Ezekiel 28:2, Daniel 8:7, Revelation 19:20, Leviticus 15:25, 1 Kings 13:4, 2 Kings 12:4, 2 Chronicles 24:20, 2 Chronicles 31:10, Nehemiah 10:39, Esther 2:12, Jeremiah 27:8, Numbers 14:14, Joshua 19:51, 2 Chronicles 36:23, Esther 6:13, Ezekiel 40:5, Daniel 2:45, Daniel 4:34, Jonah 4:2, Haggai 1:14, Exodus 15:26, Exodus 34:10, Numbers 5:18, Judges 10:6, 2 Samuel 20:21, 1 Chronicles 12:40, 2 Chronicles 7:7, 2 Chronicles 19:11, 2 Chronicles 31:2, Ezra 6:5, Ezra 10:9, Isaiah 5:24, Isaiah 37:24, Jeremiah 52:31, Ezekiel 37:23, Daniel 3:27, Amos 9:1, Zephaniah 3:8, Deuteronomy 9:4, Joshua 22:5, Judges 11:18, 2 Samuel 18:9, 1 Kings 20:34, 2 Chronicles 9:1, 2 Chronicles 10:16, 2 Chronicles 35:15, Ecclesiastes 9:2, Isaiah 66:19, Ezekiel 11:1, Ezekiel 23:24, Deuteronomy 20:19, Deuteronomy 31:29, Joshua 24:32, 2 Kings 1:13, 2 Kings 11:2, 2 Chronicles 31:19, Nehemiah 8:4, Ezekiel 14:22, Ezekiel 32:27, Genesis 34:30, Exodus 3:8, Numbers 10:10, Numbers 35:8, Deuteronomy 31:21, 1 Samuel 7:3, 1 Kings 1:25, 1 Kings 11:33, 1 Chronicles 9:19, Ezra 6:3, Nehemiah 4:2, Nehemiah 9:25, Ezekiel 5:2, Ezekiel 13:9, Ezekiel 28:13, Acts 28:17, Leviticus 5:15, Deuteronomy 1:7, Joshua 8:31, 2 Chronicles 32:15, Nehemiah 7:3, Job 2:3, Isaiah 61:3, Jeremiah 8:2, Jeremiah 38:4, Ezekiel 8:17, Ezekiel 26:20, Ezekiel 31:12, Exodus 3:18, Exodus 13:15, Leviticus 11:32, Joshua 15:8, 2 Samuel 21:2, 1 Kings 8:43, 1 Kings 12:32, 2 Chronicles 20:20, Job 42:11, Joshua 6:13, 1 Samuel 2:30, 1 Kings 8:25, 2 Kings 19:23, 1 Chronicles 13:2, 1 Chronicles 28:9, 2 Chronicles 6:16, 2 Chronicles 29:34, Isaiah 50:2, Jeremiah 16:4, Jeremiah 19:7, Jeremiah 34:17, Jeremiah 36:6, Daniel 4:32, John 8:44, Genesis 24:14, Numbers 33:54, Judges 7:13, 1 Samuel 14:45, 2 Samuel 11:11, 2 Samuel 20:3, 1 Kings 11:38, 2 Kings 8:5, 2 Chronicles 6:33, 2 Chronicles 26:18, 2 Chronicles 32:21, Nehemiah 5:13, Jeremiah 25:30, Deuteronomy 12:11, Deuteronomy 22:24, Judges 18:2, 1 Samuel 1:11, 1 Samuel 21:9, 1 Samuel 22:17, 1 Samuel 27:1, 1 Kings 2:8, 2 Kings 1:16, 2 Kings 8:12, Nehemiah 1:6, Ezekiel 16:52, Daniel 3:28, Numbers 19:13, Numbers 36:3, Judges 20:10, 1 Samuel 6:18, 2 Chronicles 25:5, Ezekiel 20:21, Ezekiel 20:47, 1 Kings 14:21, 1 Kings 20:28, Nehemiah 9:29, Jeremiah 42:18, Ezekiel 7:19, Ezekiel 31:18, Ezekiel 34:8, 2 Kings 17:26, 1 Chronicles 5:26, 1 Chronicles 27:1, 2 Chronicles 22:9, Nehemiah 5:5, Ezekiel 20:40, Ezekiel 22:26, Deuteronomy 4:34, Judges 20:31, 2 Samuel 12:18, 1 Chronicles 21:17, 1 Chronicles 22:5, 2 Chronicles 1:11, Jeremiah 49:2, Ezekiel 32:30, Leviticus 4:7, Deuteronomy 31:17, 2 Kings 23:13, 2 Chronicles 24:25, 2 Chronicles 34:4, Ezra 4:15, Jeremiah 29:21, Leviticus 13:3, 1 Samuel 12:3, 2 Kings 10:25, 2 Chronicles 12:13, Ezra 8:33, Isaiah 30:6, Isaiah 49:7, Ezekiel 21:7, Ezekiel 32:25, Exodus 32:1, Leviticus 10:6, Numbers 5:15, Joshua 9:24, Joshua 22:9, Judges 7:4, 1 Samuel 14:41, 2 Samuel 6:20, 2 Kings 17:15, Nehemiah 13:15, Isaiah 61:10, Daniel 12:1, Leviticus 4:35, Deuteronomy 12:18, Joshua 12:7, 1 Samuel 17:46, Nehemiah 2:8, Esther 1:19, Ezekiel 20:8, Luke 6:42, Deuteronomy 17:8, 2 Samuel 14:32, 2 Samuel 24:16, Nehemiah 3:15, Nehemiah 6:10, 1 Kings 16:7, 2 Kings 10:6, 2 Kings 22:19, 2 Chronicles 13:11, 2 Chronicles 34:30, Esther 7:8, Isaiah 5:25, Jeremiah 40:7, Daniel 7:7, Revelation 17:8, Ezekiel 8:16, Exodus 29:20, Judges 6:13, 2 Samuel 19:43, 1 Kings 20:39, 2 Kings 25:19, Esther 9:22, Ezekiel 14:4, Daniel 3:3, Amos 7:17, Zephaniah 2:9, Zechariah 12:10, Numbers 15:24, Numbers 35:5, Judges 9:48, 1 Samuel 25:39, 1 Kings 19:11, 2 Kings 18:17, Nehemiah 13:19, Esther 2:15, Ezekiel 14:7, Leviticus 20:17, Joshua 22:27, 1 Samuel 11:7, Judges 1:27, 1 Samuel 5:11, Nehemiah 10:37, Joshua 4:8, 1 Samuel 14:34, 1 Samuel 29:6, 2 Chronicles 28:9, Nehemiah 12:44, Esther 9:12, Jeremiah 40:15, Leviticus 16:21, Numbers 5:27, Joshua 22:19, 2 Chronicles 34:9, Job 42:8, Jeremiah 17:26, Jeremiah 27:16, Jeremiah 32:8, Ezekiel 31:14, Ezekiel 33:12, Numbers 32:33, Judges 18:7, Jeremiah 35:17, Ezekiel 20:13, Ezekiel 47:12, 1 Samuel 17:28, Isaiah 66:20, Esther 3:8, Ezekiel 3:20, Ezekiel 45:7, Ezekiel 46:2, Daniel 6:7, 1 Samuel 29:3, Ezekiel 12:19, Deuteronomy 7:1, Judges 7:24, 1 Samuel 28:15, 2 Samuel 24:13, 1 Kings 13:2, 2 Kings 22:13, Job 1:5, Ezekiel 8:3, 1 Samuel 10:2, 1 Kings 15:18, 2 Kings 23:24, Ezra 5:14, Esther 6:9, Jeremiah 20:4, Jeremiah 40:4, Ezekiel 39:17, Amos 6:10, Deuteronomy 16:11, 2 Kings 23:2, 2 Chronicles 7:6, 2 Chronicles 19:10, Jeremiah 41:16, 1 Kings 3:6, 2 Chronicles 34:21, Esther 9:1, Daniel 9:7, Joshua 1:15, 2 Kings 23:3, 2 Chronicles 30:6, Daniel 5:21, Joshua 22:31, 1 Chronicles 21:15, Nehemiah 9:17, Jeremiah 40:5, Jeremiah 44:17, Ezekiel 42:13, 2 Kings 14:6, Jeremiah 52:25, Daniel 5:7, 1 Kings 2:32, 2 Kings 7:12, 2 Chronicles 8:14, 2 Chronicles 24:11, Ezekiel 20:28, Ezekiel 48:10, 2 Kings 25:23, 1 Chronicles 24:6, Joshua 17:11, Ezekiel 38:8, Daniel 5:11, Numbers 8:19, Deuteronomy 9:5, Ezekiel 18:24, 2 Samuel 3:8, Ezekiel 46:9, Daniel 4:19, Isaiah 45:14, Isaiah 59:21, Jeremiah 41:10, Ezekiel 38:20, 2 Kings 23:8, Nehemiah 9:32, Daniel 2:35, Daniel 4:25, Ruth 4:4, Jeremiah 35:15, Numbers 4:15, Deuteronomy 30:16, Jeremiah 32:44, 2 Chronicles 23:18, 1 Samuel 26:19, 2 Kings 10:15, Jeremiah 24:1, Jeremiah 44:25, Deuteronomy 26:13, 2 Kings 23:4, Jeremiah 21:4, Malachi 3:5, 1 Chronicles 21:12, Daniel 3:15, 2 Samuel 14:19, 2 Chronicles 23:13, Exodus 7:19, Deuteronomy 5:14, Deuteronomy 13:5, Jeremiah 25:9, 2 Chronicles 15:8, Ezekiel 43:7, Ezekiel 46:12, Daniel 12:7, Joshua 5:6, Ezra 9:1, Ezekiel 6:9, Ezekiel 45:17, 2 Kings 12:18, Isaiah 66:3, Daniel 11:6, 2 Samuel 14:7, Joshua 5:1, 2 Kings 1:6, 1 Kings 2:5, 2 Chronicles 24:14, Judges 19:9, 1 Chronicles 28:1, 2 Chronicles 5:13, 2 Chronicles 2:4, 2 Chronicles 2:14, Jeremiah 44:12, Jeremiah 33:11, Esther 4:11, 1 Samuel 10:1, 1 Kings 8:64, 1 Chronicles 29:2, Daniel 6:12, Esther 8:5, Ezekiel 43:11, Ezekiel 48:21, 2 Kings 6:32, 2 Chronicles 22:11, Daniel 4:23, Revelation 20:4, 2 Chronicles 31:1, 2 Chronicles 28:15, 1 Samuel 29:4, Joshua 8:33, Jeremiah 21:7, Ezra 3:8, Esther 3:12, Daniel 5:23, 2 Kings 16:15, Esther 8:9

Javascript Functions for PostgreSQL

CRAIG KERSTIENS — Tue, 25 Jun 2013 23:55:56 GMT

Javascript in Postgres has gotten a good bit of love lately, part of that is from Heroku Postgres recently adding support for Javascript and part from a variety of people championing the power of it such as @leinweber (Embracing the web with JSON and PLV8) and @selenamarie (schema liberation with JSON and PLV8). In a recent conversation it was pointed out that it seems a bit of headache to have to create your own functions, or at least having an initial collection would make it that much more powerful. While many can look forward to PostgreSQL 9.3 which will have a bit more built in support for JSON a few functions can really help make it more useful today.

These are courtesy of Will Leinweber. For each of the following functions I’ll highlight an example of using it as well. To get an idea of the data its being run on:

select * from example;
data
--------------------------------------------
{"name":"Craig Kerstiens", +
"age":27, +
"siblings":1, +
"numbers":[ +
{"type":"work", +
"number":"123-456-7890"}, +
{"type":"home", +
"number":"456-123-7890"}]}
(1 row)

get_text

CREATE OR REPLACE FUNCTION
get_text(key text, data json)
RETURNS text AS $$
return data[key];
$$ LANGUAGE plv8 IMMUTABLE STRICT;

Then using the function:

select get_text('name', data) from example;
get_text
----------------
Craig Kerstiens
(1 row)

get_numeric

CREATE OR REPLACE FUNCTION
get_numeric(key text, data json)
RETURNS numeric AS $$
return data[key];
$$ LANGUAGE plv8 IMMUTABLE STRICT;

Then using the function:

select get_numeric('siblings', data) from example;
get_text
----------------
1
(1 row)

json_select

create or replace function
json_select(selector text, data json)
returns json as $$
exports = {};
(function(a){function z(a){return{sel:q(a)[1],match:function(a){return y(this.sel,a)},forEach:function(a,b){return x(this.sel,a,b)}}}function y(a,b){var c=[];x(a,b,function(a){c.push(a)});return c}function x(a,b,c,d,e,f){var g=a[0]===","?a.slice(1):[a],h=[],i=!1,j=0,k=0,l,m;for(j=0;j<g.length;j++){m=w(b,g[j],d,e,f),m[0]&&(i=!0);for(k=0;k<m[1].length;k++)h.push(m[1][k])}if(h.length&&typeof b=="object"){h.length>=1&&h.unshift(",");if(u(b))for(j=0;j<b.length;j++)x(h,b[j],c,undefined,j,b.length);else for(l in b)b.hasOwnProperty(l)&&x(h,b[l],c,l)}i&&c&&c(b)}function w(a,b,c,d,e){var f=[],g=b[0]===">"?b[1]:b[0],h=!0,i;g.type&&(h=h&&g.type===v(a)),g.id&&(h=h&&g.id===c),h&&g.pf&&(g.pf===":nth-last-child"?d=e-d:d++,g.a===0?h=g.b===d:(i=(d-g.b)%g.a,h=!i&&d*g.a+g.b>=0));if(h&&g.has){var j=function(){throw 42};for(var k=0;k<g.has.length;k++){try{x(g.has[k],a,j)}catch(l){if(l===42)continue}h=!1;break}}h&&g.expr&&(h=p(g.expr,a)),b[0]!==">"&&b[0].pc!==":root"&&f.push(b),h&&(b[0]===">"?b.length>2&&(h=!1,f.push(b.slice(2))):b.length>1&&(h=!1,f.push(b.slice(1))));return[h,f]}function v(a){if(a===null)return"null";var b=typeof a;b==="object"&&u(a)&&(b="array");return b}function u(a){return Array.isArray?Array.isArray(a):b.call(a)==="[object Array]"}function t(a,b,c){var d=b,g={},j=i(a,b);j&&j[1]===" "&&(d=b=j[0],j=i(a,b)),j&&j[1]===f.typ?(g.type=j[2],j=i(a,b=j[0])):j&&j[1]==="*"&&(j=i(a,b=j[0]));for(;;){if(j===undefined)break;if(j[1]===f.ide)g.id&&e("nmi",j[1]),g.id=j[2];else if(j[1]===f.psc)(g.pc||g.pf)&&e("mpc",j[1]),j[2]===":first-child"?(g.pf=":nth-child",g.a=0,g.b=1):j[2]===":last-child"?(g.pf=":nth-last-child",g.a=0,g.b=1):g.pc=j[2];else{if(j[1]!==f.psf)break;if(j[2]===":val"||j[2]===":contains")g.expr=[undefined,j[2]===":val"?"=":"*=",undefined],j=i(a,b=j[0]),j&&j[1]===" "&&(j=i(a,b=j[0])),(!j||j[1]!=="(")&&e("pex",a),j=i(a,b=j[0]),j&&j[1]===" "&&(j=i(a,b=j[0])),(!j||j[1]!==f.str)&&e("sex",a),g.expr[2]=j[2],j=i(a,b=j[0]),j&&j[1]===" "&&(j=i(a,b=j[0])),(!j||j[1]!==")")&&e("epex",a);else if(j[2]===":has"){j=i(a,b=j[0]),j&&j[1]===" "&&(j=i(a,b=j[0])),(!j||j[1]!=="(")&&e("pex",a);var k=q(a,j[0],!0);j[0]=k[0],g.has||(g.has=[]),g.has.push(k[1])}else if(j[2]===":expr"){g.expr&&e("mexp",a);var l=o(a,j[0]);j[0]=l[0],g.expr=l[1]}else{(g.pc||g.pf)&&e("mpc",a),g.pf=j[2];var m=h.exec(a.substr(j[0]));m||e("mepf",a),m[5]?(g.a=2,g.b=m[5]==="odd"?1:0):m[6]?(g.a=0,g.b=parseInt(m[6],10)):(g.a=parseInt((m[1]?m[1]:"+")+(m[2]?m[2]:"1"),10),g.b=m[3]?parseInt(m[3]+m[4],10):0),j[0]+=m[0].length}}j=i(a,b=j[0])}d===b&&e("se",a);return[b,g]}function s(a){if(a[0]===","){var b=[","];for(var c=c;c<a.length;c++){var d=r(d[c]);b=b.concat(d[0]===","?d.slice(1):d)}return b}return r(a)}function r(a){var b=[],c;for(var d=0;d<a.length;d++)if(a[d]==="~"){if(d<2||a[d-2]!=">")c=a.slice(0,d-1),c=c.concat([{has:[[{pc:":root"},">",a[d-1]]]},">"]),c=c.concat(a.slice(d+1)),b.push(c);if(d>1){var e=a[d-2]===">"?d-3:d-2;c=a.slice(0,e);var f={};for(var g in a[e])a[e].hasOwnProperty(g)&&(f[g]=a[e][g]);f.has||(f.has=[]),f.has.push([{pc:":root"},">",a[d-1]]),c=c.concat(f,">",a.slice(d+1)),b.push(c)}break}if(d==a.length)return a;return b.length>1?[","].concat(b):b[0]}function q(a,b,c,d){c||(d={});var f=[],g,h;b||(b=0);for(;;){var j=t(a,b,d);f.push(j[1]),j=i(a,b=j[0]),j&&j[1]===" "&&(j=i(a,b=j[0]));if(!j)break;if(j[1]===">"||j[1]==="~")j[1]==="~"&&(d.usesSiblingOp=!0),f.push(j[1]),b=j[0];else if(j[1]===",")g===undefined?g=[",",f]:g.push(f),f=[],b=j[0];else if(j[1]===")"){c||e("ucp",j[1]),h=1,b=j[0];break}}c&&!h&&e("mcp",a),g&&g.push(f);var k;!c&&d.usesSiblingOp?k=s(g?g:f):k=g?g:f;return[b,k]}function p(a,b){if(a===undefined)return b;if(a===null||typeof a!="object")return a;var c=p(a[0],b),d=p(a[2],b);return l[a[1]][1](c,d)}function o(a,b){function c(a){return typeof a!="object"||a===null?a:a[0]==="("?c(a[1]):[c(a[0]),a[1],c(a[2])]}var d=n(a,b?b:0);return[d[0],c(d[1])]}function n(a,b){b||(b=0);var c=m(a,b),d;if(c&&c[1]==="("){d=n(a,c[0]);var f=m(a,d[0]);(!f||f[1]!==")")&&e("epex",a),b=f[0],d=["(",d[1]]}else!c||c[1]&&c[1]!="x"?e("ee",a+" - "+(c[1]&&c[1])):(d=c[1]==="x"?undefined:c[2],b=c[0]);var g=m(a,b);if(!g||g[1]==")")return[b,d];(g[1]=="x"||!g[1])&&e("bop",a+" - "+(g[1]&&g[1]));var h=n(a,g[0]);b=h[0],h=h[1];var i;if(typeof h!="object"||h[0]==="("||l[g[1]][0]<l[h[1]][0])i=[d,g[1],h];else{i=h;while(typeof h[0]=="object"&&h[0][0]!="("&&l[g[1]][0]>=l[h[0][1]][0])h=h[0];h[0]=[d,g[1],h[0]]}return[b,i]}function m(a,b){var d,e=j.exec(a.substr(b));if(e){b+=e[0].length,d=e[1]||e[2]||e[3]||e[5]||e[6];if(e[1]||e[2]||e[3])return[b,0,c(d)];if(e[4])return[b,0,undefined];return[b,d]}}function k(a,b){return typeof a===b}function i(a,b){b||(b=0);var d=g.exec(a.substr(b));if(!d)return undefined;b+=d[0].length;var h;d[1]?h=[b," "]:d[2]?h=[b,d[0]]:d[3]?h=[b,f.typ,d[0]]:d[4]?h=[b,f.psc,d[0]]:d[5]?h=[b,f.psf,d[0]]:d[6]?e("upc",a):d[8]?h=[b,d[7]?f.ide:f.str,c(d[8])]:d[9]?e("ujs",a):d[10]&&(h=[b,f.ide,d[10].replace(/\\([^\r\n\f0-9a-fA-F])/g,"$1")]);return h}function e(a,b){throw new Error(d[a]+(b&&" in '"+b+"'"))}function c(a){try{if(JSON&&JSON.parse)return JSON.parse(a);return(new Function("return "+a))()}catch(b){e("ijs",b.message)}}var b=Object.prototype.toString,d={bop:"binary operator expected",ee:"expression expected",epex:"closing paren expected ')'",ijs:"invalid json string",mcp:"missing closing paren",mepf:"malformed expression in pseudo-function",mexp:"multiple expressions not allowed",mpc:"multiple pseudo classes (:xxx) not allowed",nmi:"multiple ids not allowed",pex:"opening paren expected '('",se:"selector expected",sex:"string expected",sra:"string required after '.'",uc:"unrecognized char",ucp:"unexpected closing paren",ujs:"unclosed json string",upc:"unrecognized pseudo class"},f={psc:1,psf:2,typ:3,str:4,ide:5},g=new RegExp('^(?:([\\r\\n\\t\\ ]+)|([~*,>\\)\\(])|(string|boolean|null|array|object|number)|(:(?:root|first-child|last-child|only-child))|(:(?:nth-child|nth-last-child|has|expr|val|contains))|(:\\w+)|(?:(\\.)?(\\"(?:[^\\\\\\"]|\\\\[^\\"])*\\"))|(\\")|\\.((?:[_a-zA-Z]|[^\\0-\\0177]|\\\\[^\\r\\n\\f0-9a-fA-F])(?:[_a-zA-Z0-9\\-]|[^\\u0000-\\u0177]|(?:\\\\[^\\r\\n\\f0-9a-fA-F]))*))'),h=/^\s*\(\s*(?:([+\-]?)([0-9]*)n\s*(?:([+\-])\s*([0-9]))?|(odd|even)|([+\-]?[0-9]+))\s*\)/,j=new RegExp('^\\s*(?:(true|false|null)|(-?\\d+(?:\\.\\d*)?(?:[eE][+\\-]?\\d+)?)|("(?:[^\\]|\\[^"])*")|(x)|(&&|\\|\\||[\\$\\^<>!\\*]=|[=+\\-*/%<>])|([\\(\\)]))'),l={"*":[9,function(a,b){return a*b}],"/":[9,function(a,b){return a/b}],"%":[9,function(a,b){return a%b}],"+":[7,function(a,b){return a+b}],"-":[7,function(a,b){return a-b}],"<=":[5,function(a,b){return k(a,"number")&&k(b,"number")&&a<=b}],">=":[5,function(a,b){return k(a,"number")&&k(b,"number")&&a>=b}],"$=":[5,function(a,b){return k(a,"string")&&k(b,"string")&&a.lastIndexOf(b)===a.length-b.length}],"^=":[5,function(a,b){return k(a,"string")&&k(b,"string")&&a.indexOf(b)===0}],"*=":[5,function(a,b){return k(a,"string")&&k(b,"string")&&a.indexOf(b)!==-1}],">":[5,function(a,b){return k(a,"number")&&k(b,"number")&&a>b}],"<":[5,function(a,b){return k(a,"number")&&k(b,"number")&&a<b}],"=":[3,function(a,b){return a===b}],"!=":[3,function(a,b){return a!==b}],"&&":[2,function(a,b){return a&&b}],"||":[1,function(a,b){return a||b}]};a._lex=i,a._parse=q,a.match=function(a,b){return z(a).match(b)},a.forEach=function(a,b,c){return z(a).forEach(b,c)},a.compile=z})(typeof exports=="undefined"?window.JSONSelect={}:exports)
return JSON.stringify(
exports.match(selector,
data));
$$ LANGUAGE plv8 IMMUTABLE STRICT

Then using the function:

select json_select('.name nth-child(1)', data) as name, json_select('.numbers', data) as phone
from example;
name | phone
--------------------+------------------------------------------------------------------------------------------
["Craig Kerstiens"] | [[{"type":"work","number":"456-123-7890"},{"type":"home","number":"123-456-7890"}]]
(1 row)

javascript injection attack

create or replace function
js(src text) returns text as $$
return eval(
"(function() { " + src + "})"
)();
$$ LANGUAGE plv8;

Have any others you feel are essential when starting to work with JSON? Let me know craig.kerstiens@gmail.com. Beyond that give JSON and JavaScript a try inside your database.

Oracle Database 12c R1 (12.1.0.1.0) is finally released!

Tanel Poder Blog — Tue, 25 Jun 2013 21:39:46 GMT

You can download it from http://edelivery.oracle.com

And now I (and other beta testers) can finally start writing about the new cool features in it! :)

Looks like only the Linux x86-64, Solaris x86-64 + SPARC ports are available first (as usual).

(just a screenshot below, you’ll need to go to http://edelivery.oracle.com to download the files)

Update: Also the Oracle 12c Documentation is now available in the OTN website.

MongoDB Masters Summit 2013

Nicola Iarocci — Tue, 25 Jun 2013 03:00:00 GMT

I’m just back from the MongoDB Masters Summit hosted by 10Gen in New York City. In just a couple days I was given the opportunity to meet and share knowledge (and fun!) with amazingly talented minds coming from all over the world. I’m back with literally dozen new ideas opportunities and concepts, on which I’ll need to elaborate a little bit. While I cannot comment on the many things the smart minds at 10Gen are working on, rest assured that the future of MongoDB is looking great and brighter than ever.

Jon Birdsong: Founder of Rivalry

Sam Solomon — Tue, 25 Jun 2013 03:00:00 GMT

Jon Birdsong is the founder of Rivalry, a sales process management software company.

If you're going to change databases, do it in one go

Databases & Life — Tue, 25 Jun 2013 03:00:00 GMT

At Uboot, there was the suggestion that we should change database technology. This was because we would save money with by moving away from Oracle to e.g. MySQL.

It was further decided, as we had 200k+ lines of code, and 100+ tables, that if a migration was to occur, it shouldn’t happen “all at once”, but instead one would have some parts of the system migrated with other parts of the system not yet migrated.

Small BF Interpreter in Scala

Niklas Korz — Tue, 25 Jun 2013 01:00:00 GMT

This is a small interpreter for BF I wrote about a month ago. Nothing new, but I thought I might share it anyway.

Post Statistics Plugin for Pelican

duncanlock.net — Mon, 24 Jun 2013 07:28:11 GMT

This is a Pelican plugin to calculate various statistics about a post and store them in an article.stats dictionary. You can see this in action in the sidebar on the left of this site.

I wanted to implement the nice little “X min read” thing from Medium - and it turned out that it was easy to provide a few other interesting stats at the same time, for people to use in their templates.

The returned article.stats dictionary contains the following:

wc: how many words
read_mins: how many minutes would it take to read this article, based on 250 wpm
word_counts: frequency count of all the words in the article; can be used for tag/word clouds
fi: Flesch-kincaid Index/ Reading Ease
fk: Flesch-kincaid Grade Level

For example:

{
    'wc': 2760,
    'fi': '65.94',
    'fk': '7.65',
    'word_counts': Counter({u'to': 98, u'a': 90, ...}),
    'read_mins': 12
}

This allows you to output these values in your templates, like this, for example:

<p title="~{{ article.stats['wc'] }} words">~{{ article.stats['read_mins'] }} min read</p>
<ul>
    <li>Flesch-kincaid Index/ Reading Ease: {{ article.stats['fi'] }}</li>
    <li>Flesch-kincaid Grade Level: {{ article.stats['fk'] }}</li>
</ul>

The word_counts variable is a python Counter dictionary and looks something like this, with each unique word and it’s frequency:

Counter({u'to': 98, u'a': 90, u'the': 83, u'of': 50, u'karma': 50, .....

This can be used to create a tag/word cloud for a post.

Requirements

post_stats requires BeautifulSoup:

$ pip install beautifulsoup4

Caveat Emptor

Please note that the values are a wee bit approximate - it’s surprisingly difficult to compute a perfect word count - it depends on what you count as a ‘word’, how many code samples, data tables, etc… you have in your post. Calculating the Flesch-kincaid Index/ Reading Ease/ Grade level stuff involves counting syllables - again something that is very hard to do perfectly, but quite easy to get 90% right.

In addition, the Flesch-kincaid stuff currently only works on English text, but everything else should work multi-language. I haven’t done much Unicode testing though, so patches welcome!

Slim Wallet Comparison

Justin Garrison's Homepage — Mon, 24 Jun 2013 03:00:00 GMT

As a follow-up to my recent article about the best wallet ever, I was given the opportunity to test some of the slim wallets

Fresh releases! puppet-ipa, puppet-nfs, puppet-gluster

The Technical Blog of James on purpleidea.com — Sun, 23 Jun 2013 12:22:32 GMT

I’ve been a little slow in making release announcements, so here’s some news:

I’ve just released the third stage of my puppet-ipa module. At the moment it now supports installation, managing of hosts, and managing of services. It integrates with my puppet-nfs module to allow you to easily setup and run an NFSv4 kerberized server and client.

While we’re at it, that’s some more news: I’ve just released a puppet-nfs module to make your /etc/exports management easier. It’s designed to manage other security types, or even to work without kerberos or any authentication at all, but I haven’t tested those.

Visiting Hour by Stuart Conn

ho.dges.online — Sat, 22 Jun 2013 03:00:00 GMT

In the pond of our new garden
were five orange stains, under
inches of ice. Weeks since anyone
had been there. Already by far
the most severe winter for years.
You broke the ice with a hammer.
I watched the goldfish appear,
blunt-nosed and delicately clear.

Since then so much has taken place
to distance us from what we were.
That it should come to this.
Unable to hide the horror
in my eyes, I stand helpless
by your bedside and can do no more
than wish it were simply a matter

Five years of Weight Tracking

Tafkas Blog — Sat, 22 Jun 2013 03:00:00 GMT

After I moved back from New Jersey in June 2008 I started to track my body weight more seriously. My routine usually consists of getting up and after finishing the morning bathroom I would step on my scale. That way I try to ensure that the condition for each weighing are as similar as possible. I recorded my weight on paper and eventually would put everything into a spreadsheet for further analysis.

Die Flut-Hilfe-App flut.stomt.de wird vorgestellt

Philipp Zentner — Sat, 22 Jun 2013 02:43:10 GMT

Ich freue mich euch mein mobiles Webtool zur besseren Koordination von Helfern vorstellen zu können. https://flut.stomt.de Die mobile Webseite ist mit HTML5 und jQuery Mobile geschrieben und arbeitet mit einem kleinen PHP Backend zusammen. Mit der Flut-Hilfe-App kann man eine Hilfeanfrage stellen welche beinhaltet wer,…

I hate your code

Honza Pokorný — Fri, 21 Jun 2013 16:25:00 GMT

When starting to work on an existing codebase, I often find myself in a state of despair. The code doesn’t make any sense, the programmers must have all been idiots, why on earth would they do it like this, … I hate everything about the code.

I spend hours going through it, thinking to myself, I would have done a much better job writing this and making a list of changes that must be done in order for the project to conform to my standards.

But then, when I have spent enough time reading everything, something clicks in my mind. I see what the authors were trying to do and everything makes sense. It’s actually kind of clever.

And I feel dumb. Every time.

Safety Nets

Zac Szewczyk — Fri, 21 Jun 2013 16:20:51 GMT

A few weeks ago now Yahoo bought Tumblr for more than a billion dollars; responding to the news, Marco Arment wrote The One-Person Product. In episode seventy-five of Roderick on the Line, John talked about watching successful young artists blow fortunes one CD at a time. On the one hundred and twentieth episode of their Back to Work program, Dan and Merlin discussed a common topic between Marco’s article and John’s podcast, the topic of a safety net.

Permalink.

Matt Gemmell

Zac Szewczyk — Thu, 20 Jun 2013 22:54:24 GMT

I really enjoy reading Matt Gemmell’s writing. His article from quite a while ago, Writing Tools, caught my attention, and iOS 7 greatly impressed me. So, earlier this afternoon, I subscribed to his site; ironically, The Unfollower was the first article I read after doing so. Continuing the previously-established trend of excellence, this piece was no exception.

Permalink.

Persuading David Simon

Zac Szewczyk — Thu, 20 Jun 2013 22:54:07 GMT

While I don’t agree with many of the author’s points, nor do I agree with her overarching theme, she did, however, say a number of interesting things throughout the piece. I tried, for the most part, to stay away from articles written on this topic, but this one is well worth the read.

“The security state operates as a ratchet. Once you click in a new level of surveillance or intrusiveness, it becomes the new baseline. What was unthinkable yesterday becomes permissible in exceptional cases today, and routine tomorrow.”

Permalink.

Urgent: help needed for a Workshop on Open Data in and from schools

Welcome to Marco Fioretti's website! on Stop at Zona-M — Thu, 20 Jun 2013 21:02:24 GMT

What are the Commons anyway? Some answers and thoughts from ECC 2013 in Berlin

Welcome to Marco Fioretti's website! on Stop at Zona-M — Thu, 20 Jun 2013 14:22:57 GMT

A Marvellous & Incomplete Compendium of reddit Automatons & Bots

duncanlock.net — Thu, 20 Jun 2013 05:48:54 GMT

Figure 1. How much does a software bot weigh, anyway? Heavily modified & adapted from the original public domain robot on openclipart, posted by johnny_automatic.

reddit, the insanely popular internet community, had 71,435,935 unique visitors last month, with over 2,360,783 people logged in [1].

I say people - but it turns out that not all the denizens of reddit are human. There are also bots. Lots and lots of bots. How many? No-one really knows. [2]

This is an interesting and somewhat shadowy facet of the otherwise very public reddit community, so I thought I’d take a closer look…

What is a reddit bot?

A reddit bot is no different from any other user, as far as reddit is concerned. The only difference is that rather than a human logging in to upvote cat pictures and post comments, this account is used by an automated computer script.

reddit has a captcha system to help prevent automated signups - so the bot’s human creator will need to create a new user account for the bot to use, then program the username and password into the bot, so it can use that account - just like a human would.

In the same way that computers can run scripts to automatically check weather data and send you a message if you should take an umbrella with you today, a computer can run scripts to automatically check reddit for certain activity - and post comments if certain conditions are met. [3] A reddit bot does this by doing what your web browser does behind the scenes when you use websites - it makes requests and sends things to the reddit servers.

reddit also has an API (Application Programming Interface) [4] which makes it easier for automated external services (including bots) to talk to reddit. This allows bots & scrapers to do things in bulk, like “Show me all the new posts in the last hour” – they can then go away, analyze this information and then take actions based on it.

It’s a Hard Bot Life

A major problem for any internet activity at scale is ‘spam’, or similar unwanted activity, in some form or other.

reddit has scale coming out of its ears, so needs aggressive, pervasive and rapid automated spam control algorithms - combined with extensive human flagging and moderation - just to survive.

These mechanisms come down on bots particularly hard, to prevent the place being overrun by an army of implacable text hurling machines, typing & posting at the speed of light.

This is a really nice /r/InternetAmA thread discussing the retirement of TicTacToeBot, which did exactly what you’d expect:

Figure 2. The only winning move is not to play.

Some quotes from TicTacToeBots developer:

Q: Your account has only existed for 6 days. How have you already been banned from the subreddits?

A: No clue. Every day I am banned from subreddits. I woke up today, looked at the mail. Banned from circlejerk, cats, and skyrim… Those aren’t even default subs. I had to sub to new channels to be any active as a bot.

Q: You actually got banned from circlejerk [5]? For derailing threads?!?

A: Yes

TicTacToeBot got shot down for derailing threads - i.e. for being disruptive. It was intentionally designed to randomly pop up and challenge people to a game - whimsical and fun, but also an uninvited disruption - albeit a harmless good-natured one.

So unless they’re careful, disruptive bots tend to have a fairly short life on reddit, quickly being hunted down and blocked by reddit’s immune system – even whimsical and seemingly harmless bots, like TicTacToeBot.

More circumspect bots, like JiffyBot, CHART_BOT or serendipity - either completely or largely confine themselves to their own subreddits, only turning up elsewhere when invited. This generally means that they’ll be left alone to do their thing, because they’re not interfering with anyone else. They’re also completely upfront about what they do and provide a useful service to the reddit community.

Workin’ on a Bot Farm

Bots also take resources to run - both to initially create & then to maintain the code - but mainly to provide a computer to run them on [6]. Bots need a computer to host their code and to lavish CPU cycles running them - reddit doesn’t do this, it’s up to the bots creator to host them somewhere. This generally isn’t free and can eat up quite a lot of computer resources, depending on what the bot does. Bots can get shut down by their creators for lack of resources - time or money - or lack of interest. Pretty much all reddit bots are just created for fun, for learning, or both - sometimes the creator just wants to move on to another project.

Bad Bots, Sad Bots

Some bots are designed to try to behave statistically more like human users [7], or to deliberately try to slip under the radar. Some bots are designed to boost the reddit karma [8] of their masters by pretending to be regular users and up-voting their masters posts and down-voting those who disagree with them. Some bots are designed to start flame wars and generally be mean, virtually.

This is pretty sad and pathetic… so I’m going to ignore them.

So, without further ado, here’s the compendium, split into Bots that you can Summon with an Incantation and Bots that just Show Up, without human intervention.

Bots that you can Summon with an Incantation

These bots listen out for their summoning incantation to be posted somewhere on reddit, then turn up and do their thing in response:

JiffyBot

Purpose

Makes animated GIFs out of YouTube links

Creators

Home Base

/u/JiffyBot
/r/JiffyBot
JiffyBot Documentation
JiffyBot in Action
JiffyBot FAQ
JiffyBot Source Code - NB this is an orphaned fork of the original GitHub code repository; I’m currently trying to find out what happened to the original.

Current Karma

1 link karma
30,173 comment karma

A Redditor for

16 days

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/JiffyBot	0	333 (391)
/r/cringe	0	92 (614)
/r/tf2	0	45 (315)
/r/gaming	0	40 (418)
/r/youtubehaiku	0	36 (173)
/r/leagueoflegends	0	27 (73)
/r/funny	0	27 (434)
/r/YouShouldKnow	0	27 (28)
/r/SeeThisShit	0	22 (22)
/r/DotA2	0	17 (35)
/r/starcraft	0	15 (96)
/r/hockey	0	12 (7)
/r/atheism	0	10 (221)

Summon by posting a link to a YouTube video, then writing Jiffy! followed by a start time and end time, in either of these forms:

Jiffy! 0:07-0:12
/u/JiffyBot 0:00-0:15

The second form is apparently more reliable.

The bot will respond by replying to your comment, with a comment of it’s own, containing an imgur.com link to an animated GIF of that video, for the time period you specified. This is great for people on mobile devices - animated GIFs load much quicker than YouTube.

Figure 3. JiffyBot in action: it can also do multiple GIFs!

BitcoinTip

Purpose

The bitcointip bot allows redditors to tip each other ‘real’ money, just by leaving a reddit comment or message.

Human Creator

/u/NerdfighterSean

Home Base

Current Karma

9 link karma
11,906 comment karma

A Redditor for

1 year

Source Code

https://github.com/NerdfighterSean/bitcointip

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/Bitcoin	0	368 (813)
/r/GirlsGoneBitcoin	0	51 (59)
/r/worldnews	0	36 (133)
/r/IAmA	0	30 (81)
/r/AskReddit	0	30 (88)
/r/bitcointip	0	29 (49)
/r/pics	0	20 (136)
/r/technology	0	13 (134)
/r/AdviceAnimals	0	12 (23)
/r/investing	0	11 (43)
/r/gaming	0	11 (241)
/r/tf2	0	10 (145)
/r/starcraft	0	10 (205)

The bot scans user comments and messages for tips of the form:

+/u/bitcointip @RedditUsername $1
+/u/bitcointip @Username $1usd
+/u/bitcointip BitcoinAddress 1 millibit
+/u/bitcointip Username ฿0.001 verify
+/u/bitcointip $1 # This tips 1 usd to whoever posted the comments parent
+/u/bitcointip BitcoinAddress ALL # This sends your entire balance to that bitcoin address
+/u/bitcointip 2 internets # An "internet" is worth $0.25

You have to setup a bitcointip tip account in advance and put some funds into it. It then sends the specified amount of bitcoins from the sender’s bitcointip account, to the receiver’s bitcointip account. Supports lots of different currencies, which get converted to bitcoin automatically.

Allows you to tip people for useful or awesome comments, in a very natural and low friction way:

Figure 4. BitcoinTip in action: Adam Savage gets tipped. Yes that Adam Savage.

CHART_BOT

Purpose

Automatically generates and posts a chart of your posting history - or someone else’s.

Home Base

Active SubReddits

Overwhelmingly active in it’s own subreddit, but has been known to pop-up elsewhere, for the lulz:

Subreddit	Submissions (karma)	Comments (karma)
/r/CHART_BOT	1 (2)	931 (1063)
/r/WTF	0	19 (13)
/r/wheredidthesodago	0	14 (-14)
/r/science	0	13 (13)
/r/TheLastAirbender	0	12 (20)

Current Karma

3 link karma
5,686 comment karma

A Redditor for

8 months

Making a submission to this subreddit will cause CHART_BOT to automatically generate and post a chart of your reddit posting history. You can also request charts of other reddit users by putting their username prefixed with an @ in the title of your submission. The charts look like this - here’s mine:

CHART_BOT also produces some graphs of activity which are quite interesting. Here are the ‘Posts Over Time’ ones for me (on the left) and chartbot (on the right). You can clearly see the characteristic posting pattern of humans (irregular) vs. bots (regular):

Figure 5. Fairly typical human reddit user (left) vs bot (right). Bot scripts are often run on a regular schedule - e.g. once an hour, every 10 minutes, etc… - which explains the regular patterns of activity.

Bots that just Show Up, without human intervention

These bots ceaselessly scan the endless, mighty cataract of text that is reddit and leap in whenever they sense patterns in the noise & spume that match their programming.

raddit-bot

Purpose

Shares (most of) the data about the posts it sees being used on radd.it. Currently it’s sharing a combination of data from youtube, soundcloud, vimeo, last.fm, IMDb, and amazon; only comments in subreddits it’s been invited to.

Human Creator

/u/radd_it

Home Base

Current Karma

1915 link karma
376 comment karma

A Redditor for

1 month

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/listentothis	0	765 (1109)
/r/FullMoviesOnline	352 (764)	213 (215)
/r/listentonew	51 (55)	0
/r/VBT	0	1 (1)
/r/Music	0	1 (2)

Raddit-bot is a helpful bot that posts information when you post a link to a piece of media that’s been on radd.it. It’s posts look like this, sharing a wealth of links and information about things that people have linked to:

Discovered this bot while browsing /r/listentothis - which in turn led me to discover radd.it; I’m currently trying to resist getting distracted by radd.it itself.

haiku_robot

Purpose

Watches reddit for comments that would qualify as Haiku [9] and posts a reply, with the original text reformatted into 3 lines of 5, 7 & 5 syllables.

Home Base

Current Karma

1 link karma
104,473 comment karma

A Redditor for

1 year

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/funny	0	284 (2580)
/r/pics	0	199 (1239)
/r/AdviceAnimals	0	126 (619)
/r/gaming	0	90 (501)
/r/WTF	0	56 (618)
/r/todayilearned	0	25 (115)
/r/IAmA	1 (8)	23 (99)
/r/gifs	0	23 (164)
/r/videos	0	22 (77)
/r/leagueoflegends	0	15 (404)
/r/mildlyinteresting	0	15 (28)
/r/gonewild	0	10 (116)
/r/technology	0	10 (13)
Plus 45 more…

This seems to be quite popular, with lots of very highly upvoted comments - like this one:

Metric System Converting bot

Purpose

When it sees a post using Imperial/US units, it replies with a conversion to their Metric equivalents.

Human Creator

/u/xwcg

Home Base

Current Karma

239 link karma
26,779 comment karma

A Redditor for

27 days

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/AdviceAnimals	1 (285)	538 (4160)
/r/pics	0	94 (1878)
/r/todayilearned	0	68 (625)
/r/gaming	0	63 (65)
/r/videos	0	44 (493)
/r/gifs	0	15 (258)
/r/politics	0	15 (230)
/r/progresspics	0	10 (92)

MetricConversionBot will convert the following units to their metric equivalents:

Pounds (lbs) to Kilograms
Miles to Kilometers
Miles per hour to Kilometers per Hour
Foot/Feet to Meters
Kelvin to Celsius
Fahrenheit to Celsius
inch to cm
yard to meters
(US) fl. oz. to ml
ounces to grams

and it leaves comments that look like this:

This bot is a (more popular) successor to the deceased SI_BOT. Interestingly, MetricConversionBot has attracted it’s own parody bots, MetricConversionNot - which randomly makes similar looking, but factually inaccurate parody comments (somewhat similar to the older, inactive parody bot Lord_Longbottom) and UselessConversionBot:

Website Mirror bot

Purpose

Mirrors websites that go down from the traffic surge, due to being posted on reddit.

Home Base

Current Karma

1 link karma
9,946 comment karma

A Redditor for

20 days

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/todayilearned	0	29 (6391)
/r/politics	0	17 (870)
/r/worldnews	0	15 (1021)
/r/technology	0	8 (203)
/r/Bitcoin	0	4 (25)
/r/atheism	0	4 (2299)
/r/starcraft	0	4 (50)
/r/conspiracy	0	4 (15)
/r/leagueoflegends	0	3 (109)

Takes a (generally very tall) screenshot of the page that was linked to, puts it on imgur.com and posts a link in a comment:

tabledresser

Purpose

Automatically generates a summary table from an AmA thread, showing all answered questions, along with their answers.

Human Creator

/u/epsy

Home Base

Current Karma

4 link karma
8,857 comment karma

A Redditor for

1 year

Source Code

https://github.com/epsy/tabledresser

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/tabled	1000 (9253)	0
/r/IAmA	0	970 (4377)
/r/InternetAMA	0	19 (62)
/r/tf2trade	0	2 (4)

It posts the first few rows in the actual AmA thread, with a link to the full table that it posts to /r/tabled. This provides a great way to quickly read a condensed summary of a complete AmA thread, like this one. They look something like this:

VideoLinkBot

Purpose

Posts a summary of all video links in a discussion, kept up to date as the discussion grows.

Human Creator

/u/shaggorama

Home Base

Current Karma

25 link karma
49,423 comment karma

A Redditor for

4 months

Source Code

https://github.com/dmarx/VideoLinkBot

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/videos	0	126 (343)
/r/gaming	0	93 (167)
/r/hiphopheads	1 (0)	48 (123)
/r/leagueoflegends	0	47 (118)
/r/todayilearned	0	41 (69)
/r/movies	0	23 (66)
/r/nfl	0	21 (86)
/r/nba	0	18 (32)
/r/politics	0	18 (19)
/r/Random_Acts_Of_Amazon	4 (98)	13 (21)
/r/WhereDoIStart	0	16 (36)
/r/hockey	0	15 (39)
/r/SquaredCircle	0	15 (43)
/r/worldnews	0	14 (27)
/r/IAmA	0	12 (263)
/r/CFB	0	12 (33)
/r/DotA2	0	12 (28)
/r/tipofmytongue	0	12 (14)
/r/teenagers	0	11 (21)
/r/VideoLinkBot	11 (17)	0
/r/atheism	0	10 (11)
/r/Guitar	0	9 (45)

VideoLinkBot scans for comments containing supported video links. When it finds one, it scans the discussion that comment belongs to for video links. It then posts the aggregate links it has found to a comment. If it’s already visited this discussion, it will update its existing comment with whatever new links it finds. Video links are sorted by the score of the comment they came from.

If the bot doesn’t see a certain number of links or all the links the bot sees were posted by the same user, the it won’t post a comment. Also, if a discussion has too few or too many comments, this bot will leave it alone.

This provides a useful summary of a wide ranging discussion, in a similar way to tabledresser does for AmA threads. The comments it leaves look like this:

meme_transcriber

Purpose

Automatically finds links to meme pics (memegen.com) and provides a plain-text transcript of the content of that meme in a comment, so you don’t have to click through to the meme site to get the ‘joke’. Useful on mobile devices or if the meme site goes down.

Home Base

Current Karma

286 link karma
340,954 comment karma

A Redditor for

1 year

This bot tends to turn up in subreddits like /r/AdviceAnimals/ and post comments that look like this:

YTScreenShotBot

Purpose

Creates a screenshot montage of a YouTube video and posts a link to it, in reply to posts containing YouTube links.

Home Base

/u/YTScreenShotBot

Active SubReddits

Subreddit	Submissions (karma)	Comments (karma)
/r/videos	0	420 (2551)
/r/pics	0	300 (3843)
/r/gaming	0	280 (302)

Current Karma

1 link karma
15,475 comment karma

A Redditor for

25 days

This bot allows you to get a quick overview of the video, just by viewing an image - much quicker than watching the video, especially on mobile devices. This is what it’s comments look like:

and this is what the montage looks like:

JordanTheBrobot

Purpose

A sophisticated Multi-purpose bot that patrols reddit looking for scams, misleading links, mistakes in markup, kindness, flash content, etc…

Home Base

Current Karma

1 link karma
36,879 comment karma

A Redditor for

8 months

Active Subreddits

Subreddit	Submissions (karma)	Comments (karma)
/r/gaming	0	193 (4614)
/r/videos	0	71 (1808)
/r/todayilearned	0	36 (221)
/r/gonewild	0	32 (34)
/r/pics	0	27 (277)
/r/AdviceAnimals	0	14 (212)
/r/ginger	0	14 (33)
/r/Bitcoin	0	13 (80)
/r/worldnews	0	13 (68)
/r/movies	0	12 (49)
/r/brobot	5 (36)	3 (3)

This bots most user visible function is to detect when people have got the markdown syntax for links the wrong way round (a very common mistake), and if they don’t correct it themselves within a few minutes, leave a reply with the corrected links:

It also detects ‘spam/affiliate marketing’ links and leaves a reply warning people:

Spam Link

The comment above contains a link to a spam site, click with caution, your clicks will earn a spammer money and give them motivation to continue.

This bot also has moderator functionality, if you add it as a moderator of a subreddit, it will automatically:

Follows all links posted to all subreddits to identify dangerous redirect chains
Scans comments/submissions/redirect chains for spam domains
Detects and warns users of mismatched domains in reddit link markup IE: [http://test.com](http://test.com(http://not-really-test.com])
Detects and waits 6 minutes to post a fix of mistakes in reddit link markup (for ease of clicking)
Warns users of unapparent links to flash content

It also upvotes the original commenter if it corrects you links and upvotes you if you thank it - which might help it’s popularity. It also has a real time dashboard which lets you see what it’s up to.

SerendipityBot & /r/Serendipity

Purpose

Cross posts a popular submission from a random subreddit to /r/Serendipity every few hours

Home Base

Current Karma

37,027 link karma
2,641 comment karma

A Redditor for

2 years

Source Code

https://github.com/umbrae/Serendipity

Figure 6. Slice of life, reddit style.

I discovered this bot & subreddit combo while writing this article and it’s quickly become one of my favourites. /r/Serendipity is a meta-subreddit meant to broaden the perspective of its subscribers. It chooses a popular post from a completely random subreddit and posts it every few hours, so if you subscribe to it, you get a broad, random, serendipitous sprinkling of great content from across reddit on your front page – often surprising, wonderful things that you would otherwise never have come across. As the sidebar says:

If you want to increase your exposure to niche subreddits, or just your perspective on things on the web in general, serendipity might help you do that. But it might not. It’s a bot, after all.

NB: Occasionally, just by chance, a random post might be NSFW (Not Safe for Work) or NSFL (Not Safe for Life - i.e. ugh, wish I could un-see.), but not very often. I asked the bots creator, /u/umbrae, if it did any filtering - this is what he said:

It’s actually a bit complicated: It does technically filter out NSFW subreddits, but does not necessarily filter out NSFW posts from subreddits that are not marked NSFW. So you’ll occasionally get a NSFW post here and there. There are also a few subs that have asked to be opted out for privacy /audience concerns. – /u/umbrae, in this comment

Other Interesting Bots

I don’t have time to cover all the multitude of great bots on reddit - here’s some other useful or fun ones to checkout:

SmileBot
DollarSignBot
F1-Bot
RideItBot
SimilarImage
original-finder
Australian_Translate and his Arch Nemesis: FIXES_YOUR_COMMENT
RepostConspiracyBot
CaptionBot

Another whole category of bots, that I didn’t have time to go into, are Moderator Bots - designed to assist the human moderators of reddit with their ceaseless work, by automating some of the mechanical stuff:

AutoModeratorBot - very widely used now & also open source: more information here.
moderator-bot
atheismbot & atheismbot FAQ
DeltaBot is part of the bot moderation team at /r/changemyview. It adds a special feature to the subreddit that allows users to awards deltas (∆) to each other.

Ex-Bots?

Some interesting bots who seem to be ex-bots – or maybe they’re just resting:

Know of any more interesting & fun reddit bots? Let me know in the comments…

Footnotes & References

About reddit, including some mind boggling statistics. ↩
How many bots? No one really knows. How to create a reddit bot. This being reddit, there’s a community to keep an eye on them, too - and /r/TheoryOfReddit do sometimes discuss bots. Well, actually they talk about bots quite a lot. ↩
This is mostly quoted from the excellent qkme_transcriber bot’s FAQ, here. ↩
*API*: An agreed way for one piece of software to talk to another. Often consists of functions you can call with parameters, that return different peices of information - or perform different actions - depending on the value of the parameters. In the case of websites, the functions map to URL’s - pages that you can request, with the parameters on the end of the URL. *Why does reddit have an API?* Well, people would find a way to get the same information somehow - often by brute force (acting like a very fast human making lots of requests) - which puts more strain on reddit’s servers than just giving the data out in one go, on request - it also means that they get to set the rules when they make the API. ↩
/r/circlejerk is a subreddit dedicated entirely to reddit satire. It’s full of ‘parodies’ of ‘karma whoring’ posts and ‘parodies’ of endless pun threads. The thought that they have rigorous standards and actually kick people out for breaking them is almost funny in itself. ↩
/r/redditdev/ thread: Where do you all host your python-based bots? - turns out YTScreenhostBot is hosted on an old laptop. ↩
How easily could a computer program emulate the average reddit commenter? ↩
Internet Points! reddit has a system called Karma : “The number next to a username is called that user’s “karma.” It reflects how much good the user has done for the reddit community. The best way to gain karma is to submit links that other people like and vote for.” ↩
Haiku: In English, Haiku are traditionally three line verses, each line having 5, 7 & 5 syllables respectively. ↩

The Quilt of our Lives

The David Brownman Blog — Thu, 20 Jun 2013 03:00:00 GMT

undefined

Read the whole thing.

iOS 7 and Apps With Personality

Zac Szewczyk — Thu, 20 Jun 2013 01:06:04 GMT

“What makes an app great is the little things — the small details that take something normal and turn it into something extraordinary. I see iOS 7 as a blank canvas — an ‘un-design’ if you will. The goal of a 3rd-party isn’t to copy the stock apps pixel for pixel (that wasn’t the goal for iOS 1-6, and it’s not the goal now). Rather this is Apple saying it’s time to re-imagine what mobile software should look and act like. Five-hundred million people are using iOS devices, and it’s time for the training wheels to come off.”

Marco Arment made a similar point in is article Fertile Ground. As I said in my link to the piece, I’m very excited for this Fall.

Permalink.

Encyclopedia of Life Rubenstein Fellowship: Crowdsourced morphology

Jonathan Chang — Wed, 19 Jun 2013 18:50:34 GMT

This is a rather late announcement, but my project proposal, “Using massively crowd-sourced data to examine morphological impacts of extinction risk in ray-finned fishes”, was selected for the 2013 Rubenstein Fellows Program. I’m happy to announce that the first pilot study of my project is starting today. These first steps are the result of much preparation with my collaborators, Dan Rabosky at Michigan and Michael Alfaro here at UCLA.

The overall goal of this project is to quantify morphological disparity across the radiation of ray-finned fishes, which account for around 50% of all vertebrate diversity. We recently showed that the rate of speciation and body size evolution are correlated across fishes (Rabosky et al 2013, Nat Commun). However, size is just one facet of phenotypic diversity. In fact, shape is likely to be able to tell us quite a lot more about both morphological and ecological diversity, so with shape information we may be able to explain the factors that drive fish biodiversity, and also help identify patterns useful for fish conservation.

We will then be able to test for a relationship between shape and human exploitation, i.e., are there fishes with certain body shapes that tend to be more or less vulnerable to overfishing? This type of data and analysis can also allow us to get at many deep questions in macroevolution, including if there is convergence in body shape in certain environments or habitats, or if certain groups of fishes enjoy a faster rate of shape evolution.

There are tens of thousands of high-quality photographs of fishes on the Internet, in well-curated collections like the Encyclopedia of Life. Numerous expert editors have taken the time to identify photographs down to the species level. However, collecting landmark data for geometric morphometrics is the rate limiting step for this type of analysis. My hope is that crowdsourcing will help solve this bottleneck!

The pilot study that I’m starting today is only a small piece of the puzzle. We’ve chosen the triggerfishes, a group that we already have high-quality photographs of due to a previously published study (Dornburg et al 2011, Syst Biol). This is so we can readily identify areas we need to improve for our larger analysis. The source code for the web-facing portion of this study is available on github, and you can play around with a version of it online.

(Top figure: An unsuspecting Pseudobalistes naufragium is viciously landmarked by the author; Bottom figure: A phylogeny of the ray-finned fishes, with warm colors corresponding with fast body size change and longer branches with rapid speciation. Courtesy of Dan Rabosky)

How to Make a Wordcloud Using R

Luke Singham — Wed, 19 Jun 2013 03:00:00 GMT

Recently I have been using R for some basic data visualisations, outputs like word clouds and heat maps. I don't have a programming background so upon first look the R command line based environment can seem a little daunting. However, the ease at which I have been able to create some pretty amazing outputs with very little code has surprised me. In this blog I will attempt to share the steps in a simple process as well as the small amount of code that is needed.

1. RStudio + Packages #

First of all, you will need to install RStudio. The program gives the user a nice interface to operate within. The code can be typed in the window to the top left of the program, useful particularly if you want to save your code as a script. The code can be sent to the command line from there, or you can simply start typing the code into the Console.

# Install required packages
install.packages(c("tm", "wordcloud","SnowballC"))

# Load libraries
library(tm)
library(wordcloud)
library(SnowballC)

2. Load the Text #

This is the point where you load the text with which you would like to create your word cloud with. For this example I am using JFK's 'We choose to go to the Moon' speech.

Create a new folder e.g. ~/Desktop/test/ containing a speech.txt file.

# Create a corpus variable
mooncloud <- Corpus(DirSource("~/Desktop/test/"))

# Make sure it has loaded properly - have a look!
inspect(mooncloud)

3. Format and Clean the Text #

These commands will remove various things like punctuations and english words you aren't particularly interested in for the cloud like conjunctions. Additionally it will format the case of the text, I am going to go with lowercase, however you can run various combinations of these arguments including arguments not listed here.

# Strip unnecessary whitespace
mooncloud <- tm_map(mooncloud, stripWhitespace)
# Convert to lowercase
mooncloud <- tm_map(mooncloud, tolower)
# Remove conjunctions etc.
mooncloud <- tm_map(mooncloud, removeWords, stopwords("english"))
# Remove suffixes to the common 'stem'
mooncloud <- tm_map(mooncloud, stemDocument)
# Remove commas etc.
mooncloud <- tm_map(mooncloud, removePunctuation)

#(optional) arguments of 'tm' are converting the document to something other than text, to avoid, run this line
mooncloud <- tm_map(mooncloud, PlainTextDocument)

4. Word Cloud Time! #

Time to produce a word cloud, run the following command and watch RStudio populate the 'Plots' window to the right of the console.

# Time to generate a wordcloud!
wordcloud(mooncloud
        , scale=c(5,0.5)     # Set min and max scale
        , max.words=100      # Set top n words
        , random.order=FALSE # Words in decreasing freq
        , rot.per=0.35       # % of vertical words
        , use.r.layout=FALSE # Use C++ collision detection
        , colors=brewer.pal(8, "Dark2"))

5. The Result #

Voilà! Where there is a 'will' there is a way. It's hard to imagine a current leader of a western country announcing such a bold and expensive policy now - despite the world increasing its wealth substantially in the last half century of rapid development and therefore being even more capable than it was in the 60s.

Back to technical aspects, for further information and optional arguments you can use to customise the word cloud please see the following:

tm - the text mining package
wordcloud - the cloud generator, also does commonality clouds e.g. compare two political speeches for common themes
SnowballC - multi-language stemming algorithm package

I learnt to do this from a fair amount of Googling. The most helpful blog I came across was Georeferenced - so credit where credit is due. I learnt this method due to Wordle being blocked from my workplace, so of course use the website if you want to keep your hands clean!

The Joys of UNIX Keyboards

Donat Studios — Wed, 19 Jun 2013 02:10:51 GMT

I fell in love with a dead keyboard layout.

A decade or so ago while helping a friends father clean out an old building, we came across an ancient Sun Microsystems server. We found it curious. Everything about it was different from what we were used to. The command line was black text on a white background, the connectors strange and foreign, and the keyboard layout was bizarre.

We never did much with it; turning it on made all the lights in his home dim, and our joint knowledge of UNIX was nonexistent. It sat in his bedroom for years supporting his television at the foot of his bed.

I never forgot that keyboard though. The thought that there was this alternative layout out there seemed intriguing to me.

I am ruined for all other keyboards…

Mac is the main platform at my new job. I found myself unhappy with Apple keyboards; they are flat, bland, and completely unsatisfying to type on. I dug out an old AppleDesign keyboard, and used that for several months but I still needed something more.

I read about Happy Hacking Keyboard, and after some deliberation decided to give it a try. I thought I could learn to accept most of the layout changes, but the lack of arrow keys on the "Professional" model made me squirm a little. Luckily there is a "Lite" version that includes arrow keys.

I purchased the Happy Hacking Keyboard Lite2.

The Happy Hacking Keyboard much like the Sun Microsystem keyboard I found years earlier features a UNIX layout. They designed it with typing at a terminal in mind.

A Better Layout

For those unfamiliar with UNIX keyboards, there are a few distinctions.

The Control key moved to the Caps Lock keys usual position. This makes it much easier to hit common commands than its usual location, often without ever leaving home row. I can't imagine why anyone thought Caps Lock should have had this prominent of placement.
The Meta (◆ / ⌘ / Windows) key is in its rightful place next to the space bar, as on a Mac keyboard.
The Backspace key moved down a row to be above the Enter key. This change is my favorite change. Having a small reach, normally my hands have to leave home row to hit backspace. but on a UNIX board I have no issue hitting it with my pinky with the rest of my fingers remaining firmly on home row.
Escape is also in reach of home row, placed where you would usually find ~. I could have done without this change, but it is fine.
The ~ and \ have moved to the usual location of the Backspace. Working exclusively on UNIX systems now, I don't mind the \ being harder to reach. I could understand a Windows user finding this irritating.

The HHKB is a minimal version of the UNIX keyboard. To this end the F Keys are mapped to Fn + 1, 2, 3, etc. The HHKB encourages you to stay on home row; you can hit any key on the keyboard without leaving it. I find my typing accuracy and speed to have improved thanks to its use.

The HHKB features one more change I don't care for. The Backspace key by default performs Forward Delete. Luckily changing this is easy by flipping a toggle switch on the back of the board.

Closing

I recommend this keyboard to anyone who spends a lot of time at the terminal. You are able to do more of what you need without ever leaving home row, every important key is within reach.

Elsewhere

Discussion on Hacker News
Mentioned on BSD Now Podcast: Episode 333

Playing with FreeIPA and puppet

The Technical Blog of James on purpleidea.com — Tue, 18 Jun 2013 15:36:54 GMT

So I just rolled a new vm to hack around with FreeIPA. Here are some things that I’ve come across so far. I was planning on configuring LDAP, and Kerberos manually, but the included webui looks like a lovely tool to have for the data entry, user administrator type who likes to click on things. Let’s explore…

/etc/hosts:

FreeIPA is choosy about how your /etc/hosts is formatted. It requires an entry that has a particular order, that is:

Minimal password security is gained from case-sensitivity

Databases & Life — Tue, 18 Jun 2013 03:00:00 GMT

My colleague suggested that systems should compare passwords in a case-sensitive manner. He pointed out the larger space of possible passwords, and thus the longer passwords would take to crack by a brute-force attack. This is all standard knowledge.

I still maintain, however, as discussed before, that the correct trade-off between usability and security is to compare passwords in a case-insensitive manner.

The increase in usability in having case-insensitive passwords is obvious (and documented in the previous post), so to understand the usability/security trade-off, how much is security reduced by using them?

🎙️ Enriching Podcasts and Radio Shows

Jayson Salazar Rodriguez | @jdsalaro | Blog — Tue, 18 Jun 2013 03:00:00 GMT

Here you’ll find podcasts I’ve found valuable over the years.

puppet lsi hardware raid module

The Technical Blog of James on purpleidea.com — Mon, 17 Jun 2013 21:11:02 GMT

In response to some discussion in the gluster community, I am releasing my puppet-lsi module. It’s quite simple, but it is very useful for rebuilding machines. It could do a lot more, but I wanted to depend on the proprietary LSI tools as little as possible. Running megacli with puppet would be a very doable hack, but I’m not sure enough devops out there who would use that feature.

Usage is straightforward if you like the sensible defaults:

Krav Maga, or "Crush Balls, Gouge Eyes, and Break Bones"

Josh Thompson — Mon, 17 Jun 2013 03:00:00 GMT

In the last few weeks, I have been physically attacked dozens of times. Usually the attacker was just trying to choke me, but sometimes he was trying to throw me to the ground. After a few minutes of fighting, I would attack him. Then we’d both shake hands, say “thank you”, and walk to the metro. more My wife and I have always recognized a need (or a strong desire) for some sort of self-defense training. I’ve always wanted some, because I don’t like the idea that my only option to protect myself is “run away”. That would not always an option, nor does it help anyone other than me.

Kristi often felt uncomfortable walking many places in DC by herself, especially at night. Metro platforms, parking garages, gas stations, or any place where you’re not alone can be scary places.

The way I saw it was this: We’re not training to protect ourselves against a low-probability incident, but rather we’re training to provide peace and comfort in situations where before we may have been nervous or on edge, because ITSHTF, we have options that, if executed correctly, leave us safe.

The top of my Epic List is Krav Maga. My wife and I are taking lessons at Krav Maga DC, in China Town. We go between two and four times a week, for an hour each lesson.

We signed up for a year of classes, which usually gets students to a solid level of proficiency. The classes are structured in week-long “blocks”, where a single new element is focused on, for the week. Recent topics have been learning to use “hammer fists”, elbow strikes, and defenses from chokes and head locks. I feel far from proficient, but we’ve been going for just a few weeks. (By the way, every defense includes usually a “crush the groin” step, and “gouge the eyeball” or “collapse the windpipe”.)

Krav focuses on real-life situations and instinctual offensive reactions to attacks. The goal is to, if attacked, not just respond and be safe, but leave the other guy unable to get off the ground to prosecute the attack any farther. (This is called “ending the fight”, and is brutal. Yes, you are expected to kick ‘em when they’re down.) Anything goes, because if attacked, you’re probably smaller than your attacker, weaker, and much less prepared for what’s going on. (If I were attacking someone, I’d make sure to be bigger, stronger, and mentally prepared for the attack. Wouldn’t you?)

We’re having a blast, and this is a solid step towards checking off an item on my list. If anyone wants to join with us, it’s Krav Maga DC,by the Gallery Place/Chinatown metro. There are a lot of training centers in the area, though, so if you’re interested, make time in your schedule, your budget, and make it happen. You’ll always have other things to do with your time and money, but if this is something important to you, it’ll happen.

The original author of code should fix its bugs, and they should do that before writing more code

Databases & Life — Mon, 17 Jun 2013 03:00:00 GMT

There are (at least) the following options that a project manager must make when organizing bug fixes to software:

Should the original author of the code in question fix the bug? Or should there be a “bug team” who surgically go in and fix bugs?
Should one fix bugs as one goes along? Or concentrate on features and write the bugs down and fix them in a “bug sprint”?

I am very much in favour of the original author fixing bugs, and fixing bugs as soon as they occur. Because:

iOS 7 and the rejection of the unfamiliar

Zac Szewczyk — Sun, 16 Jun 2013 21:08:16 GMT

In this morass of terribly-written prose, Rene Ritchie did manage to make an interesting point:

“The problem is that Apple listened, and now instead of being a trend creator they are ‘following’ trends.”

While I can’t say I necessarily agree with this opinion, it is nevertheless a very interesting one, and one that I haven’t see voiced since the WWDC keynote nearly a week ago.

Permalink.

Acquisition and maintenance of a band of minions

Zac Szewczyk — Sun, 16 Jun 2013 20:56:47 GMT

I love this article. Its post slug, “campus”, should give you an idea as to what it is about. Great read.

Permalink.

Faded Avocado

Zac Szewczyk — Sun, 16 Jun 2013 20:55:20 GMT

Working my way through The B&B Podcast’s back catalog I came across episode seventy-three, Faded Avocado, during which Shawn and Ben talked about Marcelo Somer’s piece The Linkblog Cancer. This article sparked a controversy that went viral a few months ago, a controversy even the likes of Jim Dalrymple and Marco Arment felt the need to respond to. I even mentioned it, albeit briefly, in my article Reinventing the Linkblog.

For those curious, Ben and Shawn argued both sides very well and made a number of great points. If you have to pick one episode of The B&B Podcast to listen to, this is a good choice.

Permalink.

Cheap And Enjoyable Gaming On Unix

Venam's Blog — Patrick Louis (Lebanon) — Sun, 16 Jun 2013 20:00:00 GMT

Hello fellow Unixers, In this thread I'll explain how to enjoy playing games on free Unix OS for a cheap price. The rumor that gaming on Unix is bad has been around for quite some time now. While it's almost true for the newest games with the 3D rendering that makes hair looks so real that it feels like your own hair are fake, it's still not true for all games. I won't start blabbering about "Steam"TM because the internet is already infested with it. I won't, also, write about running games through wine for the same reason.

DNS servers for Vibe Communications

Rich Dougherty — Sun, 16 Jun 2013 08:35:00 GMT

7shape my first iphone application

Fabrice Aneche — Sun, 16 Jun 2013 00:59:12 GMT

As an iphone developer contractor, I’ve released some applications on the Apple Store for my customers but not on my own. Here is my 1st personal (30 hours) toy project: 7shape a 7 minutes workout training application, based on an [NYT blog](http://well.blogs.nytimes.com/2013/05/09/the- scientific-7-minute-workout/) post. I’ve spent 20 hours on website release, marketing, 3D for the human trainer and application design, and last 10 hours to create the app and release it to Apple …

Installing Redis on Debian as a Service

Thomas Hunter II — Sat, 15 Jun 2013 03:00:00 GMT

The Smart Guide to Stack Overflow: Zero to Hero

duncanlock.net — Sat, 15 Jun 2013 01:03:28 GMT

Figure 1. StackOverflow is made of people - lots and lots and lots of people.

Seemingly like everything else in the world, Stack Overflow is getting more & more competitive as time passes. Gaining a good reputation - and even finding good questions to answer - is becoming harder and harder, as more and more people compete for less and less unanswered questions.

This is fantastic if you want to find an answer - but makes it much harder for newcomers to get started and build a reputation on the site.

This guide will help you jump-start your reputation on StackOverflow and help you get more out of the site.

How to find questions you can answer

Ignored & Favourite Tags

Figure 2. I don’t know jack: Screenshot of part of my (long) ignored tags list from Stack Overflow

Use the no answers page, the newest unanswered page and the bounties pages, but make sure you add plenty of Ignored Tags. Whenever you see a question that you don’t know anything about, add it’s tags to your Ignored Tags list. This fades questions with these tags, making it much easier to skim through the list finding things that you can answer.

Don’t be afraid to add lots of ignored tags - it’s not an admission of failure - there will always be lots of things that you aren’t an expert on.

Add some favourite tags too - this highlights questions with these tags, again, helping you to sort the wheat from the chaff.

Wildcards

Both Ignored and Favourite Tags can use wild cards - just put an asterisk at the end of the tag when you enter it - so xcode* would match both xcode and xcode4.5, for example. This significantly reduces the number of tags you need.

Specialize, Follow Tags & Automate

You can also follow a single tag - one of your Favourite tags, for example - just click on it in your sidebar and you’ll see a filtered version of the Questions pages, just for that tag. This also works for wildcards, so clicking on a wildcard tag in your sidebar will filter by all matching tags.

At the bottom of each of these filtered lists is a link to an Atom Feed [1] that you can subscribe to in a News/Feed Reader [2] - this will alert you whenever new questions are posted with that tag.

You can also use IFTTT to automatically notify [3] you when new questions appear, when your reputation changes, etc - it can even send you an SMS, so you can jump in immediately.

Mercenary Reputation Building 101

Most of these reputation building techniques are win-win, thanks to Stack Overflow’s masterful gamification [4] architecture - but some of them are a little bit… mercenary:

Answers in the comments are just asking for it

For some reason, people often answer questions in the comments, rather than submitting an actual Answer - this is wrong for lots of reasons:

It makes the answers hard to find for other people & adds to the noise on the site.
It means that an answer can never be accepted, so other people won’t be able to tell if the question has an answer - and the question will appear in the Unanswered lists forever.
People get no credit for answers supplied in the comments
Formatting and space is intentionally very limited in comments - to try to dissuade people posting answers there.

If people are stupid enough to do this, then they deserve to be punished (a little tiny bit). Copy their answer out of the comment into a real Answer. Expand on it in the extra space you now have, improve the formatting, add example code, etc… - and wait for the reputation points to roll in.

Answer questions from experienced users

Figure 3. Except this guy.

Everything else being equal, answer questions asked by users with higher reputation. They know how the site works, they know to accept and upvote answers. New users often don’t, or they’ll ask a question and never some back - so it’s much more likely that you’ll get no reward for answering their questions.

New users also tend to ask lower quality questions, which are harder to answer well - and get closed more often - than questions from experienced users.

This is a little hard on new users, so if they’ve asked a well articulated, valid question and have a real looking username, I would suggest taking a chance and answering the question anyway. Even if the asker never comes back, you can still get upvotes from other users.

On the other hand…

Encourage New Users

Figure 4. These two techniques, used together, are very effective.

As ray pointed out in the comments, perhaps I was a little bit hard on new users.

So, you spend time researching and writing a solid, well written, correct answer to a question and… crickets. It’s either the only answer, the only good one, or it’s gets upvoted but not accepted. What now?

Here are two ways to encourage users (new or not) to upvote and accept your answers to their questions:

Leave a comment: Leave them a comment on their question, asking if it worked, if they had any issues with the answer and asking them to accept the answer if it worked for them - so that other users can benefit: from knowing that the answer works and by having the question marked as Answered.
Upvote their question: As Ray said: “I tend to wait and get some up votes, by that time the new user is used to SO so I up vote the question, 10 times of 10 he always accepts my answer and adds an upvote, 25 points collected by being patient with new users like me.”

Speculate to Accumulate: Answer lots of questions, well

This seems obvious, but the more questions you answer well, the more reputation you’ll gain - but not just at the time you answer: forever. Good answers keep building reputation over time as new people discover them and upvote them - and the more of your answers are out there, the more you’ll gain from this on an ongoing basis.

Figure 5. This answer was posted in May 2011, this screenshot was taken in June 2013.

Once you’ve got the top voted answer on a popular question, you will gain occasional upvotes and reputation from it without you actively doing anything. The more of this you have and the more popular those questions and answers, the more you gain - with top users sometimes hitting the daily reputation cap of +200 without doing anything.

Come back and improve your popular answers

If you find that one of your answers keeps receiving upvotes over time, then come back and improve on it. Edit your answer - improve the formatting, add better example code and answer any comments people have left - by improving the answer to address them. This increases the amount of upvotes that your improved answer will get over time and improves the quality of the site overall. It also bumps that question back up in search results and lists, making it more visible, increasing the likelihood of upvotes, and so on.

However - don’t do this too often. Only make edits that are worthwhile and add value to the answer - if you edit your answers too much, they’ll become Community Wiki posts and stop generating reputation altogether.

Get in First

Being the first answer is often surprisingly important. There are lots of other people looking through the unanswered questions list for questions to answer - as soon as a question has an answer it disappears from this list. Being the first correct answer to a question also makes it more likely that other people visiting the question will upvote your answer and move on, looking for something else to answer. Answers are sorted by votes, so the answer with the first upvote will move to the top, thus getting more attention and re-enforcing the cycle – answers with an early lead will often maintain it.

So, if you see a question that you know the answer to off the top of your head, answer it immediately. Get the gist of the answer down and submit it - don’t spend too long writing this first draft answer, or someone else will beat you to it. Then, read through your answer, think about it some more and edit it - expanding on your answer, adding more detail, improving it with examples and Markdown formatting.

Quick answers are also good for the asker - they get the answer they need quickly and can start working on their solution - and perhaps making follow-up comments while you’re further polishing your answer.

Preferentially answer questions with bounties

Again, obvious - questions with bounties give you the bounty as reputation if you post the accepted (or highest voted) answer.

Use the Featured list to see all questions with bounties. Your ignored and favourite tags work here too.

Even if the person who places the bounty never bothers to come back and award it - half of it will get awarded to the highest voted answer (created after the bounty started with at least 2 upvotes) when the bounty closes. This means that you’re only guaranteed to land the bounty if you can get the top spot, so answering questions with an outstanding bounty - but several existing answers with lots of votes - generally isn’t such a good investment of time. Unless you think you can provide an answer that’s sufficiently good to beat the existing ones before the bounty closes, don’t bother.

Getting Badges: Earning Valuable Flair

Figure 6. Ooooh look - pieces of valuable flair™

You will accumulate badges in the course of using the site, but there are ways to increase your accumulation rate slightly without going out of your way too much.

Preferentially answering older, unanswered questions is a good way to pick up Necromancer, Revival and Excavator badges - and using ignored tags is a great way to filter out the noise in the No Answers list, allowing you to quickly zip back to the older unanswered questions that you can answer. There’s also much less competition to answer these poor, neglected questions than there is for new questions, so you can answer at your leisure, taking your time to craft the perfect answer for the ages.

Another simple win-win way to acquire badges is by sharing your questions & answers with your friends, using the sharing buttons on the site. This is a double whammy - your question or answer will get more exposure, so more upvotes - and you can also get badges…

Figure 7. StackOverflow’s Sharing badges

The Announcer, Booster & Publicist badges are awarded for sharing a link to a question that was visited by 25, 300 or 1000 unique visitors, respectively - and they can all be awarded multiple times.

See Answer Your Own Questions, below for another easy to earn badge.

Ask Good Questions

You can also get reputation (and badges) for asking questions: +5 for each upvote your question gets.

How to ask good questions? Questions that attract good answers - and upvotes? The official guide is here. In addition to this, my tips for good questions are:

Search first

Someone has almost certainly asked your question before and the answer is just there waiting for you. Search with Google & directly on Stack Overflow.

Think before you post

Don’t just ask questions for the sake of it - or for the reputation. Ask when you’re genuinely stuck. Try to solve the problem yourself - but if you really can’t, ask. Mention your attempted solutions in the question, so that people know what you’ve already tried and eliminated.

Explain carefully

Carefully explain your problem, in detail, so that someone without any prior knowledge of your situation can understand the problem. They’re not telepathic - you need to explain yourself succinctly and thoughtfully if you want a good answer.

Include a relevant simplified example

Boil your problem down to its essence and include a simplified example - with any required code and data - in your question. Try and make this as short as possible without leaving out anything essential.

A working example, using jsfiddle, sqlfiddle, rubyfiddle, etc… is the gold standard. Put the simplified example code into your question as normal, but also upload it to the relevant *fiddle site and add the link to your question.

Use Markdown formatting

This goes for both asking questions and answering them. Stack Overflow supports Markdown for formatting your posts - use it! It will make your questions easier to read and understand, you’ll get more upvotes and better answers.

Read before posting, then read it again afterwards

Read your question through a few times before posting. Make sure that it’s well phrased, well formatted and spelt correctly. Make sure that your example code and data is clear and concise and includes everything you would need to reproduce the problem.

Once you’ve posted it, read the live version and edit out the mistakes you missed before posting.

Answer your own Questions

In the unlikely event that you can’t get any help from StackOverflow initially - but later figure out the solution yourself - post both the question and the answer at the same time. As balpha said in the comments section:

If you’ve had a hard or interesting problem for which there’s nothing on Stack Overflow yet, and you have eventually managed to solve it yourself: Ask and answer the question. Someone else is bound to be having the same problem, and you already did the hard work. The “ask question” interface has a checkbox that lets you submit an answer alongside with the question. And if you’ve already asked the question, and then later managed to solve the problem: Go ahead, answer your own question.

Not only can you spare the next person with the same issue having to figure it out all over again - you also have a chance to get an upvote from them on both the question and the answer, for a total of 15 reputation!

Reputation Bonanza!

If you later figure out the answer to one of your questions - or figure out a better answer, or a new solution becomes available, come back and tell everyone by either answering - or adding an answer - to your own question: everyone wins.

Figure 8. Answered your own question with score of 3 or more.

This is offically encouraged - there are even badges for doing it, so Ask and Answer away!

If you’ve got any tips or advice I’ve missed, I’d love to hear about them in the comments below.

Footnotes & References

*Atom Feeds* (like RSS Feeds) can be used to allow users to subscribe to updates from a website. Wikipedia Atom Article… ↩
A *Feed Reader* is a piece of software (Desktop, Mobile or Web based) that allows users to collect/aggregate and read their Feeds, manage subscriptions and send notifications. Wikipedia Feed Reader Article… ↩
*IFTTT* enables you to create and share “recipes” that fit the simple statement: “if this then that”. The “this” part of a recipe is a trigger. Some example triggers are “I’m tagged in a photo on Facebook” or “I check in on Foursquare.” The “that” part of a recipe is an action. Some example actions are “send me a text message” or “create a status message on Facebook.”. Wikipedia IFTTT Article… ↩
*Gamification* is the use of game thinking and game mechanics in a non-game context in order to engage users and solve problems. Wikipedia Gamification Article… ↩

Don't use string constants when writing SQL statements in code

Databases & Life — Fri, 14 Jun 2013 03:00:00 GMT

I was always in two minds about using constants for table and column names when writing SELECT queries. Now I've concluded that constants are definitely bad, and should not be used. Here's why.

The topic of discussion is difference is between writing

sql = "SELECT * FROM " + TABLE_NAME + " WHERE ..."

and

sql = "SELECT * FROM my_table WHERE ..."

There are the following consequences from this choice as far as I can see:

Explaining your PostgreSQL data

CRAIG KERSTIENS — Thu, 13 Jun 2013 23:55:56 GMT

I’ve written a bit before about understanding the output from EXPLAIN and EXPLAIN ANALYZE in PostgreSQL. Though understandably getting a grasp on execution plans could probably use some more guidance. Yet, this time around I’m taking a bit of a cop out and highlighting a few tools instead of documenting myself, which I’ve done in a talk I’ve frequently given Postgres Demystified.

Getting at the Data

The first small thing you can do is actually retrieve the data in JSON form. By adding in (format json) right after your EXPLAIN or EXPLAIN ANALYZE command it’ll as you’d expect return it in JSON. To give an example:

# EXPLAIN SELECT * FROM users LIMIT 1;
QUERY PLAN
--------------------------------------------------------------
Limit (cost=0.00..0.03 rows=1 width=812)
-> Seq Scan on users (cost=0.00..1.50 rows=50 width=812)
(2 rows)

Then in JSON format:

EXPLAIN (format json) SELECT * FROM users LIMIT 1;
QUERY PLAN
------------------------------------------------
[ +
{ +
"Plan": { +
"Node Type": "Limit", +
"Startup Cost": 0.00, +
"Total Cost": 0.03, +
"Plan Rows": 1, +
"Plan Width": 812, +
"Plans": [ +
{ +
"Node Type": "Seq Scan", +
"Parent Relationship": "Outer",+
"Relation Name": "users", +
"Alias": "users", +
"Startup Cost": 0.00, +
"Total Cost": 1.50, +
"Plan Rows": 50, +
"Plan Width": 812 +
} +
] +
} +
} +
]
(1 row)

While its on my list to build some interesting apps by pulling in the JSON input, others may be equally as interested in taking advantage of this data in its JSON form. If you take a shot at building something with this output, as always I’d love to hear about it - craig.kerstiens@gmail.com

Despez

Of course if you’re itch isn’t in better tools for Postgres, you may just want to have a solution that works today. While its not perfect, one of the best ones out there is Dezpez’s explain tool. You can take any execution plan and paste it in and get some better visual representation of the result. You can also share them as well.

Who are the weak Christians?

Honza Pokorný — Thu, 13 Jun 2013 17:34:00 GMT

When you look around you while sitting in a church service, you will generally have a sense of who is who. You know who the nice people are, who the grumps are and who always causes trouble. You know the people who always ask silly questions, and you know the people that always seem to know what to say when you are helpless. You might have an idea of who is a strong Christian and who has ways to go.

We all do.

What does the Bible say about strong and weak Christians? In Romans 14, Paul gives us an answer to this question. If you are anything like me, his answer might surprise you:

As for the one who is weak in faith, welcome him, but not to quarrel over opinions. One person believes he may eat anything, while the weak person eats only vegetables. (Romans 14:1-2, ESV)

Paul is saying here that the weaker Christian is the kind of person who has lesser freedom in Christ. They think that those who eat meat aren’t real Christians and they need to learn. They are bound by their conscience to obey additional rules to honor the Lord.

This is very interesting because our natural inclination is to see those with a zeal for good, Christian rules as more mature in the faith. If you are exhorting others to do this and stop doing that, you are more likely to be viewed as a mature Christian. However, the Bible says that the opposite is true. Strong Christians have a greater freedom in the gospel than their weaker brothers. Their conscience doesn’t prevent them from doing certain things. Their legalistic tendencies are minimal.

A great example before you go: in Acts 10, Peter is told to eat unclean animals. These animals were unclean according to the law which was now fulfilled in Jesus.

But Peter said, “By no means, Lord; for I have never eaten anything that is common or unclean.” (Acts 10:14, ESV)

Peter’s conscience is weak and needs to be redeemed by the Holy Spirit. This is a great example of a weak person becoming stronger in the faith.

We Just Redesigned ReadWrite

Zac Szewczyk — Thu, 13 Jun 2013 12:45:36 GMT

ReadWrite’s new site looks fantastic, very reminiscent of Digg’s current design.

“It would have been easy at that point to rest on our laurels. But we and our colleagues at Say Media, our parent company, whose technology and design teams worked tirelessly on this launch, wanted to keep pushing our design forward and drop the remnants of the ’90s-era Web that clung to our site.”

Good for them.

Permalink.

Microsoft turns Siri against Apple

Zac Szewczyk — Thu, 13 Jun 2013 12:12:05 GMT

Reminds me of the old “I’m a Mac, and I’m a PC” days. Even though, as Ian Paul points out in his article, the commercial is laughably innacruate, I still had a good chuckle.

Permalink.

Fixing Homebrew

Thomas Hunter II — Thu, 13 Jun 2013 03:00:00 GMT

Two Sides of the Same Coin

The David Brownman Blog — Thu, 13 Jun 2013 03:00:00 GMT

undefined

Read the whole thing.

Gotcha with basic HTTP authentication in Python

Carey Metcalfe — Thu, 13 Jun 2013 02:53:00 GMT

When doing basic HTTP authentication in Python, make sure your authentication realm is surrounded by double, NOT single quotes.

Bad:

self.send_response(401)
self.send_header("WWW-Authenticate", "Basic realm='/'")
self.end_headers()

Good:

self.send_response(401)
self.send_header("WWW-Authenticate", "Basic realm=\"/\"")
self.end_headers()

The single quotes work with most browsers, curl, wget, and tons of other tools. However, when using Python to access the page (using urllib2.HTTPPasswordMgrWithDefaultRealm to manage authentication) single quotes don't trigger the "automatic retry with authentication" response, and instead just raise a 401 HTTPError.

Fertile Ground

Zac Szewczyk — Thu, 13 Jun 2013 00:24:24 GMT

“Apple has set fire to iOS. Everything’s in flux. Those with the least to lose have the most to gain, because this fall, hundreds of millions of people will start demanding apps for a platform with thousands of old, stale players and not many new, nimble alternatives. If you want to enter a category that’s crowded on iOS 6, and you’re one of the few that exclusively targets iOS 7, your app can look better, work better, and be faster and cheaper to develop than most competing apps.”

Now I see why this article was at the top of the Hacker News front page. Marco is very hopeful for this fall, and rightly so: iOS 7 does indeed present a rare opportunity for existing markets to be disrupted by brand new entrants. I’m extremely excited to see what comes next, especially from Marco. We are moving towards a very interesting time; buckle up and hold on.

Permalink.

Bang, You're Dead. Signed, Tim Cook.

Zac Szewczyk — Thu, 13 Jun 2013 00:12:27 GMT

Almost every time Apple releases a new version of iOS, someone has the Marco Arment “Well, shit” moment. The time, most prominently, it was 1Password’s turn, although other small, one-off app developers likely had similar reactions throughout the keynote.

Permalink.

Why Nintendo Won't Make Games for Smartphones

Zac Szewczyk — Thu, 13 Jun 2013 00:09:36 GMT

The temptation certainly exists to criticize Satoru Iwata and his decision not to bring the company’s most popular titles to mobile gaming platforms like iOS; however, looking beyond our disappointment at being unable to play Pokemon and Mario Kart on the iPhone, we can look at the situation dispassionately and draw a number of parallels between Nintendo and Apple, Satoru Iwata and Steve Jobs: both men led (and lead) their respective corporations with a complicated, long-term vision for success. As the sole possessor of this grand master plan, Iwata’s decisions, like Jobs’s, sometimes seem nonsensical and even cryptic, in a way. Nonsensical or not though, no one in their right mind would argue that Steve Jobs was anything less than a genius; perhaps, in time, the same will prove true of Satoru Iwata.

Permalink.

Matt Gemmel on iOS 7

Zac Szewczyk — Wed, 12 Jun 2013 20:56:19 GMT

Wonderfully worded and impressively well thought-out, Matt Gemmel’s article iOS 7 is easily the best piece on the topic I have read since the WWDC keynote address. In explaining the motivation behind Apple’s complete UI overhaul in iOS7, he began his one-two punch with this paragraph:

“The thing is, we’ve grown up. We don’t require hand-holding to tell us what to click or tap. Interactivity is a matter of invitation, and physical cues are only one specific type. iOS 7 is an iOS for a more mature consumer, who understands that digital surfaces are interactive, and who doesn’t want anything getting in the way of their content.”

Then, following up, he said something curiously familiar before moving on with the article:

“The basic functionality hasn’t changed. You still use iOS in the same way, and almost everything is where you expect it to be. The same gestures work. There are a few differences here and there - it’s a major new version of the OS, after all - but the changes are mostly aesthetic. You won’t be confused by iOS 7 if you’re accustomed to a previous version.”

Permalink.

Anti-iOS 7 Anger

Zac Szewczyk — Wed, 12 Jun 2013 20:12:56 GMT

I try to, for the most part, stay positive when I write on here. Instead of taking a page out of Jim Dalrymple’s play book, not that there is anything wrong with his approach, and calling shenanigans and bullshit when I see shenanigans and bullshit, I try to “take the high road” and either ignore bad writing and poorly-formed opinions altogether, or criticize them generously. In the wake of the iOS 7 announcement though, many people have said things that I consider — quite frankly — stupid, especially concerning iOS 7’s overhauled interface.

Permalink.

How I Survived A Week Without Food

Zac Szewczyk — Wed, 12 Jun 2013 20:05:53 GMT

“I think of it much in the same way I do exercise — you just have to make yourself miserable for a finite period of time, to reap the benefits later.”

Another Soylent story, this one, interestingly, less lauding than the others.

Permalink.

Alright Tim, I'm Buying a Mac

Zac Szewczyk — Tue, 11 Jun 2013 22:11:55 GMT

Surrounded by Tweetbot on my iPhone, iMore’s live blog on one iPad and Apple’s keynote stream on another, and flanked by my inconveniently inoperable computer, I watched Tim Cook introduce iOS 7. Even now, I can’t quite quantify the feeling I had upon seeing iOS 7 for the first time: a mixture of surprise and relief at the departure from almost every previously-held design philosophy, amazement for reasons that anyone who watched the keynote or read one of the many blog posts recapping the event would find obvious, and perhaps even euphoria for some inexplicable reason. iOS 7 is beautiful, plain and simple, and the reason my next computer will be a Mac.

Permalink.

The Journal

Zac Szewczyk — Tue, 11 Jun 2013 21:57:12 GMT

Although I make it a point not to spend much time talking about my personal life on this blog, it occasionally creeps in to my writing in the form of an anecdote, perhaps, or the inspiration for an entire article. A few weeks before Christmas last year, I linked to an article by Jason Snell titled Why I’m Writing on the iPad, in which he talked about a time when he was forced to write using a pen and paper rather than on a computer. In my brief article linking to that piece, I talked about a six month period during which I kept a journal for a person very near and dear to my heart. I happened across that article a few minutes ago in the process of writing a new piece, and this paragraph struck a chord:

Permalink.

James LaCroix: Founder of LaCrox Design Co

Sam Solomon — Tue, 11 Jun 2013 03:00:00 GMT

James LaCroix is the founder of The LaCroix Design Company and 1 Page Sites.

Fasting in the face of corruption

The Walkabout Blog — Tue, 11 Jun 2013 02:25:09 GMT

This is an interim post as I'm completing the (large) post for the recent India work.
Indians recently have been supercharged by the protest, arrest, and fasting of a famous activist named Anna Hazare. (Anna's a man's name here). He's an older fellow associating himself with Gandhian tradition. He advocates the passage of a far-reaching anti-corruption bill in Parliament. The photo above shows the gateway of the remote rural school I was staying at in Orissa state's far-afield Parlekhemundi. When Anna was arrested, the students at the school spelled out 'No More Corruption' in candles, pictured above. Later they marched en masse around the town.
I first heard of this man in business school during a class in social entrepreneurship describing how back in the 1980's he got a village in Maharashtra state to close its abused alcohol shops, ultimately leading to much greater prosperity in the village. (I found it interesting, I am still as big a fan as the next guy of spirits ;) ) He's since set his sites on eradicating Indian corruption now, which is sort of like living in California and trying to eradicate the sunshine. So his influence and capturing of the Indian spirit is really impressive. Also, the body he demands to pass his bill is the same containing the members he accuses of corruption - people who would risk being detained and punished for corrupt practices after the bill's passage. Talk about an uphill battle. And so the progress of his movement's success is all the more impressive - Parliament agreed in principle to his demands, and after twelve days his fast was to close just this morning. Can you imagine, in the US, someone fasting to protest campaign finance? Then can you imagine that within two weeks, both houses of Congress debating the issue ad nauseam due to his fast? I think our system would let the man starve without so much as paying lip service to his cause inside the Capitol.

Well as I write I'm in Delhi during a two day layover. I overcame a bout of Delhi-belly (don't eat from the roadside nut vendors!) that unfortunately emptied itself all over the center of Connaught Place, and promptly headed to the city's Ramlila Maidan grounds to see Hazare's protest.

I tried on a hat of the same style that Mr. Hazare wears - see the photo below of an example of one - these hats were very popular at his rally, and a local handed me one :) . Yet I debated how much direct support I wanted to show - I generally try to steer clear of showing my opinions in the middle of another country's political rally especially when I have limited visibility into the issues. Academics can rightly critique that his rally is motivating the passage of a bill forming a top-level organization above parliament and answerable to no one. I decided that anti-corruption in general was a worthwhile theme to get around, and moreover that marshaling the public energy towards achieving a shared public good is much more needed in the short term than early intellectual dithering resulting in inaction. I see and experience the far reaching effects of corruption every day while in India, including my day's Delhi-belly (think public works, sanitation, promoting food-prep practices). See my later posts from 2008 showing some effects of corruption.

How often does your grandfather (e.g. above) care enough about an issue that he'll *sit* and perhaps even *sleep* in the middle of the protest grounds?

I came across just one other foreigner on the grounds; I guess I was a little disappointed in the backpacker set. A note for travelers staying in Delhi: If you're going to stay in a moderately priced guesthouse, I highly recommend staying in Delhi's suburb called Gurgaon. The chaos level is *much* less than the Delhi itself, tends to be much cleaner, and often still with good access to the metro subway. I'll recommend where I stayed with excellent ambience and super friendly staff, the Royal Park Plaza in DLF Phase-1. You can search it on Google.

Rosalind Problems in Clojure

John Jacobsen — Sun, 09 Jun 2013 03:00:00 GMT

This weekend I’ve been having a lot of fun working the Bioinformatics problems from Rosalind. Most people work them in Python, but so far they have been very amenable to Clojure except where BioPython libraries are used for access to online databases. The problems have been straightforward so far but I have enjoyed the elegance and brevity that Clojure lends the solutions.

In particular, I like this short translator from RNA sequences to amino acids:

;;; Translating RNA into Amino Acids

(defmacro deftable [tname & rest]
  `(def ~tname (apply hash-map '(~@rest))))

(deftable proteins
  UUU F      CUU L      AUU I      GUU V
  UUC F      CUC L      AUC I      GUC V
  UUA L      CUA L      AUA I      GUA V
  UUG L      CUG L      AUG M      GUG V
  UCU S      CCU P      ACU T      GCU A
  UCC S      CCC P      ACC T      GCC A
  UCA S      CCA P      ACA T      GCA A
  UCG S      CCG P      ACG T      GCG A
  UAU Y      CAU H      AAU N      GAU D
  UAC Y      CAC H      AAC N      GAC D
  UAA Stop   CAA Q      AAA K      GAA E
  UAG Stop   CAG Q      AAG K      GAG E
  UGU C      CGU R      AGU S      GGU G
  UGC C      CGC R      AGC S      GGC G
  UGA Stop   CGA R      AGA R      GGA G
  UGG W      CGG R      AGG R      GGG G)

(defn to-protein [s]
  (->> s
       (partition 3)
       (map (partial apply str))
       (map symbol)
       (map proteins)
       (take-while #(not= % 'Stop))
       (apply str)))

The body of the proteins table is literally cut-and-pasted from the problem page (click on “RNA codon table”). I think it’s a good example of using macros to provide a little bit of syntactic sugar to make the code just a little more readable and elegant, or to encode domain facts as directly as possible.

This and my other solutions so far are up on GitHub.

SSH into a machine with a dynamic IP

Thomas Hunter II — Sun, 09 Jun 2013 03:00:00 GMT

Build a Better Warrior in Rift

Ben Overmyer's Site — Sat, 08 Jun 2013 03:00:00 GMT

I've been playing Rift a lot lately, and the more I play, the better I understand the ins and outs of being a Warrior. This post has a few of my thoughts on the subject of tuning warrior builds. The class is really versatile, but focuses heavily on two aspects - tanking and dealing damage. That much is obvious. What is less obvious is that there are several ways to do each of these. My personal preference is for dealing respectable amounts of damage to multiple enemies while being able to take a lot of punishment before going down. My favorite ability for staying in the fight is No Permission to Die. It's in the fifth tier of the Warlord soul, and it can be a godsend. If you die within ten seconds of triggering it, you are resurrected at 50% of your maximum health. Properly timed, it can really save your bacon. Also, it's not on global cooldown, so it's really hard to NOT time it right if you have a good sense of your combat situation. My next favorite ability is Cornered Beast, which is the 32 point unlock for the Champion soul. It hits up to 6 enemies for a ton of damage over time AND generates Attack Points over time, making it a powerful threat-building ability. Awesome for tanks, and for area effect damage. Along with Warlord and Champion, picking the Reaver soul allows for a ridiculous amount of survivability. It has a number of abilities that boost armor, endurance, and resistances. A balanced mix of the three souls, like the build linked here (Champion (32) / Warlord (23) / Reaver (21)), will give you a decent AoE tanking playstyle. You won't win any DPS races, but it will keep you in the fight for a good long time.

How to switch to Compton for beautiful tear free compositing in XFCE

duncanlock.net — Fri, 07 Jun 2013 10:05:59 GMT

I switched my XFCE machines over to use Compton for window compositing today - and it’s a noticeable improvement.

A compositor glues your stacks of windows together to form the final image that you see on screen. It’s responsible for any fancy effects like drop-shadows, as well drawing windows while dragging, resizing and minimizing or maximizing them. [1]

Compton does this beautifully. It does one thing and it does it well. It provides glassy smooth, tear free compositing and supports a few tasteful effects - drop shadows, fades and transparency.

I stumbled across this while searching for something else and found a great guide in the NeoWin forums [2], where most of this info comes from, so thanks ViperAFK.

Switch off the existing compositor

You’ll need to switch of any existing compositing you’ve got running, otherwise this won’t work. Unless you know differently, this will be the default one, built into the XFCE window manager, xfwm4.

To switch this off, go into the Applications menu and click ‘Settings Manager’:

Then click ‘Window Manager Tweaks’, then the ‘Compositor’ tab, and un-tick the ‘Enable Display Compositing’ box:

Once you’ve switched off any existing compositor, you can install Compton.

Install Compton

To do that, run the following commands in a terminal window. These will add the official Compton PPA [3] and then install it:

$ sudo apt-add-repository ppa:richardgv/compton
$ sudo apt-get update
$ sudo apt-get install compton

Configure Compton

Once it’s installed, create a text file in ~/.config/ called compton.conf with the following contents:

#################################
#
# Backend
#
#################################

# Backend to use: "xrender" or "glx".
# GLX backend is typically much faster but depends on a sane driver.
backend = "glx";

#################################
#
# GLX backend
#
#################################

glx-no-stencil = true;

# GLX backend: Copy unmodified regions from front buffer instead of redrawing them all.
# My tests with nvidia-drivers show a 10% decrease in performance when the whole screen is modified,
# but a 20% increase when only 1/4 is.
# My tests on nouveau show terrible slowdown.
# Useful with --glx-swap-method, as well.
glx-copy-from-front = false;

# GLX backend: Use MESA_copy_sub_buffer to do partial screen update.
# My tests on nouveau shows a 200% performance boost when only 1/4 of the screen is updated.
# May break VSync and is not available on some drivers.
# Overrides --glx-copy-from-front.
# glx-use-copysubbuffermesa = true;

# GLX backend: Avoid rebinding pixmap on window damage.
# Probably could improve performance on rapid window content changes, but is known to break things on some drivers (LLVMpipe).
# Recommended if it works.
# glx-no-rebind-pixmap = true;


# GLX backend: GLX buffer swap method we assume.
# Could be undefined (0), copy (1), exchange (2), 3-6, or buffer-age (-1).
# undefined is the slowest and the safest, and the default value.
# copy is fastest, but may fail on some drivers,
# 2-6 are gradually slower but safer (6 is still faster than 0).
# Usually, double buffer means 2, triple buffer means 3.
# buffer-age means auto-detect using GLX_EXT_buffer_age, supported by some drivers.
# Useless with --glx-use-copysubbuffermesa.
# Partially breaks --resize-damage.
# Defaults to undefined.
glx-swap-method = "undefined";

#################################
#
# Shadows
#
#################################

# Enabled client-side shadows on windows.
shadow = true;
# Don't draw shadows on DND windows.
no-dnd-shadow = true;
# Avoid drawing shadows on dock/panel windows.
no-dock-shadow = true;
# Zero the part of the shadow's mask behind the window. Fix some weirdness with ARGB windows.
clear-shadow = true;
# The blur radius for shadows. (default 12)
shadow-radius = 5;
# The left offset for shadows. (default -15)
shadow-offset-x = -5;
# The top offset for shadows. (default -15)
shadow-offset-y = -5;
# The translucency for shadows. (default .75)
shadow-opacity = 0.5;

# Set if you want different colour shadows
# shadow-red = 0.0;
# shadow-green = 0.0;
# shadow-blue = 0.0;

# The shadow exclude options are helpful if you have shadows enabled. Due to the way compton draws its shadows, certain applications will have visual glitches
# (most applications are fine, only apps that do weird things with xshapes or argb are affected).
# This list includes all the affected apps I found in my testing. The "! name~=''" part excludes shadows on any "Unknown" windows, this prevents a visual glitch with the XFWM alt tab switcher.
shadow-exclude = [
    "! name~=''",
    "name = 'Notification'",
    "name = 'Plank'",
    "name = 'Docky'",
    "name = 'Kupfer'",
    "name = 'xfce4-notifyd'",
    "name *= 'VLC'",
    "name *= 'compton'",
    "name *= 'Chromium'",
    "name *= 'Chrome'",
    "name *= 'Firefox'",
    "class_g = 'Conky'",
    "class_g = 'Kupfer'",
    "class_g = 'Synapse'",
    "class_g ?= 'Notify-osd'",
    "class_g ?= 'Cairo-dock'",
    "class_g ?= 'Xfce4-notifyd'",
    "class_g ?= 'Xfce4-power-manager'"
];
# Avoid drawing shadow on all shaped windows (see also: --detect-rounded-corners)
shadow-ignore-shaped = false;

#################################
#
# Opacity
#
#################################

menu-opacity = 1;
inactive-opacity = 1;
active-opacity = 1;
frame-opacity = 1;
inactive-opacity-override = false;
alpha-step = 0.06;

# Dim inactive windows. (0.0 - 1.0)
# inactive-dim = 0.2;
# Do not let dimness adjust based on window opacity.
# inactive-dim-fixed = true;
# Blur background of transparent windows. Bad performance with X Render backend. GLX backend is preferred.
# blur-background = true;
# Blur background of opaque windows with transparent frames as well.
# blur-background-frame = true;
# Do not let blur radius adjust based on window opacity.
blur-background-fixed = false;
blur-background-exclude = [
    "window_type = 'dock'",
    "window_type = 'desktop'"
];

#################################
#
# Fading
#
#################################

# Fade windows during opacity changes.
fading = true;
# The time between steps in a fade in milliseconds. (default 10).
fade-delta = 4;
# Opacity change between steps while fading in. (default 0.028).
fade-in-step = 0.03;
# Opacity change between steps while fading out. (default 0.03).
fade-out-step = 0.03;
# Fade windows in/out when opening/closing
# no-fading-openclose = true;

# Specify a list of conditions of windows that should not be faded.
fade-exclude = [ ];

#################################
#
# Other
#
#################################

# Try to detect WM windows and mark them as active.
mark-wmwin-focused = true;
# Mark all non-WM but override-redirect windows active (e.g. menus).
mark-ovredir-focused = true;
# Use EWMH _NET_WM_ACTIVE_WINDOW to determine which window is focused instead of using FocusIn/Out events.
# Usually more reliable but depends on a EWMH-compliant WM.
use-ewmh-active-win = true;
# Detect rounded corners and treat them as rectangular when --shadow-ignore-shaped is on.
detect-rounded-corners = true;

# Detect _NET_WM_OPACITY on client windows, useful for window managers not passing _NET_WM_OPACITY of client windows to frame windows.
# This prevents opacity being ignored for some apps.
# For example without this enabled my xfce4-notifyd is 100% opacity no matter what.
detect-client-opacity = true;

# Specify refresh rate of the screen.
# If not specified or 0, compton will try detecting this with X RandR extension.
refresh-rate = 0;

# Set VSync method. VSync methods currently available:
# none: No VSync
# drm: VSync with DRM_IOCTL_WAIT_VBLANK. May only work on some drivers.
# opengl: Try to VSync with SGI_video_sync OpenGL extension. Only work on some drivers.
# opengl-oml: Try to VSync with OML_sync_control OpenGL extension. Only work on some drivers.
# opengl-swc: Try to VSync with SGI_swap_control OpenGL extension. Only work on some drivers. Works only with GLX backend. Known to be most effective on many drivers. Does not actually control paint timing, only buffer swap is affected, so it doesn't have the effect of --sw-opti unlike other methods. Experimental.
# opengl-mswc: Try to VSync with MESA_swap_control OpenGL extension. Basically the same as opengl-swc above, except the extension we use.
# (Note some VSync methods may not be enabled at compile time.)
vsync = "opengl-swc";

# Enable DBE painting mode, intended to use with VSync to (hopefully) eliminate tearing.
# Reported to have no effect, though.
dbe = false;
# Painting on X Composite overlay window. Recommended.
paint-on-overlay = true;

# Limit compton to repaint at most once every 1 / refresh_rate second to boost performance.
# This should not be used with --vsync drm/opengl/opengl-oml as they essentially does --sw-opti's job already,
# unless you wish to specify a lower refresh rate than the actual value.
sw-opti = false;

# Unredirect all windows if a full-screen opaque window is detected, to maximize performance for full-screen windows, like games.
# Known to cause flickering when redirecting/unredirecting windows.
# paint-on-overlay may make the flickering less obvious.
unredir-if-possible = true;

# Specify a list of conditions of windows that should always be considered focused.
focus-exclude = [ ];

# Use WM_TRANSIENT_FOR to group windows, and consider windows in the same group focused at the same time.
detect-transient = true;
# Use WM_CLIENT_LEADER to group windows, and consider windows in the same group focused at the same time.
# WM_TRANSIENT_FOR has higher priority if --detect-transient is enabled, too.
detect-client-leader = true;

#################################
#
# Window type settings
#
#################################

wintypes:
{
    tooltip =
    {
        # fade: Fade the particular type of windows.
        fade = true;
        # shadow: Give those windows shadow
        shadow = false;
        # opacity: Default opacity for the type of windows.
        opacity = 0.85;
        # focus: Whether to always consider windows of this type focused.
        focus = true;
    };
};

Details on what each of these options does can be found here. Some of them might need adjusting if you have crappy graphics drivers but should work for anyone with reasonable, up to date drivers & some kind of 3D graphics card.

It worked perfectly for me, on both my desktop dual monitor setup on an NVidia 8800GTS using the current xorg-edgers driver, 313.30 [4] - and also on my laptop with a some sort of crappy Mobility Radeon. By the look of the documentation, the most likely settings that might cause problems with drivers would be vsync and backend.

Start Compton for the Current Session

Now we’re going to make sure this is all working by starting compton. Press Alt+F2, type compton in the Application Launcher box, then press enter:

Your screen will flicker and you should now have glassy smooth, tear free window dragging, with drop shadows and beautiful fading on window open/close & desktop switching, etc… Try dragging and few windows around, switching workspaces and open and closing things. Bathe in the smoothness.

Set Compton to auto-start

Assuming that worked, we’ll make Compton start at startup. Go into the Applications menu and click ‘Settings Manager’, then click ‘Session and Startup’, then select the ‘Application Autostart’ tab:

Figure 1. Click the ‘Add’ button, then fill in the boxes like this.

Excluding some windows using xwininfo and shadow-exclude

Figure 2. Notice the square background behind the rounded corners on this volume notification.

You probably don’t want shadows on every window - they don’t work very well on notification popups, for example.

To exclude certain types of window, or certain applications, from having shadows, you can set the shadow-exclude setting. This setting is a list of conditions to match windows to. The simplest one is a wild card match on the window name, which is done something like this: name *= 'Firefox'.

Here’s an example from my config file. It excludes various notification popups, VLC, Chrome, Kupfer [5] and other problem apps:

shadow-exclude = [
    "! name~=''",
    "name = 'Notification'",
    "name = 'Plank'",
    "name = 'Docky'",
    "name = 'Kupfer'",
    "name = 'xfce4-notifyd'",
    "name *= 'VLC'",
    "name *= 'compton'",
    "name *= 'Chromium'",
    "name *= 'Chrome'",
    "name *= 'Firefox'",
    "class_g = 'Conky'",
    "class_g = 'Kupfer'",
    "class_g = 'Synapse'",
    "class_g ?= 'Notify-osd'",
    "class_g ?= 'Cairo-dock'",
    "class_g ?= 'Xfce4-notifyd'",
    "class_g ?= 'Xfce4-power-manager'"
];

To add to this, you will need to know either the name or the class that X11 uses to refer to the window. There’s a handy utility called xwininfo that will tell you this. To use it, run this from a console window:

$ xwininfo -stats -wm

Your mouse cursor will turn into a little cross-hair. Use this to click on the window you want to know about and xwininfo will print out some information about it. For example, clicking on an XFCE notification bubble will print something like this:

xwininfo: Window id: 0x9a00073 "xfce4-notifyd"

  Absolute upper-left X:  1390
  Absolute upper-left Y:  16
  Relative upper-left X:  0
  Relative upper-left Y:  0
  Width: 274
  Height: 76
  Depth: 32
  Visual: 0xec
  Visual Class: TrueColor
  Border width: 0
  Class: InputOutput
  Colormap: 0x9a00003 (not installed)
  Bit Gravity State: NorthWestGravity
  Window Gravity State: NorthWestGravity
  Backing Store State: NotUseful
  Save Under State: no
  Map State: IsViewable
  Override Redirect State: no
  Corners:  +1390+16  -2064+16  -2064-1060  +1390-1060
  -geometry 274x76+1390+16

  Window manager hints:
      Client accepts input or input focus: No
      Initial state is Normal State
      Displayed on all desktops
      Window type:
          Notification
      Window state:
          Sticky
          Skip Pager
          Skip Taskbar
          Above
      Process id: 23420 on host duncan-desktop
      Frame extents: 0, 0, 0, 0

The window name is on the end of the first line (xfce4-notifyd in this case) and the class and type are further down. Click here for more information about Compton conditionals. You can use this information to add exclusions for these windows to your config.

All done. If you have any improvements on this setup, let me know in the comments.

Footnotes & References

Some window managers have Compositing built in and some don’t. See here for more info. ↩
Some of this information here came from this great guide by ViperAFK on the NeoWin formus and this one by screaminj3sus on ubuntuforums.org, as suggested by Saravanan Kumar in the comments. ↩
Compton code is on GitHub and the PPA is on Launchpad. ↩
xorg-edgers: “Packages for those who think development versions, experimental and unstable are for old ladies. We want our crack straight from upstream git! Well, straight, we want it built and packaged so we don’t need to know what we’re doing, except that we will break our X and put our computers on fire.” Use at your own risk! ↩
Kupfer: An extremely lightweight quick launcher, like Gnome DO, “a convenient command and access tool”, is a program that can launch applications and open documents, and access different types of objects and act on them. ↩

Climbing in "decking range"

Josh Thompson — Fri, 07 Jun 2013 03:00:00 GMT

In indoor sport climbing, as your climber progresses from the ground to the first three bolts, you need to be ready for any situation. Here’s how to give a kick-ass lead belay when your climber is close enough to the ground they could potentially deck.

This is part of a series on lead belaying.

Have you ever encountered hard moves right off the ground? If you can’t make it to the first bolt, you know you’ll land on the ground if you fall. No big deal. If you make the first bolt, and get to the second one and can’t clip, or if you have to make a committing move past the second bolt in order to clip, all of a sudden, hitting the ground is a real possibility, and you don’t really want to do that, right?

If you’re like me, and you don’t completely trust your belayer, climbing becomes scary, because I’m now focused on not hitting the ground. Heady stuff, for something you do for fun.

This situation is why you need to be an awesome belayer when your climber is between the first and second bolts. You should never expect (or demand) that your belayer be better than you.

I’ll address a few common situations, and explain what to do in each. Hopefully I’ll help you sketch out a mental picture of what to do, then you can get in the gym and practice a bit. I’ll close with how you can build all these skills in the comfort of your local climbing gym.

Disclaimer: Climbing is dangerous. Falling from before the third bolt can result in you hitting the ground. So can falling from after the third bolt. Don’t hurt yourself - start with small and safe, and work into big and safe.

All that follows is in the context of INDOOR SPORT CLIMBING. If you’re outside, you need to evaluate the landing zone, and decide how risky it is to let your climber come anywhere close to the ground.

OK - from the ground up, with equally sized climbers:

Climber is below the first bolt

You’re spotting right now, because they can’t be on belay. Have enough slack out that the climber can clip the first bolt without getting short roped, but not so much that you have to take in a bunch before they proper slack is in the system. Pro tip: estimate before they clip how much slack they need, and adjust accordingly, rather than estimating and adjusting after they clip.

Climber is between the first and second bolt

Belay should be very snug, with zero extra slack, and the belayer should be out from under the climber with the bolt between the climber and belayer. (I.E. Not directly underneath the climber.)

If the climber falls, you need to remove as much slack as possible from the system while still giving a soft catch. If you remove slack from the system and don’t give them a soft catch, you’ve spiked your climber, which is dangerous. And rude.

To “spike” your climber means you have short-roped them while they fall. The best-case scenario is they fall into free space and are stopped very suddenly. Worst case, as they fall, they may get pulled into the wall without being able to get their feet out, or they can “pendulum” into the wall with enough force to sprain an ankle, or break a bone.

The most common way to unintentionally spike your climber is to be afraid that they will fall too far, and as they fall, you take in slack and/or move backwards and sit in the rope. (Imagine your climber was on top-rope and said “take”. That action taken on top rope belay is EXACTLY what leads to a devastating “spike” on lead belay.)

Getting spiked is mentally and physically jarring, and uncomfortable, and, if repeated, and really damage the lead climber’s confidence in themselves, their belayer, and hard climbing in general.

To remove slack and still give a soft catch, you’ve got to be alert. As the climber is falling, you remove slack from the system, quickly, and get in the brake position. As their weight hits, you jump, hard, off the ground, into the air. It’s possible that the climber will end up standing on the ground, with the belayer up in the air.

This is not a ground fall - the climber, while maybe a bit startled, will have landed on the ground very softly. If the belayer is also standing on the ground, this means the climber was dropped. If the belayer is five or six or seven feet in the air, it was an awesome catch.

It’s also common for the climber and belayer to bump into each other like pool balls. This is physics, and not to be feared. The reason the starting stance of the belayer matters is so that they don’t hit each other on the way up. This would be uncomfortable for all involved.

Climber is clipping the second bolt:

The belayer has zero extra slack, has not short roped the climber, and is standing beneath the first bolt ready to take in slack and step backwards if the climber blows it before clipping. If the climber does fall, the belayer should take in slack while stepping backwards but still give a soft catch.

If you spike your climber in this scenario, you’re really putting the hurt on. Broken ankles and severely bruised knees are in your (or their) future.

For moving between the second and the third bolt:

Repeat the above steps, but leave a little more slack in the system. This makes it less likely that you’ll accidentally short rope or spike them, without exposing them to any additional risk. (I would contend that it’s much safer to have a little more rope out. Zero downside.)

Weight Differences:

If there is a weight difference between the climber and the belayer, the belayer needs to adjust accordingly. I use the following rule of thumb: If the climber outweighs me by more than 25 lbs, I don’t have to try very hard to give a soft catch - it’ll just happen.

If he falls between the first and second bolt, I may try to spike him, in order to keep him off the ground. (Since he outweighs me, I cannot cause a dangerous spike - it will just be a bit harder of a catch than normal.)

If I outweigh the climber by 25lbs or more, I have to try very hard to give a soft catch. There are two ways to do this:

Use a tube-style belay device

(I know it’s more work. You’ll be OK) and let slack go through it as you arrest the fall.

Do not let rope run through your hand! You will burn yourself, and be tempted to let go of the break strand.

What you can do is, as the climber is falling, but before their weight has hit the rope, slide your hand a few inches down the rope, and then just naturally let your hand end up in the break position just below the belay device. Eighteen to twenty four inches of rope will have run through the device as the fall is arrested, and it will be much more comfortable for the climber.

Belay kneeling on one knee and “stand up” into the fall

If your climber is lighter than you, and especially if there is any rope drag, you won’t be able to give a soft catch by just jumping up the wall. You’ll jump, and end up right where you started. It isn’t dangerous, but it’s just not as comfortable to your climber as it could be. (You want them to be comfortable falling, right?) To do this, as they’re moving between bolts, belay from a knee from where you would normally stand. As they fall, still try to jump, but you’ll give a much softer catch since you’ll be assisting them pulling you off the ground with the muscles in your legs.

In sum: Belaying is a big responsibility. It’s easy to get psyched out if you’re doing hard moves between the first and second bolt, or while clipping. You’ll get a great return on investment if you spend a few minutes over your next few sessions practicing these skills. If you are more relaxed while climbing, you’ll climb better. Practice these skills in order to grow relaxed. It won’t come any other way.

In another post, I’ll talk about considerations for climbing outdoors. Everything covered above is applicable, but outside you come across hazards that are not often encountered inside. (Ledges, dangerous landing zones, etc.)

Practice makes perfect

So, you slogged through these thousand words, and you’re ready to practice. (Bless you, for reading this far)

Should you just head out, grab an unsuspecting friend, and then ask them to whip before clipping the second bolt?

Um. No.

Here’s why:

Your brain is a much more powerful beast than you think it is. It is constantly tuned in to the environment and evaluating new sights, sounds, and situations, even when you’re not paying attention to any of this. This is why music is so important to movies - when the ominous music cues up, you get a tight feeling in your chest, even if everything on the screen is hunky-dorey. Your brain knows that in all the past experiences, ominous music means bad things. Bad things make you feel anxious. Therefore, ominous music makes you feel anxious.

Your brain evaluates new experiences in light of past experiences. Heuristicsis a cool word that means “mental shortcut”. When you encounter a new situation, your brain says “does this in any way, shape, or form, resemble anything I’ve encountered before? If so, repeat reaction.”

The implication of this thought process is stunning, and wide-spread. We’re talking about climbing, today, so I’ll keep it to that. When you fall, ever, do you experience stress, anxiety, or discomfort? If so, you are teaching your subconscious to link negative emotions with falling. Every time you experience stress while falling, you’re strengthening the connection.

Falling, for the sake of falling, if at all associated with discomfort or stress, reinforces negative mental attitudes.

The only way to get better at falling, to make it easier, is to make it pain free. Discomfort free. Easy. Rewarding.

You need to start small, and just barely outside your comfort zone, and not progress to more challenging material until your comfort zone has expanded to include the area that was once outside your comfort zone.

Here’s a recommended progression:

Climb to the third bolt. Clip it, and move down one move. Confirm your belayer is ready, and then let go of the wall. You’re on top rope, so this is easy. Do it a few times so your belayer can practice timing the jump up the wall, so he can give you a soft catch. You both will be able to feel when he figures it out.
Repeat the above step, but this time, have your belayer feed out a foot or two of slack before you let go of the wall. You’ll be moving a little faster, and will solidify to you both what a soft catch feels like. (Your belayer should be good at giving softer catches as this point.
Climb to the bolt, where it’s level with your chest, and fall a few times. Soft catches. This should be easy. Feel free to call it a day whenever you’re ready. At this point you probably have taught your subconscious that the last fifteen falls were actually pretty low key, and you should feel a sense of reward and pride. Revel in this feeling.
Climb so the bolt is at your waist. Make sure your belayer doesn’t have you tight - you don’t want to be short roped or spiked, remember? Fall a few times. Are you both growing comfortable with the idea behind soft catches?
Switch out with your belayer. Why should you have all the fun? Repeat the above steps, then switch back.
Climb a move or two above the bolt, take a fall. Now you’re really falling. Your belayer should be giving you soft catches.
Climb another move or two, do it again. Take a fall here a few times, but not in the exact same situation. Don’t get in the mindset that you have to perfectly prepare for falling - that does not transfer well to real-world climbing.

Once you’ve completed these seven steps, you’re well on your way to de-linking discomfort and falling. The work is not done, but a full progression is a whole blog post in it’s own. That’s coming soon.

Updated 09/12/16 (Thanks /u/notcrushingV16)

Feedback? Shoot an email to joshthompson@hey.com

Differences Of Opinion by Wendy Cope

ho.dges.online — Thu, 06 Jun 2013 03:00:00 GMT

He tells her that the earth is flat —
He knows the facts, and that is that.
In altercations fierce and long
She tries her best to prove him wrong.
But he has learned to argue well.
He calls her arguments unsound
And often asks her not to yell.
She cannot win. He stands his ground.
The planet goes on being round.

Getting the Most Out of ASH online seminar

Tanel Poder Blog — Thu, 06 Jun 2013 00:10:35 GMT

Just a little reminder – next week (10-11th June) I’ll be delivering my last training session before autumn – a short 1-day (2 x 0.5 days actually) seminar about Getting the Most Out of Oracle’s Active Session History. In the future it will act as sort of a prequel (or preparation) for my Advanced Oracle Troubleshooting class, as the latter one deliberately goes very deep. The ASH seminar’s 1st half is actually mostly about the GUI way of troubleshooting the usual performance problems (EM/Grid Control) and the 2nd half is about all my ASH scripts for diagnosing more complex stuff.

The Incredibles

🦉 olshansky 🦁 — Wed, 05 Jun 2013 12:01:45 GMT

Olshansky's review of The Incredibles

Collecting duplicate resources in puppet

The Technical Blog of James on purpleidea.com — Wed, 05 Jun 2013 02:39:08 GMT

I could probably write a long design article explaining why identical duplicate resources should be allowed [1] in puppet. If puppet is going to survive in the long-term, they will have to build in this feature. In the short-term, I will have to hack around deficiency. As luck would have it, Mr. Bode has already written part one of the hack: ensure_resource.

Why?

Suppose you have a given infrastructure with N vaguely identical nodes. N could equal 2 for a dual primary or active-passive cluster, or N could be greater than 2 for a more elaborate N-ary cluster. It is sufficient to say, that each of those N nodes might export an identical puppet resource which one (or many) clients might need to collect, to operate correctly. It’s important that each node export this, so that there is no single point of failure if one or more of the cluster nodes goes missing.

Installing PyPy with Gevent and virtualenv on Fedora

Jelle Smet — Wed, 05 Jun 2013 02:26:00 GMT

PyPy has been on my radar for a while but I have never really brought myself to the point of actually trying it. Recently, a notification caught to my attention stating PyPy 2.0.2 was released and had support to run Gevent. Good news! I was looking at speed …

Get the Urban Dictionary in your terminal

Baptiste Fontaine’s Blog — Tue, 04 Jun 2013 23:16:00 GMT

The Urban Dictionary website is pretty useful when one wants to know the meaning of any familiar or slang word. Users can write definitions for any words, and upvote or downvote them. Unfortunately, the website doesn’t have a public API, and I couldn’t find a command-line tool for it. So I wrote one.

Introducing ud

ud is a command-line tool which prints definitions from the Urban Dictionary website. It’s written in Ruby, and allows you to quickly search for a definition of any word.

$ ud wth
* WTH (567/126):

   1) Abbreviation for "What the Hell"
   2) Shortened alternative to "With"

 Example:
   1) WTH was that?!
   2) I ate some crackers wth chicken
(…)

For common abbreviations like “wtf” or “omg”, there are dozens of definitions, with minor differences. That’s why the script scraps only the first page of results, and supports a few options: -n allows you to limit the number of definitions (e.g. -n 1 → only one). -r allows you to select only the definitions which have an upvotes/downvotes ratio higher than what you want, e.g. -r 2 will select only the definitions which have twice more upvotes than downvotes. For your convenience, it also support the shortcut -u which is an alias for -r 2. Type ud -h for more info.

Install

That’s easy:

gem install ud

Please note that if you’re using Windows, you’ll need to install the Win32 Console ANSI gem for the colored output. Install it with:

gem install win32console

Using the UD module

The gem also provide a UD module, which you can use to query the website in your own Ruby code:

require 'ud'

wtf = UD.query 'wtf', :count => 1

puts wtf[0].keys.join ', '
#=> id, word, definition, example, upvotes, downvotes

puppet matlab module

The Technical Blog of James on purpleidea.com — Tue, 04 Jun 2013 05:46:27 GMT

I don’t like repetitive work, and installing matlab counts doubly as so. Once I figured out the correct steps, I automated it with a puppet module. The downside is that the install takes a while because puppet needs to copy the iso locally. This is okay because I can be busy doing something else while this is happening.

Using the module is quite easy:

matlab::install { 'R2011a':
    iso => 'puppet://files/matlab/MATHWORKS_R2011A.iso',
    licensekey => '#####-#####-#####-#####',    # provide your own here
    licensefile => 'puppet:///files/matlab/license.lic',    # get your own!
    licenseagree => true,    # setting this to true 'acknowledges' their (C)
    prefix => '/usr/local',
}

You might notice that this supports installing multiple releases on the same machine. You will have to provide your own license key and license file.

puppet rsnapshot module

The Technical Blog of James on purpleidea.com — Tue, 04 Jun 2013 05:29:35 GMT

Today I am releasing a puppet module for rsnapshot. The nice feature of this module, is that it lets you configure multiple different instances of rsnapshot, so that they could all run in parallel. Rsnapshot doesn’t support this directly, so this puppet module does the heavy lifting of separating out and managing each instance.

https://github.com/purpleidea/puppet-rsnapshot

The examples/ directory should give you a hint on how to use it. For everything else, have a look at the code, or feel free to leave me a comment. I hope you find it useful!

ZineScreen

mbutler — Tue, 04 Jun 2013 04:43:53 GMT

A project funded by an innovation grant written by Colleen Theisen, librarian at the University of Iowa Libraries. I built this touchscreen kiosk using turn.js, the iPad 2, and LiliTab hardware. The ZineScreen is based loosely on the Zine Machine, housed in the University Main Library. ZineScreen consumes scanned zines and alternative publications as content […]

Writing vs. Writing

Zac Szewczyk — Mon, 03 Jun 2013 20:00:24 GMT

Shawn Blanc in an article published over two years ago, which he linked to earlier this afternoon in a linked-list post:

“But suppose one day I do arrive at some level of skill where the ink flows like honey and the prose like fine wine. I wonder if I’d even realize it. It may very well feel just like it does right now — like today — when it seems as if I can’t even put two words together using copy and paste.”

Permalink.

Training for climbing (progress update)

Josh Thompson — Mon, 03 Jun 2013 03:00:00 GMT

I am at the end of my second iteration of climbing training, and this is how it went and what I learned: I completed the workout twelve times, but I took a twelve-day break between workout eleven and twelve. I first skipped a workout because I had ripped skin open on one of my fingers, and I did not want to attempt the workout with that damage, even though I could have taped it. I skipped the next one because I didn’t really want to do it, and was short on time for the day. Next I felt sick, and then I was on a work-related trip for a week. more

So, without even trying, I took almost two weeks off from training. And I am glad I did so; Friday and Saturday I experienced occasional throbbing pain in my elbow. I’ve felt it before, and it’s early-stage elbow tendonitis. It did not show up until I had climbed for almost two weeks, so I am glad I took it easy recently. In the future I will continue to take breaks from training, so my tendons can recover.

This last weekend I was going to climb in the New River Gorge, and I was going to see if my training had netted any improvement. As myself and a few others were driving there Saturday morning, my car decided to overheat and vent coolant all over the inside of the hood. Thanks to kind and knowledgeable West Virginians, we were able to temporarily repair what is probably catastrophic damage (supposedly a blown head gasket) and drive my car back to DC. I’m not positive what caused the problem but it certainly ended the trip. The down side is we didn’t climb for the weekend; the upside is the car is still drivable. (For a while I was afraid I would have to have to get it towed 150 miles back to DC. Expensive.)

I trained hard but didn’t see the improvement I’d hoped with my heavy pulls. I would saddle myself with up to 20 pounds of weight and do my dynamic touches. There was not a lot of change in that area, although I am still glad I did them. My largest improvement came from my static hangs – I would have ten pounds on me and hang from three fingers for as long as I could. I certainly got stronger in this area.

I feel better at my two finger hang as well. I was initially barely able to get my weight off the ground, and now I have hit ten or twelve seconds a few times.

Next Steps

I am now thinking about how to change my workout. I don’t want to focus on weighted touches as much, for the time being – I want to work on my finger strength. Specifically, I want to work toward one-hand dead hangs. I have some ideas, but I know that it will take a while to get there. It’s critical that I implement good progress tracking, and reward myself for hitting mini-milestones along the way. It’s too big a goal to just aim for one-handed hangs. I would grow discouraged well before I ever got there.

I am enjoying this training. I enjoyed my break, but I am excited to get back into the training. I feel like I’m in a good place, when it comes to motivation.

MongoDB User Group a Cesena

Nicola Iarocci — Mon, 03 Jun 2013 03:00:00 GMT

Domani sarò al primo meeting romagnolo del #MUG MongoDB User Group organizzato da 10Gen (azienda dietro a MongoDB), Byte-Code e Ideato.

Parlerò di MongoDB usato come backend per una REST WEB API. L’evento si svolgerà in serata a Cesena, è gratuito, e ci sono ancora posti disponibili. Se ci siete passate a salutarmi.

Setting up a Security Camera for a Linux Webcam

Thomas Hunter II — Mon, 03 Jun 2013 03:00:00 GMT

National Day of Civic Hacking: Exploring Consumer Financial Protection Bureau Data

Kevin Ohashi — Mon, 03 Jun 2013 01:05:22 GMT

This weekend I participated in the National Day of Civic Hacking.

The project I decided to work on was working with the CFPB data (and also used some census data).

Background

The CFPB released a large complaints database that contained information about what type of financial products people are complaining about. It also gave information about where the complaints came from, what they were complaining about and resolution information. Some of the data was released literally a day earlier. So I was given a chance to take a look at, analyze and visualize information that nobody has really seen yet.

It was an exciting and interesting opportunity. Since it was very fresh data with little to no previous work, much of what I got to do was more general analysis. I created a handful of graphics (click them to see full size) and maps (click to use the map) which I have included below:

What products are people complaining about the most?

The biggest product people are complaining about is mortgage related products. There is a category for other mortgages that people can choose and it seems most people seem to select that. I wasn't sure why until I looked at the issues people were having.

What are the most common issues people have?

Foreclosure, Loan Modification and Collection. Intuitively, this makes a lot of sense. I probably don't care what type of mortgage it is when they are trying to take my house away. This particular issue dwarfed everything else, so I had to use a log scale to even see what the other issues people were facing.

What are the most common issues people have? (log scaled)

This gives a more in-depth picture of the issues, but the first graphic really shows you the most common and/or pressing financial issue for people.

Which companies had the most complaints?

Then I explored which companies were receiving the most complaints. This data is NOT normalized. That means that just because a company has more complaints doesn't make it worse than one with less. For example, if company A had 10 complaints and 100 customers and company B had 5 complaints and 20 customers, company B would be worse (if we measured complaints as a % of customers). I didn't have easy access to a database with any dataset that would normalize these banks, so this is for curiosity more than any meaningful insight. It probably is a proxy for the largest players in consumer finance though.

[MAP] Where are the complaints coming from in the US? (Normalized for state population)

This map shows where people are complaining the most. DC won that dubious honor. Maryland, Delaware, New Hampshire, California and Florida were also high on the list. All the numbers were adjusted to reflect complaints relative to population of a state. So we can clearly see there are differences and we can probably make educated guesses for some of them. DC for example is probably the highest because of the highest awareness of CFPB (since it's based in DC). Maryland probably has a high awareness too. Florida and California had big real estate bubbles and perhaps were hit especially hard. New Hampshire and Delaware are a mystery to me, although a woman from New Hampshire at my event told me that she complained to the CFPB and told all her friends as well. Perhaps an above-average awareness of the CFPB caused the higher complaint rate.

Top 10 Companies by Complaints and their Disputed Resolution Rates

Next I explored disputed resolutions. Companies alert the CFPB when the matter is resolved and consumers are allowed to tell the CFPB they were not satisfied with the resolution. I graphed the top 10 companies by complaint volume and what their disputed resolution rates looked like. It's interesting to see such big differences between companies but without further information about how they handle disputes, it's impossible to say anything confidently comparing one company to another.

[MAP] Disputed Resolutions by State

Finally, I created a map graphing disputed resolutions by state. There was a surprisingly large variation between states. Alaska, for instance, had a disputed resolution rate of over 26% while Wyoming had a measly 16%. I have no idea why, but it's interesting and worth looking into further.

Conclusion

I had a lot of fun exploring this fresh set of data and there is a lot more to be learned from it. I want to give a big thanks to Ana from the CFPB and Logan from the Census Bureau who attended the event and helped participants navigate the data provided their respective organizations.

Magic Phone Numbers: My VOIP Setup, with voip.ms

duncanlock.net — Sat, 01 Jun 2013 00:46:45 GMT

Figure 1. In an ideal world, I’d like something like this - and vice versa, please.

My wife and I currently live in Canada, and our families are back in the UK. We’d been using Skype to chat with people in the UK, but I was getting frustrated with Skype’s limitations: it either ties you to a computer and WiFi, or running a battery hungry app which slows down your phone. It doesn’t work very well over the 3G phone network here and while it’s free to make Skype to Skype calls, it’s fairly expensive calling real phones. I didn’t really want to buy a dedicated Skype phone - we both already have mobile/cell phones. And, to top it all off, the Skype software for Linux is the poor cousin of the Windows one, or pretty much unusable if you run 64-bit Linux.

In addition to these Skype specific issues, our parents both live out in the English countryside, and their internet connections are pretty slow and unreliable. It would be better if they didn’t have to use the internet on their end at all.

So, what I really wanted was something that I could easily use on my Android phone without having to run yet another app, and that was cheaper and easier to use. I also wanted something that could be used exactly like a regular local phone number – just call it and ring a phone on the other side of the world.

What I wanted was a Magic Phone Number

After a lot of reading & research [1], I decided that I wanted a VOIP (Voice Over IP) [2] setup of some sort.

Unlike Skype, VOIP is an open standard, which means that anyone can create software and devices for it, not just one company. Amongst other things, this means that there are lots of VOIP soft-phones [3] available for every platform and, even better, Android has built in support for making and receiving VOIP calls – so it would just work on our existing phones, without needing to install anything.

There are also lots of VOIP services available that provide lots of other features, like DID (Direct Inward Dialing - i.e. real phone numbers), voice-mail, call forwarding, ring groups, IVR (Interactive Voice Response - i.e. Press One for…, Two for…)` etc…

I eventually chose http://voip.ms/, because of their extreme flexibility, features and very low wholesale-style costs.

Because it’s so flexible, it easily allowed us to get what we needed, along with plenty of bonus extras, for almost no cost.

Getting a Real Phone Number

The first thing I wanted was a real UK phone number that people there could call, that would ring our phones in Canada. Ideally it would be a local number for our parents - familiar and free or cheap to call from a landline phone.

These are called DID (Direct Inward Dialing - i.e. real phone numbers) numbers - and you can get one for practically anywhere. DID’s for many places have a choice of either pay as you go, or monthly flat rate which includes unlimited inbound calls to that number; the UK ones only offer flat rate: $0 setup fee and $4 per month unlimited inbound calls. You just choose the area code you want and click Order.

Congratulations, you now have a UK phone number! The process for getting a phone number practically anywhere else in the world is the same. Now you just need to decide what happens when someone calls it.

Routing

There are lots of options for routing your incoming calls: send them to voicemail, send them to a Digital Receptionist/IVR (Interactive Voice Response - i.e. Press One for…, Two for…), forward them to another number, play them a recording, etc…

I wanted to give people the option of being put through to either me, or my wife, so I wanted to prompt them to choose: ‘Press 1 to call Duncan, Press 2 to…’ – so I needed to send callers to an IVR:

Interactive Voice Response (IVR)

This is just a simple voice prompt system. It plays the caller a recording that you supply and then does things in response to them pressing different digits. You can route each option anywhere you can route a normal call. I set up 1 to call me, 2 to call my wife, 3 to leave me a voicemail and 4 to leave one for my wife:

Figure 2. Simple UK IVR setup, works out to free calls, plus $4 per month flat rate.

Now I wanted the same thing, in reverse – a local number that I could call in Canada that would let me call the UK.

Phone to Phone calling, via the Cloud

So I purchased another DID number, a local Vancouver number, that we could call for free from our cell phones. I then created another IVR, so that when we called that number it would give us a menu of people in the UK to call:

Figure 3. Building an IVR menu in voip.ms. On the right - the digit the caller pressed, on the left, the destination. As you can see, there are lots of different options on the left - these are all the different places you can send callers.

Because our cell phone plan gives us unlimited included/free talk time to local numbers, this means that we can call our local DID number for free and talk to people in the UK (or anywhere else), for as long as we like - no data connection required.

There are two different plans available for the Vancouver DID number: either $1.99 per month plus 0.0149¢ per minute, or $5.95 per month flat rate. The flat rate plan is cheaper if you’re using more than 400 minutes per month - we’re currently using less than that, so we’re on the $1.99 plan.

Counting the Cost

Last month, we spent a total of 14 hours, 24 minutes, 55 seconds calling people in the UK and spent a total of $12.59. That’s… a lot of talking, for not very much cash.

This gives us what we wanted - magic numbers that we can use to call anyone in the world from our cell phones - and that anyone can use to call us - at very low prices.

But wait, there’s more…

This just scratches the surface of the things you can do using VOIP & voip.ms. Here’s a taster of some of the other things that you can do, some of this we’re already using and some we might use in the future:

Free Voicemail for anything: You can route any call to voicemail to take a message. The system can then email the recording (as a .wav file attachment) to any inbox.
CallerID: You can pass-through the CallerID from your phone when you use DID numbers to make outbound calls if you want, or you can set them yourself. You can also have the system report CallerID’s on incoming calls, so that your phone will tell you who’s calling.
VOIP to VOIP calling, VOIP to Phone calling (aka free long distance): You don’t have to use the POTS (Plain Old Telephone System) at all - you can make pure data calls over the internet, either to regular phones or SIP/VOIP numbers. This means that you can use WiFi to make calls without using your cell phone minutes at all, or indeed having a SIM card or a phone - you can use a softphone on any computer or laptop to make calls.
SMS text messaging: I haven’t figured this out yet, but you can send & receive SMS text messages, using your DID numbers. This is a new feature currently US only (and free) - will be 1¢ per text from 2014.
DISA - Direct Inward System Access: This allows you to make outgoing calls, to anyone, with no setup. You just dial to your DID number, provide a 4 digit PIN, then you can dial out to any number in the world, using voip.ms’s cheap termination rates.
Callback: You can define a number to be called back by voip.ms, in order to receive a dial tone and place outgoing calls. This could be useful if you want to place a call and you are not at home or don’t have access to your voip device: you call the number, hang up and it calls the predefined number. You pick up and you get a dial tone - and you can then dial any phone number.
CallerID Filtering: Allows you to filter the incoming calls to your DID numbers that came from specific numbers, area code or even anonymous numbers. For example, if you receive annoying incoming calls from a telemarketing company you can create a filter to route all the calls to a recording that plays the message “That number is no longer in service, please hang up and try again”, amongst several other options. You can also flip this around and filter out everyone except certain numbers, creating a private line that’s impervious to telemarketers.

There are also loads of ‘professional’ type features designed for big offices - calling cues, ring groups, failover, time conditions, etc… Lots more details here: http://wiki.voip.ms/article/Features.

If you’re sold on voip, here’s the voip.ms getting started guide – and if you’ve got any questions, please just ask in the comments!

Footnotes & References:

Thanks very much to Jay Parlar, who wrote up his voip setup here. ↩
What is VOIP: http://en.wikipedia.org/wiki/Voice_over_IP ↩
A soft-phone is a piece of software, like Skype, that allows you to make phone calls on a computer. Unlike Skype, most of them support SIP, STUN and VOIP. ↩

Getting Out of the Office

Zac Szewczyk — Fri, 31 May 2013 20:58:38 GMT

For the past three days, I’ve gotten out of “the office” to write, meaning instead of in my room where I usually write, I went outside and sat in the backyard. And it’s done wonders for my work.

Permalink.

Unsplash

Zac Szewczyk — Fri, 31 May 2013 17:39:51 GMT

Up until now, I have, with but one exception, abstained from writing a single article containing anything but simple text. That exception, a video from Merlin Mann, Scott Simpson, and Adam Lisagor titled Smart and Funny, was just too good to resist: I couldn’t bear the thought of not posting it, of not sharing this hilarious video with everyone that happened to visit my site.

As I said, that video is the only exception, an exception I made because it was great. Today, a new Tumblr popped up called Unsplash. Every ten days, the curator of Unsplash posts ten new hi-resolution photos, free for anyone to use in all their glory. The first ten are nothing short of amazing — not great, even better: amazing. I can’t wait to see the next batch.

Permalink.

The Magazine on Facebook

Zac Szewczyk — Fri, 31 May 2013 17:29:00 GMT

“We now have a Facebook page where we will post photos, video, and teasers of upcoming articles.”

Permalink.

Go Ahead, Write About that Again

Zac Szewczyk — Fri, 31 May 2013 17:22:09 GMT

For the past week or so, I’ve been on a bit of a writing binge. With school finally done for the summer, I suddenly found myself with a lot of free time I quickly filled with writing at every possible moment. I started and finished Nickelodeon’s Experiment over the first six days, and wrote a number of much smaller articles and link posts since then. All in all, it’s been a great few days.

Permalink.

Postgres Indexing - A collection of indexing tips

CRAIG KERSTIENS — Thu, 30 May 2013 23:55:56 GMT

Even from intial reviews of my previous post on expression based indexes I received a lot of questions and feedback around many different parts of indexing in Postgres. Here’s a mixed collection of valuable tips and guides around much of that.

Unused Indexes

In an earlier tweet I joked about some SQL that would generate the SQL to add an index to every column:

# SELECT 'CREATE INDEX idx_'
|| table_name || '_'
|| column_name || ' ON '
|| table_name || ' ("'
|| column_name || '");'
FROM information_schema.columns;
?column?
---------------------------------------------------------------------
CREATE INDEX idx_pg_proc_proname ON pg_proc ("proname");
CREATE INDEX idx_pg_proc_pronamespace ON pg_proc ("pronamespace");
CREATE INDEX idx_pg_proc_proowner ON pg_proc ("proowner");

The reasoning behind this is guessing whether an index will be helpful can be a bit hard within Postgres. So the easy solution is to add indexes to everything, then just observe if they’re being used. Of course you want to add it to all tables/columns because you never know if core of Postgres may be missing some needed ones

As included with the pg-extras plugin for Heroku you can run a query to show you all unused indexes. On Heroku simply install the plugin the run heroku pg:unused_indexes to show the size and number of times an index scan has been used. On a non Heroku Postgres database you can run:

# SELECT
schemaname || '.' || relname AS table,
indexrelname AS index,
pg_size_pretty(pg_relation_size(i.indexrelid)) AS index_size,
idx_scan as index_scans
FROM pg_stat_user_indexes ui
JOIN pg_index i ON ui.indexrelid = i.indexrelid
WHERE NOT indisunique AND idx_scan < 50 AND pg_relation_size(relid) > 5 * 8192
ORDER BY pg_relation_size(i.indexrelid) / nullif(idx_scan, 0) DESC NULLS FIRST,
pg_relation_size(i.indexrelid) DESC;
table | index | index_size | index_scans
---------------------+--------------------------------------------+------------+-------------
public.grade_levels | index_placement_attempts_on_grade_level_id | 97 MB | 0
public.observations | observations_attrs_grade_resources | 33 MB | 0
public.messages | user_resource_id_idx | 12 MB | 0
(3 rows)

Costs of Indexing

There are really a couple of primary costs when it comes to indexing your data. The first is the overall size of the index. Indexes take size on disk, fortunately in most cases disk is pretty cheap. If you’re limited on disk size and not on your current performance then its pretty clear the trade-off you want to take. If you do need to get the size of your index you can do that by running:

# SELECT pg_size_pretty(pg_total_relation_size('idx_name'));

The harder trade off to look at is the cost in terms of throughput. As your data comes in there’s a cost for maintaining that index as the data within it has to be computed. If you’re doing crazy regex’s in your index then you can expect this to have an impact on your throughput.

Composite Indexes vs. Multiple Indiviual Indexes

A composite index is an index that includes multiple columns. Given an example table of purchases:

# \d purchases
Table "public.purchases"
Column | Type | Modifiers
-------------+-----------------------------+-----------
id | integer | not null
item | integer |
quantity | integer |
color | integer |

You might want to add an index on item and quantity together. You can do this with:

CREATE INDEX idx_purchases_item_quantity_color ON purchases (item, quantity, color)

From now on if you included item and quantity in a query its likely it would use this index just as it would if you used item, quantity and color. If you have a large varied set of data within each of these such an index can prove very useful. The caveat is that if you’re querying against only quantity and color then this index is useless, it must include the item column.

In contrast if you have three individual indexes Postgres may combine these or simply use one that would be the most efficient out of the three.

CREATE INDEX idx_purchases_item ON purchases (item);
CREATE INDEX idx_purchases_quantity ON purchases (quantity);
CREATE INDEX idx_purchases_color ON purchases (color);

Of course in this case if you query any individual column it would use the index if appropriate.

What Else

What else do you want to know about Postgres Indexing? Drop me a line craig.kerstiens at gmail.com or hop over to Postgres Guide and read a little there or even contribute some articles of your own.

Under Old Management

Zac Szewczyk — Thu, 30 May 2013 21:05:24 GMT

As Glenn Fleishman said in the article’s opening sentence, Marco has indeed had a very busy few weeks lately. I’m very enthusiastic about the changes Glenn plans to make in the coming weeks and months with the publication of an actual print volume and the advent of a complementary podcast. Until now I haven’t made time to subscribe despite constantly hearing wonderful things about The Magazine; who knows, maybe this will get me to bite the bullet and spend my summer reading.

Permalink.

The Terrible First Draft

Zac Szewczyk — Thu, 30 May 2013 20:09:04 GMT

Writing about writing has always held great interest for me. That’s why, when I saw Shawn Blanc’s article The Root of Non-Writing pop up in Reeder earlier this afternoon, I read it, saved it to Instapaper, and then read it again. I love metawriting.

Permalink.

The Elegant Email

Zac Szewczyk — Thu, 30 May 2013 17:53:58 GMT

“With each paragraph you write, double the amount of time you spend editing. It’s not just grammar and spelling errors that might be hurting your credibility. Is your point clear, literate, and concise? Have you pruned aggressively to find the core of what you’re saying? With each additional paragraph, the higher the chance becomes that you’ve made an egregious mistake that might make your email confusing and forgettable.”

Permalink.

The Second Test

Zac Szewczyk — Thu, 30 May 2013 17:53:16 GMT

Michael Lopp explaining why engineers, in his experience, appear to hate you:

“In your company, there are three kinds of people. There are those you are aware of, but who don’t immediately affect your world. There are those who mildly affect your world and upon whom you have a lightweight dependency. And there are those who are an active part of your world. You depend on them.

“I don’t want to depend on you. It’s nothing personal, it’s just that as an engineer I irrationally believe that anything I don’t build with my own hands is going to get fucked up by someone else. I believe this because I’ve spent a good portion of my life watching other well-meaning people sit down at a computer and simply... make things harder for themselves.”

Replace “company” with “life” in the first paragraph and he just explained me. The entire article, in fact, and his characterization of the engineer describes my personality to a T. Well said, Mr. Lopp, well said.

Permalink.

Unknowable

Zac Szewczyk — Thu, 30 May 2013 14:52:32 GMT

“The cap on WWDC tickets means it won’t go the way of SXSW - a wildly successful conference that has grown consistently since its inception. I used to go every year until one late night we looked around a huge sea of strangers and decided that we no longer knew this conference. The experience had become diluted. It had become unfamiliar, full of strangers, and unknowable.”

For the most part, I didn’t follow the discussion surrounding WWDC ticket sales after they sold out in under two minutes. I read John Siracusa’s article on the topic, but for the most part stayed out of the conversation. I haven’t ever gone to WWDC, after all, nor do I plan to in the foreseeable future. From the few articles I did see, however, and based on the numerous podcasts that touched on the subject, I noticed that by far the vast majority criticized Apple for capping WWDC attendance at 5,000. Michael Lopp’s piece linked at the top of this article was the only piece of note I came across defending Apple’s decision, and easily the best.

As a brief aside before you go on your way, before tonight I had only heard of Michael Lopp in name. Specifically, I remember this one time, very distinctly for some reason, John Gruber mentioned him and his blog on an episode of The Talk Show. After reading Unknowable, I took a few minutes to check out his site. Ten minutes later I finished adding Rands in Repose to my RSS reader; I was very impressed. Over the next half hour I jumped between this article and You’re Not Listening, an article from last year about verbal communication and all its curious little nuances. It was a very interesting read and a representative sample of the type and quality of article Michael Lopp writes. As I suggested at the end of Tumblr. + Yahoo! = !!, if you are unfamiliar with his work, go check it out.

Permalink.

Speeding up Matplotlib

bastibe.de — Thu, 30 May 2013 13:50:00 GMT

For the record, Matplotlib is awesome! Its output looks amazing, it is extremely configurable and very easy to use. What more could you want?

Well... speed. If there is one thing I could criticize about Matplotlib, it is its relative slowness. To measure that, lets make a very simple line plot and draw some random numbers as quickly as possible:

import matplotlib.pyplot as plt
import numpy as np
import time

fig, ax = plt.subplots()

tstart = time.time()
num_plots = 0
while time.time()-tstart < 1:
    ax.clear()
    ax.plot(np.random.randn(100))
    plt.pause(0.001)
    num_plots += 1
print(num_plots)

On my machine, I get about 11 plots per second. I am using pause() here to update the plot without blocking. The correct way to do this is to use draw() instead, but due to a bug in the Qt4Agg backend, you can't use it there. If you are not using the Qt4Agg backend, draw() is supposedly the correct choice.

For a single plot, ten plots per second is not terrible. But then, this is really the simplest case possible, so ten frames per second in the simplest case probably means bad things for not so simple cases.

One thing that really takes time here is creating all the axes and text labels over and over again. So let's not do that.

Instead of calling clear() and then plot(), thus effectively deleting everything about the plot, then re-creating it for every frame, we can keep an existing plot and only modify its data:

fig, ax = plt.subplots()
line, = ax.plot(np.random.randn(100))

tstart = time.time()
num_plots = 0
while time.time()-tstart < 1:
    line.set_ydata(np.random.randn(100))
    plt.pause(0.001)
    num_plots += 1
print(num_plots)

which yields about 26 plots per second. Not bad for a simple change like this. The downside is that the axes are not re-scaled any longer when the data changes. Thus, they won't change their limits based on the data any more.

Profiling this yields some interesting results:

ncalls	tottime	percall	cumtime	percall	filename:lineno(function)
15	0.167	0.011	0.167	0.011	{built-in method sleep)

The one function that uses the biggest chunk of runtime is sleep(), of all things. Clearly, this is not what we want. Delving deeper into the profiler shows that this is indeed happening in the call do pause(). Then again, I was wondering if using pause really was a great idea for performance...

As it turns out, pause() internally calls fig.canvas.draw(), then plt.show(), then fig.canvas.start_event_loop(). The default implementation of fig.canvas.start_event_loop() then calls fig.canvas.flush_events(), then sleeps for the requested time. To add insult to injury, it even insists on sleeping at least one hundredth of a second, which actually explains the profiler output of 0.167 seconds of sleep() for 15 calls very well.

Putting this all together now yields:

fig, ax = plt.subplots()
line, = ax.plot(np.random.randn(100))

tstart = time.time()
num_plots = 0
while time.time()-tstart < 1:
    line.set_ydata(np.random.randn(100))
    fig.canvas.draw()
    fig.canvas.flush_events()
    num_plots += 1
print(num_plots)

which now plots about 40 frames per second. Note that the call to show() mentioned earlier can be omitted since the figure is already on screen. flush_events() just runs the Qt event loop, so there is probably nothing to optimize there.

The only thing left to optimize now is thus fig.canvas.draw(). What this really is doing is drawing all the artists contained in the ax. Those artists can be accessed using ax.get_children(). For a simple plot like this, the artists are:

the background ax.patch
the line, as returned from the plot() function
the spines ax.spines
the axes ax.xaxis and ax.yaxis

What we can do here is to selectively draw only the parts that are actually changing. That is, at least the background and the line. To only redraw these, the code now looks like this:

fig, ax = plt.subplots()
line, = ax.plot(np.random.randn(100))
plt.show(block=False)

tstart = time.time()
num_plots = 0
while time.time()-tstart < 5:
    line.set_ydata(np.random.randn(100))
    ax.draw_artist(ax.patch)
    ax.draw_artist(line)
    fig.canvas.update()
    fig.canvas.flush_events()
    num_plots += 1
print(num_plots/5)

Note that you have to add fig.canvas.update() to copy the newly rendered lines to the drawing backend.

This now plots about 500 frames per second. Five hundred times per second! Frankly, this is quite amazing!

Note that since we are only redrawing the background and the line, some detail in the axes will be overwritten. To also draw the spines, use for spine in ax.spines.values(): ax.draw_artist(spine). To draw the axes, use ax.draw_artist(ax.xaxis) and ax.draw_artist(ax.yaxis). If you draw all of them, you get roughly the same performance as fig.canvas.draw(). The axes in particular are quite expensive.

There is also a way of drawing the complete figure once and copying the complete but empty background, then reinstating that and only plotting a new line on top of it. This is equally fast as the code above without any visual artifacts, but breaks if you resize the plot.

In conclusion, I am quite impressed with the flexibility of Matplotlib. Matplotlib by default values quality over performance. But if you really need the performance at some point, it is flexible and hackable enough to let you tweak it to your hearts content. Really, an amazing piece of technology!

EDIT: As it turns out, fig.canvas.blit(ax.bbox) is a bad idea since it leaks memory like crazy. What you should use instead is fig.canvas.update(), which is equally fast but does not leak memory.

Rashad Abdul-Salaam: Founder of Happy Health

Sam Solomon — Thu, 30 May 2013 03:00:00 GMT

Rashad Abdul-Salaam is the founder of Happy Health, a personal health record that helps patients save time and paperwork.

Better Figures & Images Plugin for Pelican

duncanlock.net — Thu, 30 May 2013 01:49:49 GMT

How Figures & Images work in Pelican, by default

By default Pelican does a great job with figures and images, thanks to built-in support in ReStructuredText [1][1] . Pelican will turn this rst input:

.. figure:: {static}/images/better-figures-images-plugin-for-pelican/dummy-200x200.png
    :align: right

    This is the caption of the figure.

    The legend consists of all elements after the caption. In this case, the legend consists of this paragraph.

into this HTML output:

<div class="figure align-right">
    <img alt="/static/images/dummy-200x200.png" src="/static/images/dummy-200x200.png" />
    <p class="caption">This is the caption of the figure.</p>
    <div class="legend">The legend consists of all elements after the caption. In this case, the legend consists of this paragraph</div>
</div>

Which, given this CSS:

/* Styles for Figures & Images */

img {
    border: 1px solid #bbb;
    border-radius: 3px;
    padding: 4px;
    float: left;
    margin: 1em 1em 1em 0;
    box-shadow: 4px 4px 4px 0px rgba(128, 128, 128, 0.5);
}
img.align-right {
    float: right;
    margin: 1em 0 1em 1em;
}

.figure {
    border: 1px solid #bbb;
    border-radius: 3px;
    padding: 4px;
    float: left;
    margin: 0 1em 1em 0;
    box-shadow: 4px 4px 4px 0px rgba(128, 128, 128, 0.5);
}
.figure.align-right {
    float: right;
    margin: 0 0 1em 1em;
}
.figure.align-left {
    float: left;
}
.figure img {
    border: none;
    border-radius: 0;
    padding: 0;
    margin: 0;
    box-shadow: none;

    float: left;
}
.figure p.caption {
    margin: 0;
    font-size: 80%;
    padding: 4px;
    float: left;
    text-align: left;
}
.figure div.legend {
    padding: 4px;
    font-size: 80%;
    color: #aaa;
    font-style: italic;

    float: left;
}

…will look something like this:

This is great, but it’s not quite what I wanted. I wanted the caption under the image and then the figure to shrink to fit the size of the image it contains. It turns out that this is impossible in HTML & CSS unless you give the browser an explicit width attribute for the img and the containing div.

If you actually do that, and add a style="width: 200px; height: auto;" attribute to both the div and the img, you get this - which is what I wanted:

This is the caption of the figure. The legend consists of all elements after the caption. In this

case, the legend consists of this paragraph. image::{static}/images/posts/better-figures-images-plugin-for-pelican/dummy-200x200.png[]

The problem with this, is that it means that you need to supply a width attribute containing the actual pixel width of the image, for each and every image you use. This would be very tedious to do by hand, so I wrote a Pelican plugin to do this, plus a couple of other related things, for me.

What the Better Figures & Images plugin does

Adds a style="width: ???px; height: auto;" attribute to any <img> tags in the content, by automatically checking the dimensions of the actual image file on disk and adding the appropriate attribute to the <img> tag.
Also finds any <div class="figures"> tags in the content which contain images - and adds the same style attribute to them.
If the RESPONSIVE_IMAGES setting is true, it adds style="width: ???px; max-width: 100%; height: auto;" instead.
Corrects Alt text: If an img alt attribute = the image filename, it sets it to “”
Inserts automatic figure numbers into figure captions, if FIGURE_NUMBERS == True in global config, or figure_numbers exists in article metadata.

Assuming that the image is 250px wide, it turns output like this:

<div class="figure">
    <img alt="/static/images/image.jpg" src="/static/images/better-figures-images-plugin-for-pelican/image.jpg" />
    <p class="caption">
        This is the caption of the figure.
    </p>
    <div class="legend">
        Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.
    </div>
</div>

into output like this:

<div class="figure" style="width: 250px; height: auto;">
    <img style="width: 250px; height: auto;" alt="" src="/static/images/image.jpg" />
    <p class="caption">
        This is the caption of the figure.
    </p>
    <div class="legend">
        Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.
    </div>
</div>

or this, if RESPONSIVE_IMAGES = True:

<div class="figure" style="width: 250px; max-width: 100%; height: auto;">
    <img style="width: 250px; max-width: 100%; height: auto;" alt="" src="/static/images/image.jpg" />
    <p class="caption">
        This is the caption of the figure.
    </p>
    <div class="legend">
        Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.
    </div>
</div>

or this, if FIGURE_NUMBERS is also True:

<div class="figure" style="width: 250px; max-width: 100%; height: auto;">
    <img style="width: 250px; max-width: 100%; height: auto;" alt="" src="/static/images/image.jpg" />
    <p class="caption">
        <span class="fig_num" id="fig_1">Figure 1: </span>This is the caption of the figure.
    </p>
    <div class="legend">
        Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod
        tempor incididunt ut labore et dolore magna aliqua.
    </div>
</div>

How to use the Plugin

This plugin is now upstream in the main pelican-plugins repository, you can check that out like this:

$ git clone git@github.com:getpelican/pelican-plugins.git

It requires BeautifulSoup and PIL/Pillow - see the readme for details on installing these.

Then add something like this to your pelican config:

# Where to look for plugins
PLUGIN_PATH = '../pelican-plugins'
# Which plugins to enable
PLUGINS = ['better_figures_and_images']

Optionally, enable the responsive stuff via the plugin, by adding this to your config:

# Setting for the better_figures_and_images plugin
RESPONSIVE_IMAGES = True

Or add something like this to your theme’s CSS:

img, div.figure { max-width: 100%; height: auto; }

You can enable automatic figure numbering, by adding this to your config:

# Setting for the better_figures_and_images plugin
FIGURE_NUMBERS = True

or, to enable this on a per post basis, add this into the posts metadata:

:figure_numbers: True

And that’s it - you should now have Better Figures & Images.

(Not Very) Frequently Asked Questions

What is the RESPONSIVE_IMAGES setting for?

This site uses a responsive layout - it changes its layout and column widths based on the size of the screen or window you use to view it. This means, ideally, that any images contained inside those columns would also shrink or expand to fit, when the column they’re in changes. If they don’t, the images will break out of the columns if the column becomes too narrow.

The simplest way to do this, would be to add something like this to your CSS:

img, div.figure { max-width: 100%; height: auto; }

This tells the browser that images can only ever be as wide as their container - i.e. 100% of the width of their parent element. This means that when the column that the image is in shrinks - and becomes smaller than the images native width - the image will be shrunk to fit inside.

Note that this isn’t the perfect solution and isn’t fully responsive - because there isn’t a perfect solution at the moment - this provides a simple solution that gets me 80% of what I wanted: shrink to fit images that expand up to their full width (but no further) and stay inside their containers.

Couldn’t you just…

Yes, you could just add that to your CSS and only have the plugin add the width: ???px part - this would work fine. If you want to do that, either don’t set RESPONSIVE_IMAGES in your pelican config, or set it to False.

So why is there a RESPONSIVE_IMAGES setting at all?

Um… It’s partially just there because this is the way I wrote the plugin initially, before I thought it through properly.

The reason I left it in, is twofold:

It means that you can get responsive images and figures just by using this plugin - no need to mess with your theme’s CSS if you don’t want to.
Because there are lots of other ways to fudge responsive images and I may decide to use one of the alternatives - and at some point, presumably an official standard way to do it will arrive. So I may want to do extra processing, add extra markup, or do other things to support future responsive image techniques here, so I left that hook in so that I could easily add it.

Why are you messing with the ALT text?

By default Pelican adds a default alt attribute to images that don’t have them - and sets it to the image’s filename.

This is well meaning, but wrong.

The alt attribute is meant to provide a textual alternative to the image, for people who can’t see the image, for some reason - they might be blind, using a screen reader, they might be using a text-only browser, they might be a search engine, the image might not have loaded for some reason, etc…

Imagine that you are reading your page to someone over the phone. What would be the appropriate thing to do when you reach the image? [2] What would you say about that image if you were describing the page over the phone to someone?

If you wouldn’t mention the image at all, then explicitly set the alt attribute to an empty string:

<img alt="" src="" ... />

Otherwise, set it to whatever you would have said over the phone.

Why not just leave it out? Because screen readers tend to read the filename for images that don’t have an alt attribute. This also means that you never need to set the alt attribute to the image filename - that’s already there in the src attribute, if needed.

Examples

Here are a few working examples, showing the results of using the plugin. The original rst source for these are available in the plugins /test folder:

Figure 1. This image is wider than the column it’s in - try resizing the browser window. Because of the max-width: 100%, the image is resized to fit the column.

Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.

Figure 2. This image is only 200px wide - smaller that the column it’s in. The max-width: 100% doesn’t stretch the image, because it’s also got a width: 200px - making it shrink to fit.

Figure 3. This is the third image caption. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.

Footnotes & References:

The two image directives: “image” and “figure” in reStructuredText: http://docutils.sourceforge.net/docs/ref/rst/directives.html#images ↩
Guidelines on ALT texts in IMG elements: http://www.cs.tut.fi/~jkorpela/html/alt.html http://www.456bereastreet.com/archive/200412/the_alt_and_title_attributes/ http://diveintoaccessibility.info/day_21_ignoring_spacer_images.html ↩

Postgres Indexes – Expression/Functional Indexing

CRAIG KERSTIENS — Wed, 29 May 2013 23:55:56 GMT

Postgres is rich with options for indexing. First you’ve got a variety of types, and beyond that you can do a variety of things with each of these such as create unique indexes, use conditions to index only a portion of your data, or create indexes based on complex expressions or functions. In cases where you commonly use various PostgreSQL functions in your application or reporting you can get some great gains from this.

Let’s take a look at a really simple case. Given a basic user table:

# \dt users
Table "public.users"
Column | Type | Modifiers
------------+-----------------------------+-----------
id | integer | not null
email | character varying(255) |
created_at | timestamp without time zone |

You may commonly want to run a report against it showing your signups by date. Let’s say you do this by running the query:

SELECT
count(*),
date_trunc('day', created_at)
FROM
users
GROUP BY
2;

If you’re commonly using date_trunc('day', created_at) for grouping, filtering, or projecting it out you can get some great gains by creating an index on this:

# CREATE INDEX idx_user_created ON users(date_trunc('day', created_at));

Of course you can go beyond the built in functions of Postgres and use more complicated functions you create yourself. For example if you have JSON stored within PostgreSQL, have PLV8 enabled, and want to create a Javascript function to parse and return the text for a given key:

# CREATE OR REPLACE FUNCTION
get_text(key text, data json)
RETURNS text $$
return data[key];
$$ LANGUAGE plv8 IMMUTABLE STRICT;

Of note in the above function is IMMUTABLE and STRICT. Immutable specifies that the function given the same inputs will return the same result. Strict means that if you send in NULL values you’ll get a null result.

Given some example data inside your JSON field:

{
"name": "Craig Kerstiens",
"location": "San Francisco",
"numbers": [
{
"type": "work",
"number": "123.456.7890"
},
{
"type": "home",
"number": "987.654.3210"
}
]
}

If you wanted to return just the name you could index on:

# CREATE INDEX idx_name ON users(get_text('name', json_data));

Or even combine with built ins for a case-insensitive version:

# CREATE INDEX idx_name ON users(lower(get_text('name', json_data)));

Indexes like all of the above can be useful when you’re filtering on something that postgres can take advantage of. In most cases any conditions with the exception of a LIKE beginning with a % work for this. With Postgres 9.2 even a count(*) in certain cases can take advantage of the index because of index only scans.

Whether you’re looking to take advantage of all the power of Javascript with JSON or another procedural langauge – or simply speed up a basic report using built in functions expression indexes can give you some great benefits.

Full Steam Ahead

Zac Szewczyk — Wed, 29 May 2013 23:36:33 GMT

Almost a week ago I did something I rarely do: I wrote an article out of frustration. I had pushed and pushed myself to not only write every day, but to publish something at least once a day as well. But some days, there just isn’t anything to write about; sometimes, I need more than a day to work through an idea; and some days, I just don’t feel like writing. Instead of a strong readership, I only had frustration to show for my efforts. Writer’s Guilt was me saying that I had had enough: I was finished prolonging this never-ending sprint, constantly pushing myself to make and publish work I was not proud of. Then I decided to shift gears, looking to a shift in focus to revitalize my writing. Almost a week later, I’m here to say it worked.

Permalink.

Nickelodeon's Experiment

Zac Szewczyk — Wed, 29 May 2013 22:53:46 GMT

The first time I saw the Nickelodeon cartoon Avatar: The Last Airbender, I was sitting in a friend’s closet. The floor was a mess, with clothes and toys strewn all about. It had rained almost constantly since morning, so the lot of us had stayed inside for most of the day. I was ten, and the show captivated me. That feeling stuck with me until roughly six years later when I sat down to watch the series from beginning to end. Even at sixteen, I still loved the show. Love the show, I should say — present tense, not past.

Permalink.

Jonathan Mann's Song a Day

Zac Szewczyk — Wed, 29 May 2013 22:33:07 GMT

Since January first, 2009, Jonathan Mann has written a song every day. Every single day, for four years, four months, and four weeks exactly, Jonathan Mann, without fail, wrote and produced a song. That’s 1609 days, and 1609 songs. Those who have a hard time writing every day, feel free to take notes.

Permalink.

Tumblr. + Yahoo! = !!

Zac Szewczyk — Wed, 29 May 2013 21:15:16 GMT

“But most importantly, what the hell does Yahoo do with all the porn?”

Ben Brooks asking the tough questions. I love everything he does, from his writing to The B&B Podcast, retired on February 7th of this year. If you haven’t ever read any of his work, this piece wouldn’t be a bad place to start.

Permalink.

We Have Only One Story

Zac Szewczyk — Wed, 29 May 2013 20:07:23 GMT

In the past I have heard it said that there exists but one story, that every book and movie is nothing more than retelling of that single plot. Perhaps most famously, John Steinbeck once said something to this effect in his book East of Eden:

Permalink.

Forcing Smart Scans on Exadata – is the _serial_direct_read parameter safe to use in production?

Tanel Poder Blog — Wed, 29 May 2013 15:38:14 GMT

One of the most common Exadata performance problems I see is that the direct path reads (and thus also Smart Scans) don’t sometimes kick in when running full scans in serial sessions. This is because in Oracle 11g onwards, the serial full segment scan IO path decision is done dynamically, at runtime, for every SQL execution – and for every segment (partition) separately. Whether you get a direct path read & smart scan, depends on the current buffer cache size, how big segment you’re about to scan and how much of that segment is actually cached at the moment. Note that the automatic IO path decision for index fast full scans is slightly different from table scans.

This dynamic decision unfortunately can cause unexpected surprises and variance in your report/batch job runtimes. Additionally, it looks like the SELECT part of your UPDATE/DELETE statements (the select part finds the rows to update/delete) does not ever automatically get direct path read/smart scan chosen – by design! So, when your SELECT statement may use smart scan and be really fast, the same select operation in an INSERT SELECT (or UPDATE/DELETE) context will not end up using smart scans by default. There’s even a bug explaining that – closed as “not a bug” (Exadata Smartscan Is Not Being Used On Insert As Select[Article ID 1348116.1]).

To work around these problems and force a direct path read/smart scan, you can either:

Run your query in parallel as parallel full segment scans will use direct path reads, unless your parallel_degree_policy = AUTO, then you may still get buffered reads thanks to the dynamic in-memory parallel execution decision of Oracle 11.2
Run your query in serial, but force the serial direct path reads by setting _serial_direct_read = TRUE (or ALWAYS in 11.2.0.2+)

Here are the valid options for this parameter in 11.2.0.2+

My Pelican Adventures, Powered by Dropbox

Graham Stevens – Grh.am — Wed, 29 May 2013 03:00:00 GMT

This is a legacy post referring to how this blog was originally setup, using Pelican and Dropbox. It no longer reflects the current state of affairs, which can be read about here.

This website is powered solely by the wonderful static blogging engine known as Pelican. A static blogging engine means that each time a change is made i.e. a new post is created, the entire site is rebuilt as static HTML & CSS pages. This may sound laborious, but does mean that everything is extremely simple once setup correctly. For example, my work flow is as follows:

Coherence checks in SOA

Separate Concerns — Wed, 29 May 2013 02:10:00 GMT

Recently I found a rare, ugly bug in a piece of software that had been in production at Moodstocks for 6 months. The bug itself is not that interesting, but the way I found and fixed it is.

Story of a bug

Imagine you have a database where you can index some documents in a full text search engine. Indexing can be turned on and off on a per document basis.

As the size of your dataset increases, you outgrow it and decide to use a separate service for search. So you change your code such that documents which must be indexed are sent to that service, and you add a boolean field in your main datastore to indicate whether the document is indexed or not.

All is fine until one day you refactor this code a bit too fast and part of the logic for document updates becomes something like this:

if document.indexed then
  search_engine:index(document)
  document.indexed = false -- <-- WAT?
end

Of course, in practice, it is less trivial and only happens in rare corner cases, so your tests don’t catch it…

This ain’t normal(ized)

This kind of bug in a system can be very nasty. What happens when it is triggered is that the worldviews of two subsystems (here the datastore and the index) are not coherent anymore.

If you are a programmer not used to distributed systems, you may think that the problem is that the information “the document is indexed” is duplicated. State is bad, but duplicate state is plain wrong, just always ask the index for that information and drop that “indexed” field!

In a normal application setting you would be right, but this is one of the main differences between SOA and OOP. There are two reasons why you do not want to do that. The first one is performance: this may generate more internal network requests. Its importance could be discussed at length (“Is it some form of premature optimization?”).

The second reason is much more important though: if you do that, your index becomes a data-critical service. That means you cannot lose its state without losing information, so you have to back it up seriously. This simple boolean field in the datastore is enough to rebuild the whole index, making it non-critical.

So that leaves us with denormalized data and its own problems. How do we mitigate them?

Invariants are sexy

Once you have denormalized data, your problem is to keep it coherent. That means that there are invariants that must be verified at all times by the various states of the subsystems. Or rather, because of asynchronous jobs, invariants that shouldn’t remain unverified for too long.

Those invariants are almost always properties on sets. For instance, if you have a forum where only registered users can comment, users who have commented must be a subset of users who have confirmed their email. In my case, the set of documents indexed in the search engine must be equal to the set of documents flagged as indexed in the main datastore.

The big idea is that every time you denormalize data you should write invariants that ensure coherence. These invariants are checked by scripts that can be run at every transaction in some cases, but are more usually cronned. You should also have procedures to reconcile (repair) the data in case of incoherence. I am not a huge fan of having them run automatically: incoherence often reveals bugs, so humans should check where it comes from and fix it.

In our case, the script responsible for coherence checks warned me that a few documents belonging to the same user were present in the search engine but not flagged as indexed. I asked the application logs what had happened to these documents around the time when the incoherence occurred, and saw they had all been updated. I looked up the relevant code path in application code… and facepalm-ed. I had pushed that code to production half a year ago, and it was obviously wrong.

Conclusion

The moral of it all is not, as I already discussed, that you should not denormalize data. It is not that we should write more tests, either. At least it is not what I want the takeaway to be (we do test these things more carefully now, but edge cases can always slip through).

What I think this story shows is that, if you write distributed systems that handle denormalized data, you should have:

something to check invariants to detect issues;
exhaustive logs and tools to diagnose them;
reconciliation scripts to fix them.

I cannot imagine releasing a distributed system that does not have those things. They are even more important than a comprehensive test suite to me. Moreover, the coherence checks can also be run in the test suite itself (on mocks for instance) so writing them is always a win-win.

You Have Five Seconds. Go.

Zac Szewczyk — Tue, 28 May 2013 19:53:33 GMT

Nearly every day I see a new CSS module, jQuery boilerplate, or HTML5 template posted to Hacker News, or an article announcing the release of the latest version of Ember.js, whatever that is. Every so often, I follow the link out of curiosity; and every time, I close the page, disappointed.

Permalink.

Some questions and suggestions to all commoners

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 28 May 2013 19:37:59 GMT

I’m just back from the 2013 Economics and Commons Conference in Berlin. A great event, in which I took lots of general notes synthesized in another post that I’ll publish tomorrow. This one, instead, contains just questions and suggestions from me that I already shared at the conference, or I’d like to share with everybody interested in Commons. A separate post contains my critique to certain arguments against copyright I heard at the same conference.

On copyright being useless because it's recent

Welcome to Marco Fioretti's website! on Stop at Zona-M — Tue, 28 May 2013 15:32:01 GMT

I just attended the 2013 Economics and Commons Conference in Berlin. During the Knowledge stream of that event something came up that has bothered me for a long time: the assertion that copyright is useless also because it’s just a few centuries old, and artists were doing just fine even before, thank you very much. Here is what I would have repeated, if there had been more time during those sessions.

I find this particular argument against copyright very, very weak, to say the least, and I’d really like to see it go, for at least three reasons:

B: An RC Driving Quadracopter

Zac Szewczyk — Mon, 27 May 2013 21:49:26 GMT

I wish I had $635 to spend on this.

Permalink.

Debugger Dangers – Part 2

Tanel Poder Blog — Mon, 27 May 2013 20:31:45 GMT

About 5 years ago I wrote about the risks that connecting to Oracle processes via debuggers may cause and what are (in my opinion) the safer and less safer options for taking stack samples from running Oracle processes.

In the end of that article I listed different options for getting a stack traces and whether they were safe or not.

For example, ORADEBUG-based process stack traces (DUMP ERRORSTACK, SHORT_STACK and event the process/system state dumps (at level 256 or higher) are not 100% safe – because they alter the execution path of the process they attached to. Your process may crash or get some error if you hit a bug (of course once you patch/fix the bug, you’ll be fine again – until you may hit the next bug).

An example bug is this:

Bug 15677306 : SUNBT6994922 ORACLE LOGWRITER HARD HANG WHEN SIGUSR INTERRUPTS LIBAIO

LGWR may hang when SIGUSR interrupts libaio (that’s what LGWR uses for asynchronous IO). And if LGWR is hung – your whole instance will be hung pretty soon. But what does the SIGUSR signal have to do with Oracle? Well, that’s exactly the signal what ORADEBUG sends to the process it has attached to, to notify it about some debug/dump work it needs to do. And apparently receiving or handling such a signal (jumping into some stack dump function), when being in libaio codepath causes an issue.

Talk @ EmWare: Getting started with Linux

Anmol Sarma — Mon, 27 May 2013 09:30:00 GMT

Gave an introductory talk on Linux, basically a rehash of the talk I gave at KLU a couple of years ago.

Converting SS-DB data into NetCDF format

Noah Watkins — Mon, 27 May 2013 03:00:00 GMT

Scientific data wants to be in sciency formats.

My SQL Bad Habits

CRAIG KERSTIENS — Sun, 26 May 2013 23:55:56 GMT

I’m reasonably proficient at SQL – a coworker when pseudocoding some logic for him pointed out that my pseudocode is what he thought was executable SQL. I’m fully capable of writing clear and readable SQL – which most SQL is not. Despite that I still have several bad habits when it comes to SQL. Without further adieu heres some of my dirty laundry so hopefully others can not make the same mistakes.

Order/Group by Column Numbers

When quickly iterating on a query its a lot less typing to put the column number as the thing you want to order by. Here’s a quick lightweight example:

SELECT
email,
created_at
FROM
users
ORDER BY 2 DESC
LIMIT 5;

This gives me my last 5 users that have signed up for my site. Of course as soon as I have this I may want to add some data to it, like their first name so I can send them a welcome email. I quickly alter the query to:

SELECT
email,
first_name,
created_at
FROM
users
ORDER BY 2 DESC
LIMIT 5;

And now I have 5 users that have signed up ordered by their first name. Sure its obvious when you have 1 column you’re ordering by, but when you have GROUP BY 1, 2, 3, 4, 5, 6 which is actually open in one of my tabs currently its a bit more confusing….

Though if you really want to have some fun, share a query with someone that looks something like this:

SELECT
email as "3",
first_name "2",
created_at "1"
FROM
users
ORDER BY "1", "3" DESC
LIMIT 5;

Implicit Joins

I seldom use the syntax INNER JOIN. Instead I simply put the two tables in my where clause and ensure I have a where condition. The problem with ensuring I have a where condition is sometimes I don’t, especially when you’re dealing with 3 tables.

SELECT
email,
product.name,
product.price
FROM
users,
orders,
items
WHERE users.id = orders.user_id
AND orders.id = items.order_id

Is less clear (especially when dealing with 5-6 tables) than the alternative:

SELECT
email,
product.name,
product.price
FROM users
INNER JOIN orders on users.id = orders.user_id
INNER JOIN items on orders.id = items.order_id

Lack of comments

I comment my SQL far less than I comment my code, yet it can be done just as easily. For example I have this in one of my queries:

SELECT convert_from(CAST(E'\\x' || array_to_string(ARRAY(
SELECT
CASE
WHEN length(r.m[1]) = 1
THEN encode(convert_to(r.m[1], 'SQL_ASCII'), 'hex')
ELSE substring(r.m[1] from 2 for 2)
END
FROM regexp_matches(url_here, '%[0-9a-f][0-9a-f]|.', 'gi') AS r(m)
), '') AS bytea), 'UTF8');

While this has its own issues theres no documentation around what this actually does, in contrast:

--- DECODES url ---
SELECT convert_from(CAST(E'\\x' || array_to_string(ARRAY(
SELECT
CASE
WHEN length(r.m[1]) = 1
THEN encode(convert_to(r.m[1], 'SQL_ASCII'), 'hex')
ELSE substring(r.m[1] from 2 for 2)
END
FROM regexp_matches(url_here, '%[0-9a-f][0-9a-f]|.', 'gi') AS r(m)
), '') AS bytea), 'UTF8');

Comments also work well inline at the end of a line.

Large Manually Generated Lists

A lot of times in working with some specific data set I’ll manually or automatically generate a list that I want to filter. A common example is filtering out staging/dev environments. I’ll often manually search and prune the list, then save that result for the queries I’m going to build going forward. This is a bit of effort but still feels reasonable the downside is it results in something like:

SELECT
foo
FROM
bar
WHERE
bar.id NOT IN (34723, 42735, 32321, 47205, 20375, 30261, 26194, 109371, 9313, 6351, 20184, 50273, 34735, 39854, 23954, 25323, 23405, 30528, 50182, 29340, 47659, ... and the list goes on)

SQL is meant to be reasonable for containing some level of logic. Data changes, hard coding keys is going to bite you at some point, spend the extra effort and re-use something thats clear.

What else

I’m sure theres plenty more; I suspect within a few minutes of sitting down with someone they could point out some other bad habits. While I know mine at least some of mine I still often know the trade-off. What are yours? I’d love to hear to document them for others so hopefully they can prevent developing the same bad habits. Let me know; craig.kerstiens@gmail.com

Game of Snails in all its barely-playable glory

Liza Shulyayeva — Sun, 26 May 2013 22:48:17 GMT

Well, it’s the end of the month and I have to post something for May. Despite Game of Snails being broken and nigh-unplayable, I’m posting it anyway. If you want to check it out, here are some disclaimers:

How I built running shoes for my whole family in one sunday afternoon (Huarache sandals)

Geeky Nuggets — Sun, 26 May 2013 22:17:07 GMT

Some time ago, Diego Santamarta casually mentioned that the shoes he was wearing were not regular flip flops, but rather some kind of sandal which I had never heard about. “Oh ok” was my less than enthusiastic answer. In the meantime, and even before, I had been reading about barefoot running, even though I had never run more than a few hundred meters without panting uncontrollably. Yes, 15 years smoking does take it’s toll. After two years tobacco free, I feel I’m only now starting to recover.

Anyway, I had dismissed barefoot running as something that I would love to do — and probably the only way that I would ever run for pleasure — but that seemed very uncomfortable bordering on dangerous. Two days ago, that same Diego Santamarta posts to facebook a link about those sandals as used by barefoot runners to protect their feet on difficult terrain.

Documentation and materials

I almost immediately started reading about them, watching youtube videos or instructables explaining how to build them. I had an old tire in the growing “to throw away” pile which I never get around to bringing to the recycling center, so that was the main part of the material sorted. I also have some polypropylene cord (the blue one used to tie straw bales and some black one) which could be used as laces. As will be seen later this is not comfortable nor durable so I used some more elaborate string for the laces.

Trace your foot on paper and locate the holes as indicated in one of these guides.

Cutting the sole

Now the real work begins. We will need to hack at that tire, and it truly is tiresome work. I had some tin snips on hand which I thought would be perfect for the job. They are in fact totally useless. I did the job with a hacksaw to cut through the metal ring where the tire meets the wheel, and then one of my trusty Opinels to cut through the reinforced rubber outwall. If the knife is kept sharp, this is actually fairly easy work.

I cut some rough pieces from the outerwall, one from each side of the tire to match the curvature of the outerwall to the natural curve of each foot.

You then trace the outline of your paper pattern on the pieces you just cut, enabling you to have perfect tire soles for your huarache sandals.

I then used a small drill bit, around 5mm to drill the holes.

Putting the laces in places

The are many lacing systems that can be used, the one I used seemed simple enough, and can be slipped on and off easily.

To pull the string through the holes, I used a piece of bent wire as a threader, and pliers to pull on it if need be. A figure of 8 knot locks the string in the toe hole. the string then goes throught the outer hole, around the heel, through the inner whole, and ties around the front part of the lace

Here is the result: my son’s sandals. He complained that they were not very comfortable though, so I changed the cord (which was too thin) and used a thicker braided one I had around, which is much more comfortable.

Once everyone had their sandals ready, I decided to go for a short run to try them out

Running

Please keep in mind that I was a heavy smoker for many years, have never run unless obligated to, and never more than a few hundred meters.

The first segment was downhill, and I had to readjust the shoes almost immediately, for the only time in the entire run.

When I arrived at the first uphill segment I got out of breath quickly and decide to alternate running and fast walking for the rest of the outing. That worked out pretty good, and the running actually felt easier and easier. The shoes are superb. They are pretty comfortable, provide just the right amount of protection to avoid having to look out for every little piece of gravel and can be used to cross streams without fear of them becoming slippery.

My calves started hurting at around the ten minute mark, I think from landing on the front portion of the feet. It only got worse from then on, and now I can barely walk, it feels like I have a continuous cramp in these muscles. The feet are in perfect condition though, I just feel that they have had a good workout.

Can’t wait to go out tomorrow for more!

Simple backups with `Obnam`

Ecce Homology on Bastian Grossenbacher Rieck's personal homepage — Sun, 26 May 2013 15:14:41 GMT

For a long time, rdiff-backup has been my preferred backup solution. Recently, however, I started looking for an alternative because its performance simply was not up to par any more–it took over 20 minutes to process my home directory although less than 1 MiB of files had changed.

Luckily, I stumbled over Obnam. Joey Hess already adopted it as an additional backup solution, so I figured I could give it a try as well. And I was pleasantly surprised: Configuration is very easy, the backup is sufficiently fast, there’s support for GPG-based encryption, and it offers deduplication. What’s not to love?

So, my current backup setup for my laptop has a central .obnam.conf configuration file with the following content:

[config]

repository = sftp://example/home/example/backup.hostname.example.com

exclude = \.o$, \.tmp$, /Trash/, ...

Of course, the exclude list is a tad longer in reality. This is the only tedious thing about Obnam: All excluded files and directories have to be specified as a regular expression in a single line. I have several folders I do not wish to be transferred, such as caches, downloads, temporary storage, and the like. For each of these folders, I either added a /foldername/ or the full path to the exclude line so that Obnam does not include for regular backups. Here are some recommendations for stuff to exclude:

\.o$
$HOME/.cache
$HOME/.thumbnails
/build/
/Downloads/
/Trash/
A variety of auxiliary files for LaTeX sources, temporary backup files for editors, and so on

With a sufficient exclusion list, I was now able to do backups quite comfortably using obnam backup $HOME. But there’s more: Since the backup usually does not take very long, I decided to let it run automatically. I created a small shell script for this:

#!/bin/sh

notify-send "Starting obnam backup..."

obnam backup $HOME 

if [ "$?" -ne 0 ]; then
  notify-send "Unable to finish obnam backup."
  exit 1
else
  notify-send "Finished obnam backup."
fi

notify-send is a nice little program that allows scripts to send notifications to a window manager. Both awesome and GNOME 3 show small notification bubbles for a small period of time. Finally, I added an entry to my personal crontab, instructing Obnam to run every day at 8 o’clock in the evening:

0 20 * * * DISPLAY=:0 /home/example/backup

Note that the DISPLAY=:0 variable is required so that the notifications of the script are shown. For systems that are only powered on sporadically, it might also make sense to create a configuration for anacron. So far, the normal cron variant served me well, though.

If you want to use the script yourself, you might want to incorporate a more powerful logging and notification capability in case Obnam does not complete its run. For my own use (and for now), I am content with checking the backup generations created by Obnam using obnam generations every once in a while.

Lithium revisited: A 16-bit kernel (well, sort of) written in Clojure (well, sort of)

code · words · emotions: Daniel Janus’s blog — Sun, 26 May 2013 03:00:00 GMT

Remember Lithium? The x86 assembler written in Clojure, and a simple stripes effect written in it? Well, here’s another take on that effect:

And here is the source code:

(do (init-graph)
    (loop [x 0 y 0]
      (put-pixel x y (let [z (mod (+ (- 319 x) y) 32)]
                       (if (< z 16) (+ 16 z) (+ 16 (- 31 z)))))
      (if (= y 200)
        nil
        (if (= x 319)
          (recur 0 (inc y))
          (recur (inc x) y)))))

I’ve implemented this several months ago, pushed it to Github and development has pretty much stalled since then. And after seeing this recent post on HN today, I’ve decided to give Lithium a little more publicity, in the hope that it will provide a boost of motivation to me. Because what we have here is pretty similar to Rustboot: it’s a 16-bit kernel written in Clojure.

Well, sort of.

After writing a basic assembler capable of building bare binaries of simple x86 real-mode programs, I’ve decided to make it a building block of a larger entity. So I’ve embarked on a project to implement a compiler for a toy Lisp-like language following the paper “An Incremental Approach to Compiler Construction”, doing it in Clojure and making the implemented language similar to Clojure rather than to Scheme.

(Whether it actually can be called Clojure is debatable. It’s unclear what the definition of Clojure the language is. Is running on JVM a part of what makes Clojure Clojure? Or running on any host platform? Is ClojureScript Clojure? What about ClojureCLR, or clojure-py?)

So far I’ve only gotten to step 7 of 24 or so, but that’s already enough to have a working loop/recur implementation, and it was trivial to throw in some graphical mode 13h primitives to be able to implement this effect.

By default I’m running Lithium programs as DOS .COM binaries under DOSBox, but technically, the code doesn’t depend on DOS in any way (it doesn’t ever invoke interrupt 21h) and so it can be combined with a simple bootloader into a kernel runnable on the bare metal.

The obligatory HOWTO on reproducing the effect: install DOSBox and Leiningen, checkout [the code][3], launch a REPL with lein repl, execute the following forms, and enjoy the slowness with which individual pixels are painted:

(require 'lithium.compiler)
(in-ns 'lithium.compiler)
(run! (compile-program "/path/to/lithium/examples/stripes-grey.clj"))

Text editor UI

Honza Pokorný — Sat, 25 May 2013 03:30:00 GMT

What I don’t understand is: why should you ever care how your editor looks, unless you’re trying to win a screenshot competition? The primary factor in looking good should be the choice of a good font at a comfortable size, and a syntax coloring theme that you like. And that is not something specific to an editor. Editors like Emacs and vi have almost no UI! If Emacs is configured right, the only UI it has is the modeline and the minibuffer.

Vivek Haldar in New Frontiers In Text Editing

List Exadata Storage Cell disk summary with cellpd.sql and cellpdx.sql scripts

Tanel Poder Blog — Fri, 24 May 2013 23:05:50 GMT

In the previous post I explained how to list Exadata disk layout and topology details with the exadisktopo scripts, in this post I’ll introduce one celldisk overview script, which I use to quickly see the celldisk configuration, specs and error statuses. The cellpd.sql script (Cell Physical Disk) will show the following output:

SQL> @exadata/cellpd.sql
Show Exadata cell versions from V$CELL_CONFIG....

DISKTYPE             CELLNAME             STATUS                 TOTAL_GB     AVG_GB  NUM_DISKS   PREDFAIL   POORPERF WTCACHEPROB   PEERFAIL   CRITICAL
-------------------- -------------------- -------------------- ---------- ---------- ---------- ---------- ---------- ----------- ---------- ----------
FlashDisk            192.168.12.3         normal                      183         23          8
FlashDisk            192.168.12.3         not present                 183         23          8                     3
FlashDisk            192.168.12.4         normal                      366         23         16
FlashDisk            192.168.12.5         normal                      366         23         16
HardDisk             192.168.12.3         normal                    22352       1863         12
HardDisk             192.168.12.4         normal                    22352       1863         12
HardDisk             192.168.12.5         normal                    22352       1863         12

Above you see that some of my Flash Disks are missing and before they went completely missing (because the Oracle Ninja removed them :) these disks indicated the “poor performance” status.

The cellpdx.sql script will display extended info for each celldisk, including disk model, firmware version, serial number and various error metrics. Warning, lots of wide output coming again:

List Exadata Disk Layout and Topology with the exadisktopo scripts

Tanel Poder Blog — Fri, 24 May 2013 22:42:29 GMT

Here are two more Exadata scripts for listing the end-to-end ASM<->Exadata disk topology from V$ASM_ views and from V$CELL_CONFIG. These scripts see both the ASM level layout and the storage cell-level disk topology.

The exadisktopo.sql script shows all disks starting from the ASM diskgroup layer, going deeper and deeper all the way to the OS disk device level in the storage cells. It uses outer joins, so will show celldisks even if there are no corresponding grid disks allocated on them (or if there are no ASM disks using them). It also shows the Flash cards used as flash cache, thus there are no ASM disks on them usually.

The output should be self-explanatory, you just read the data from left to right (from ASM diskgroup to ASM disk to Grid Disk level etc), the more rightwards you scroll, the “deeper” you go in the Exadata IO stack layers. Warning, lots of wide output coming :)

Shifting Gears

Zac Szewczyk — Fri, 24 May 2013 00:13:07 GMT

When I wrote Writer’s Guilt a few hours ago, I was done. I was drained. I was finished, and I was mad. Nevertheless, for an article written in anger, it turned out to be pretty good. As I walked downstairs after publishing it, I couldn’t help but feel just a little proud. Then I had a banana, an orange, sat down on the couch, and watched The Fast and The Furious: Tokyo Drift for the first time in much too long. I had forgotten how great a movie it is — I had forgotten how great the entire series is, really. But after Tokyo Drift ended, as the last scene faded from the screen and the credits began to roll, I remembered. I remembered how much I love the series; I remembered how much I love movies.

Permalink.

V$CELL_THREAD_HISTORY – “ASH” for Exadata Storage Cells

Tanel Poder Blog — Thu, 23 May 2013 23:57:33 GMT

Did you know that there’s something like Active Session History also in the Exadata storage cells? ;-)

The V$CELL_THREAD_HISTORY view is somewhat like V$ACTIVE_SESSION_HISTORY, but it’s measuring thread activity in the Exadata Storage Cells:

SQL> @desc v$cell_thread_history
           Name                            Null?    Type
           ------------------------------- -------- ----------------------------
    1      CELL_NAME                                VARCHAR2(1024)
    2      SNAPSHOT_ID                              NUMBER
    3      SNAPSHOT_TIME                            DATE
    4      THREAD_ID                                NUMBER
    5      JOB_TYPE                                 VARCHAR2(32)
    6      WAIT_STATE                               VARCHAR2(32)
    7      WAIT_OBJECT_NAME                         VARCHAR2(32)
    8      SQL_ID                                   VARCHAR2(13)
    9      DATABASE_ID                              NUMBER
   10      INSTANCE_ID                              NUMBER
   11      SESSION_ID                               NUMBER
   12      SESSION_SERIAL_NUM                       NUMBER

It keeps about 10 minutes worth of samples of Exadata Storage Cell thread activity:

SQL> @minmax snapshot_time v$cell_thread_history
Show min/max (low/high) values in column "snapshot_time" of table v$cell_thread_history...

MIN(SNAPSHOT_TIME MAX(SNAPSHOT_TIME
----------------- -----------------
20130419 14:42:15 20130419 14:52:54

Note that it’s not the V$ view or the database instance which stores this array – it’s the storage cells themselves. If you query the v$cell_thread_history view, your Oracle database session is going to “gather” this instrumentation data from all the required cells and present it to you, that’s why the “cell statistics gather” wait event shows up:

PARSING IN CURSOR #140596385017248 len=42 dep=0 uid=0 oct=3 lid=0 tim=1366404896817011 hv=4063158547 ad='19e452578' sqlid='63awy1gg
t2xs8m'
select count(*) from v$cell_thread_history
END OF STMT
PARSE #140596385017248:c=0,e=115,p=0,cr=0,cu=0,mis=0,r=0,dep=0,og=1,plh=4272803188,tim=1366404896817010
EXEC #140596385017248:c=0,e=27,p=0,cr=0,cu=0,mis=0,r=0,dep=0,og=1,plh=4272803188,tim=1366404896817127
WAIT #140596385017248: nam='SQL*Net message to client' ela= 1 driver id=1413697536 #bytes=1 p3=0 obj#=40 tim=1366404896817152
WAIT #140596385017248: nam='cell statistics gather' ela= 283 cellhash#=0 p2=0 p3=0 obj#=40 tim=1366404896818846
WAIT #140596385017248: nam='cell statistics gather' ela= 352 cellhash#=0 p2=0 p3=0 obj#=40 tim=1366404896819317
WAIT #140596385017248: nam='cell statistics gather' ela= 376 cellhash#=0 p2=0 p3=0 obj#=40 tim=1366404896820929
WAIT #140596385017248: nam='cell statistics gather' ela= 326 cellhash#=0 p2=0 p3=0 obj#=40 tim=1366404896822198
WAIT #140596385017248: nam='cell statistics gather' ela= 580 cellhash#=0 p2=0 p3=0 obj#=40 tim=1366404896823620
...

Now, how frequently do the cells sample their “ASH” data:

SQL> SELECT DISTINCT (snapshot_time - LAG(snapshot_time) 
                      OVER (ORDER BY snapshot_time)) * 86400 lag_seconds
     FROM (SELECT distinct snapshot_time 
           FROM v$cell_thread_history WHERE cell_name = '192.168.12.3');

LAG_SECONDS
-----------

          1

Looks like the sampling is done exactly once per second!

So, great, what can we do with this data?

Here’s an Exadata performance script (cth.sql) which uses V$CELL_THREAD_HISTORY to dig into cell activity from the database layer.

Writer's Guilt

Zac Szewczyk — Thu, 23 May 2013 20:53:28 GMT

Some days, I want to write. Other days, I don’t. Today is one of the latter, and yet I still wrote this. Why?

Permalink.

A traumatic [read: wimpy] experience

Liza Shulyayeva — Thu, 23 May 2013 08:50:14 GMT

This Monday I went to the doctor about my leg pain. She ruled out a stress fracture and said it was most likely a calf strain, but that the pain I describe could also point to deep vein thrombosis.

iTextEditors

Zac Szewczyk — Wed, 22 May 2013 14:14:58 GMT

Speaking of iOS text editors, Brett Terpstra created an amazing chart comparing more iOS text editors than anyone could possibly use in a lifetime. This list went around the internet a few months ago, but it certainly merits linking to again. To anyone searching for a new editor, start here.

Permalink.

A Broken Spacebar and my iPad

Zac Szewczyk — Wed, 22 May 2013 14:07:39 GMT

I used to write almost exclusively on my computer. Then, my spacebar started going bad sometime around November of last year, inconveniently just before I launched this blog. Especially problematic given how much and how often I like to write, I nevertheless decided not to fix it: right around that time the flame war around the iPad as solely a content consumption versus a multi-faceted creation device was raging across the internet, and I wanted to decide what I would use my own iPad for myself.

Permalink.

Digital preservation and economic faults

Noah Watkins — Wed, 22 May 2013 03:00:00 GMT

Archiving information on paper still has a lot of value.

Google plus adoption

Honza Pokorný — Tue, 21 May 2013 20:20:00 GMT

Google+ has been the target of numerous jokes in the tech community. Many blogs claim that adoption has been minimal and that the product isn’t appealing to common users over alternatives such as Facebook.

I have noticed quite the opposite is true. Many of my extended family in the Czech Republic have somewhat recently acquired new Android devices. One by one, they have added me to their circles on Google+. My stream is now full of pictures that my parents, aunts and uncles took with their phones. Google uploads those pictures as soon as you take them and reminds you to share them. This interface is so simple that even the average joe can share their content online.

The way I see it, Google is doing something right.

Powerful Bloggers

Zac Szewczyk — Tue, 21 May 2013 19:47:50 GMT

Quite some time ago I came across a very interesting statement in the most unlikely of places, in a “tips and tricks” piece sensationally titled 10 Rare But Simple Blog Tricks that Make You Look Like a Genius, where the author writes:

Permalink.

Low-End Apple Bloggers

Zac Szewczyk — Tue, 21 May 2013 19:31:00 GMT

On January 18th Horace Dediu made two observations and posted them to Twitter. Shortly after those tweets went live, I began constructing a short article around them. Either unable or simply unwilling to finish the article though, the beginnings of this piece have remained in Simplenote since then. Now, with my Instapaper queue finally completely empty for the first time since I bought the app, I finally have the time and — more importantly — available attention to begin working through my back catalog of half-baked articles, the first of which is this one about Apple bloggers.

Permalink.

Securing your server with fail2ban and a proper SSH-configuration

zufallsheld — Tue, 21 May 2013 17:09:00 GMT

When I initially set up my server for this blog and my small photography-website I didn’t really think about securing it against attacks. But one day I looked into the “secure”-logfile of my server and was greeted with this:

Apr 24 04:38:23 vps9533 sshd[21882]: pam_unix …

Champion Pythonista

Nicola Iarocci — Tue, 21 May 2013 03:00:00 GMT

La Open Source Report Card è un’iniziativa divertente. E’ difficile resistere al richiamo dell’ego… soprattutto quand’è smisurato.

Nicola is a champion Pythonista (one of the top 11% most active Python users) who loves pushing code. Nicola is a nine-to-fiver who seems to work best in the mid-afternoon.

The Jolla Phone

Zac Szewczyk — Tue, 21 May 2013 00:23:51 GMT

“This is almost exactly what I imagined the Nintendo phone would look like”, I thought when I came across the Jolla phone this morning in a Tech Crunch article. The same principles that inspired my “8-Bit Nintendo Phone” appeared to have driven the creators of the Jolla phone to design a product innovative in both its hardware and software alike. Unfortunately, this phone will not come to America for quite some time; however, based on the information available at the company’s home page, I formulated a few admittedly premature thoughts on this topic.

Permalink.

Recruit this

Sam says you should read this — Mon, 20 May 2013 20:13:04 GMT

I have a problem with recruiters. Shocking, I know. If you ask around developers, recruiters quite often seem to be right near the top of the list for "things which tech would be far better without".

If you're a recruiter reading this, then please don't skip straight to posting angry diatribes in the comment section - I'm happy to explain where my problem comes from, and maybe even how to fix it. If you're not a recruiter, but have run into some of the same problems, then maybe you might even want to confirm that I'm not alone here.

Let's start with a short anecdote. I was recently contacted b…

Yahoo to Acquire Tumblr

Zac Szewczyk — Mon, 20 May 2013 11:46:47 GMT

“Per the agreement and our promise not to screw it up, Tumblr will be independently operated as a separate business. David Karp will remain CEO. The product, service and brand will continue to be defined and developed separately with the same Tumblr irreverence, wit, and commitment to empower creators.”

A lot of people have written about this announcement. They started when rumors of the acquisition began gaining significant traction yesterday and haven’t stopped since. For all the long-winded articles explaining how this deal undoubtedly spells the end of Tumblr and the hissy fits of those lashing out as if anyone cares to listen though, Myke Hurley put it best in a tweet from yesterday evening:

“I think it’s fair to say Marissa Mayer is giving us exactly what we hoped.

She is building an exciting Yahoo!”

Yahoo! under Marissa Mayer has been doing a lot of interesting things lately. She really has built an exciting Yahoo!, and one that I look forward to seeing many great things come from in the coming months and years.

Permalink.

logdog - a colorized Android logcat

zserge's blog — Mon, 20 May 2013 03:00:00 GMT

Sometimes I do Android development. I never liked using debuggers, neither I use IDE. So my choice is to write Android apps with Vim+Terminal. With the lack of debugger I have to use logcat frequently, and using plain adb logcat (even with grepping output) is far from being pleasant. Then I found there are nicer alternatives, like coloredlogcat or proclogcat. I tried them, but they lacked other output formats, like “time”.

💡 Idea: A Placeholder for Topics I Want to Write About

Jayson Salazar Rodriguez | @jdsalaro | Blog — Mon, 20 May 2013 03:00:00 GMT

This is a simplistic and implicit backlog to which I can link from other places. This makes it easier to remember what I want or wanted to write about as well as programmatically generate a listing.

Understand How It Works

Martin Rue — Mon, 20 May 2013 02:00:00 GMT

One of the best pieces of advice I ever got was from my grandfather. He didn't visit very often and so conversation often felt a bit like an ice breaker.

A Game of Snails and Heroku

Liza Shulyayeva — Sun, 19 May 2013 22:26:14 GMT

A Game of Snails is nowhere close to being complete or even really playable, but I’ve decided to get as much of it done as I can before the end of May and then just put it online - regardless of completion or bugs. There are no rules to One Game a Month, after all, and I can then continue to work on a more complete release for the month of June. Or, if I feel like a break from snails, make some other quick game in the meantime and let it rest until I want to work on it again.

When the Muse Strikes Me, He Hits Hard

Zac Szewczyk — Sun, 19 May 2013 16:14:57 GMT

I try to post something every day. Most days I accomplish this goal, while occasionally I go an entire week without a single post. Most of the updates I publish are links to the works of others, something insightful, funny, or interesting I found while plowing through my Instapaper queue. Occasionally though, every once in a while, the proverbial muse, making his rounds, comes around and hits me especially hard. After a few hours of heads-down writing, I emerge with a couple link posts and a few actual articles tucked under my arm, ready to post. And then the cycle repeats itself: I spend another week or two forcing myself to read and eventually write something dull until, once again, I feel the inspiration to actually write a real article.

Permalink.

Google App Engine Endpoints (REST services), with Java, Maven & Intellij (Part 1)

Jonathan Jones homepage: planetjones.net — Sun, 19 May 2013 03:00:00 GMT

Google’s App Engine now provides Endpoints, which offer a simple way to create RESTful services for clients. Here a simple Endpoint is created using the Java API, Maven and Intellij.

Eventful First Sunday in San Francisco

Salvatore's Blog — Sun, 19 May 2013 03:00:00 GMT

Good Morning

Having gone to bed early, David and I get up with no problem and head on down towards Market Street around 8:15AM. Google Maps informs us that our BART (Bay Area Rapid Transit) train will arrive at 8:29AM and will whisk us over to Akeem’s place where we’ll meet up with some other people before heading over to a parade. I took a good long glance at the map, and then cleared my phone away as we descend the escalator steps to the train platform. At 8:29AM, a train arrives that we think is our train and with inadequate time to verify, we hustle and get on the train. After a minute and a half of tracing our fingers over the color-coded map and mumbling to ourselves, we come to the correct conclusion that this is indeed our train and realize that the old couple a few yards away who went unnoticed probably think we are crazy. It didn’t matter because we were victorious.

Parade

After everyone arrived at Akeem’s apartment, we grab a Lyft to Alamo Square to watch the Bay to Breakers “race”.

The Parade

While I’m positive that the first people to run in this event do indeed treat it as a foot race, the remaining 99.9% of people are clearly not in a hurry. Everyone was wearing costumes with a San Francisco spectrum of ideas: there were people in Victorian Era outfits, a guy dressed as though he was in a hot air balloon, Teenage Mutant Ninja Turtles, naked dudes, a surprisingly large number of lifeguards, pirates, sharks, Cards Against Humanity, Ghost Busters, and many cross dressing variations on childhood TV shows.

We camped out on that hill in the background.

There is something strange in this neighborhood.

Rag-tag band

Some cross between clever and creepy

“I’m sorry sir, I can’t let you through here without the proper amount of party.”

Hey, hey, the gangs all here.

Food and the Park

We hit up this super-tasty sandwich shop called Ike’s Place (no relation to a Mike, unfortunately). I got a sandwich called “Name of Girl I’m Dating”, and it was fantastic. We got out of Ike’s just as half of the city decided to show up, and we headed to Dolores Park to enjoy our lunches and hung out for a while.

SF MOMA

My friend Nathan joined the group at the park a bit after lunch, and he, my roommate David headed over to check out The San Francisco Museum of Modern Art before it closed for two and a half years. I believe this is a picture of the first time David used public transit in San Francisco.

At this point I realized candid photos weren’t easy/cool. Unlike the way Nathan dresses. Nathan is always cool.

The scrolls were pretty sweet and would make quite the discussion piece for anyone’s living room.

If you look really close, you can see the eagle.

Fortunately, SF MOMA had restroom facilities in the middle of a gallery.

And thus concluded my first full day in San Francisco for the summer.

How I built this website, using Pelican: Part 1 - Setup

duncanlock.net — Fri, 17 May 2013 20:08:27 GMT

As I mentioned previously, this site was put together using Pelican - a static site generator, written in Python.

Figure 1. Pelecanus Occidentalis - the Brown Pelican. Original clipart Flying Pelican from OpenClipart, by molumen, Public Domain. More on Pelican, the bird.

Static site generators take your content, pour it into your templates and output the result as static pre-generated HTML, CSS, JS & image files. You can then just upload the resulting folder of output to your server and you’re done. All you need on the server is a web server of some sort, like Apache or Nginx - anything really - all it’s doing is serving static pages.

The huge advantage of this setup is simplicity:

You can write your content in Markdown [1], reStructuredText [2] or AsciiDoc [3] - all simple text formats, designed to facilitate writing and get out of your way. You can use whichever writing tool you prefer [4], as long as it can output plain text files.
Whenever you make changes, Pelican can automatically regenerate the site, so you can see your changes immediately.
When you’re done, Pelican can automatically upload the site to your web server, or you can do it, just by uploading a folder.
The web server generally requires no setup - all you need is a web server that can serve static content (which is all of them) - no extra software or configuration; no PHP, no database, no nothing - much less to go wrong.
Because you’ve only got one thing running on the server, you have much less exposure to security problems - no WordPress, no PHP - just the OS & the web server.
Because the server is only serving pre-generated static content, a Pelican site is very lightweight, using very few server resources.

NB: This tutorial is quite long. I go into detail, explain things and try to take you from zero to a complete, fully functional website, built the way a professional web developer would do it. If you just want a really quick Pelican jump start, try here: http://docs.getpelican.com/en/latest/getting_started.html

Installation & Basic Setup

I’m using Linux (Xubuntu), but doing this on Windows or Mac is quite similar - you’ll need the same things installed, but the details of installing them will be different. Installing python-dev and python packages that want to build C extensions on Windows… won’t work - I suggest you give ActiveState’s Binary Package manager a try if you’re on Windows.

Where I use duncanlock in the examples below, you should use your site name instead.

Install

Pelican uses Python, so you’ll need that installed. If you’re on Mac or Linux, you’ll already have this, but you’ll probably need to install it on Windows. Pelican supports Python 2.7.x or 3.3+, so use whichever you prefer. I’m doing this using Python 2.7.3, but I think everything should be the same on 3.x, although I haven’t tried it.

First, I’m going to install pip [5], virtualenv [6] and virtualenvwrapper [7]. These tools make working on python projects much, much easier. Later, we’re going to install some python packages that will attempt to build their C extensions during install, so we also need python-dev:

$ sudo apt-get install python-pip python-virtualenv virtualenvwrapper
$ sudo apt-get install python-dev

Next, I’m going to tell virtualenvwrapper where I want it to put stuff, by adding this to my ~/.bashrc file:

# virtualenvwrapper config
export PROJECT_HOME=~/dev
export WORKON_HOME=~/dev/virtualenvs

Now close and re-open your terminal. This will trigger a one-time setup for virtualenvwrapper. Then run:

$ mkproject duncanlock.net-pelican

which should do something like this:

New python executable in duncanlock.net-pelican/bin/python
Installing distribute.........done.
Installing pip...............done.
virtualenvwrapper.user_scripts creating
[...]
Creating /home/duncan/dev/duncanlock.net-pelican
Setting project for duncanlock.net-pelican to /home/duncan/dev/duncanlock.net-pelican

You will now have a self-contained python virtual environment installed in ~/dev/virtualenvs/duncanlock.net-pelican and a new folder in ~/dev/duncanlock.net-pelican, to put your project files in. Your command prompt will change while this virtualenv is active - gaining a (duncanlock.net-pelican) at the beginning, so you know which virtualenv you’re in.

Next, we’re going to install Pelican and it’s dependencies into our virtual environment:

$ pip install pelican

This should install the following things for you:

feedgenerator: to generate the Atom feeds
jinja2: for templating support
pygments: for syntax highlighting
docutils: for supporting reStructuredText as an input format
pytz: for timezone definitions
blinker: an object-to-object and broadcast signaling system
unidecode: for ASCII transliterations of Unicode text

It should print out a load of progress stuff and eventually finish by saying:

Successfully installed pelican feedgenerator jinja2 pygments docutils pytz blinker unidecode six
Cleaning up...

Double check it worked by running pelican --version - currently this should print out 3.2.0 - then run pip freeze - which prints out a list of the python modules installed in your current virtualenv.

Now we’ll install some extra python modules to support bonus functionality provided by some Pelican plugins that we’ll be using later:

$ pip install Pillow beautifulsoup4 cssmin cssprefixer cssutils pretty six smartypants typogrify webassets

Again, as far as I know PIL/Pillow is hard to install on Windows - use the ActiveState Package Manager. Once this is done, run this to get pip to make a list of all the things you’ve got installed in this virtualenv:

$ pip freeze > requirements.txt

Which should create a text file containing something like this:

Jinja2==2.6
Pygments==1.6
Unidecode==0.04.12
argparse==1.2.1
blinker==1.2
docutils==0.10
feedgenerator==1.5
pelican==3.2
pytz==2013b
six==1.3.0
wsgiref==0.1.2

This allows you to re-install everything in one go if you move machines, just by running pip install -r requirements.txt – or to check for & install updates to all the modules at once, just by running pip install --upgrade -r requirements.txt, amongst other things. We’re also going to check this lot into git later and this allows you to keep the list of requirements under version control too, which is nice.

Pelican Quick Start

Now that we’ve got everything installed, run this to create a basic skeleton site for you to modify:

$ pelican-quickstart

This will ask you some questions and generate a skeleton site, that matches your answers:

Welcome to pelican-quickstart v3.2.0.

This script will help you create a new Pelican-based website.

Please answer the following questions so this script can generate the files needed by Pelican.

Using project associated with current virtual environment. Will save to:
/home/duncan/dev/duncanlock.net-pelican

you can accept the defaults by pressing enter for most of these questions, except these:

> What will be the title of this web site?
duncanlock.net
> Who will be the author of this web site?
Duncan Lock

If you wanted to use the built-in Pelican webserver for development, you could say ‘No’ and skip this next bit, but we’re going to configure a local virtualhost and use Apache to serve the site for development, so we’re going to do this instead:

> Do you want to specify a URL prefix? e.g., http://example.com (Y/n) y
> What is your URL prefix? (see above example; no trailing slash) http://duncanlock.test
[...]
Done. Your new project is available at /home/duncan/dev/duncanlock.net-pelican

Now you can generate the quick-start site and see what it looks like:

$ make html

This should create an output folder with the contents of a website in it. To quickly serve the generated site so it can be previewed in your browser, run this:

$ make serve

Then visit http://localhost:8000 in your browser; you should be able to see a test site, which should look something like this:

Press Ctrl + c in the console to stop the Pelican server.

Apache Setup

Okay, now we want to configure an Apache VirtualHost [8], so that when we visit http://duncanlock.test/ in a browser, our local Apache server will serve up our local pelican development site. There are lots of reasons why this is useful, but the main one is that it’s very close to my final deployment environment - a Linux box with Apache on it. It also means that the root of the local site is /, the same as the root of the final live site, which is nice for making links work. This also allows us to do neat server configuration things and test them all locally, as we’ll see later.

If you haven’t already got Apache installed, install it:

$ sudo apt-get install apache2

Once that’s finished, save the following as a text file called duncanlock.test in /etc/apache2/sites-available/:

# domain: duncanlock.test
<VirtualHost *:80>
    # Admin email, Server Name (domain name) and any aliases
    ServerAdmin webmaster@duncanlock.test
    ServerName  duncanlock.test
    ServerAlias www.duncanlock.test

    # Index file and Document Root (where the public files are located)
    DirectoryIndex index.php index.html
    DocumentRoot /home/duncan/dev/duncanlock.net-pelican/output/
</VirtualHost>

The really crucial bit of this is the DocumentRoot - make sure this points to the /output/ folder of the Pelican site we just created - and use an absolute path.

Then add a mapping for the duncanlock.test domain to your /etc/hosts file, by adding this line somewhere:

127.0.0.1  duncanlock.test

Then enable our new virtual host in Apache:

$ sudo a2ensite duncanlock.test
$ sudo service apache2 reload

Now visiting http://duncanlock.test/ in a browser should show your local Pelican development site.

Git

It’s about time we started keeping some history of what we’re doing, so we will add our work so far to git [9] - a version control system that will keep a history of all our changes, allow easy backups and restore, moving between machines, rolling back changes - and much more.

First, create a text file called .gitignore in your website’s root folder, containing this:

output/*
*.py[cod]

This tells git to ignore everything in the output folder, and any compiled python files - we don’t need to version or backup that stuff.

Next, turn the current folder into a git repository and add our site so far:

$ git init

Initialized empty Git repository in /home/duncan/dev/duncanlock.net-pelican/.git/

$ git add .
$ git status

# On branch master
#
# Initial commit
#
# Changes to be committed:
#   (use "git rm --cached <file>..." to unstage)
#
#   new file:   .gitignore
#   new file:   Makefile
#   new file:   develop_server.sh
#   new file:   pelicanconf.py
#   new file:   publishconf.py
#   new file:   requirements.txt
#

$ git commit -m"Inital commit of duncanlock.net; quick start site with no changes, so far"
$ git status

# On branch master
nothing to commit, working directory clean

That’s it - the site is now in git, ready to be backed up onto GitHub, if you like. When you make changes, remember to do the following, so they’re stored and versioned in git:

$ git add .
$ git commit -m"Description of the changes I made."

OK, that’s it for part one - you should now have a working Pelican site, in a python virtual environment, being served by Apache via a VirtualHost on your local machine.

Coming up in Part 2:

Content creation work-flow
Creating & customizing your theme
Custom Jinja filters
Configuring your Pelican site
- Date based post URLs: /blog/2013/05/03/post-title-goes-here/
- Plugins
- Extra files to copy over
- Twitter Cards
- Favicons, sitemaps, Google Analytics,
- etc…
Performance: Web assets - minifying & compressing things, professional Apache .htaccess setup
Deploying your site to your server

Once I’ve finished part 2, I’ll link it here. If you’ve got any questions, please ask in the comments.

Footnotes & References:

*Markdown* is a text-to-HTML conversion tool for web writers. Markdown allows you to write using an easy-to-read, easy-to-write plain text format, then convert it to structurally valid XHTML (or HTML): http://daringfireball.net/projects/markdown/ ↩
*reStructuredText* is an easy-to-read, what-you-see-is-what-you-get plain text mark-up syntax and parser system. It is useful for in-line program documentation (such as Python docstrings), for quickly creating simple web pages, and for standalone documents: http://en.wikipedia.org/wiki/ReStructuredText ↩
*AsciiDoc* is a text document format for writing notes, documentation, articles, books, ebooks, slideshows, web pages, man pages and blogs. AsciiDoc files can be translated to many formats including HTML, PDF, EPUB, man page: http://www.methods.co.nz/asciidoc/ ↩
*SublimeText* is currently my favourite text editor - it’s really pretty great, you should try it. ↩
*Pip* is a package management system used to install and manage software packages written in the programming language Python. Many packages can be found in the Python Package Index (PyPI): http://en.wikipedia.org/wiki/Pip_(Python) ↩
*virtualenv* is a tool to create isolated Python environments: http://www.virtualenv.org/en/latest/ & http://www.clemesha.org/blog/modern-python-hacker-tools-virtualenv-fabric-pip/ ↩
*virtualenvwrapper* is a set of extensions to Ian Bicking’s `virtualenv` tool. Includes wrappers for creating & deleting virtual environments and managing development workflow, making it easier to work on more than one project at a time without introducing conflicts in their dependencies. http://virtualenvwrapper.readthedocs.org/en/latest/ ↩
The Apache Webserver can serve lots of different websites from the same server instance, on the same IP address. Virtual Hosts are the way it does this. You just give each one a name, a folder and a mapping in your /etc/hosts files and reload Apache. ↩
*Git* is a free and open source distributed version control system designed to handle everything from small to very large projects with speed and efficiency: http://git-scm.com/ ↩